Vol-7, Special Issue3-April, 2016, pp802-808 http://www.bipublication.com
Research Article
The Increased Gene Expression Level of TGF-
β
1Affected by Toxoplasma
gondii Lysate Product
Nader Pestechian, Hosein Khanahmad Shahreza
and Hamed Kalani3*
1,3. Department of Parasitology and Mycology,
School of Medicine, Isfahan University of Medical Sciences, Isfahan, Iran. 2. Department of Genetics, School of Medicine,
Isfahan University of Medical Sciences, Isfahan, Iran.
* Corresponding author: Hamed Kalani, E-mail: [email protected]
ABSTRACT
Background and objective: This study was designed to evaluate the gene expression level of TGF-β1 in the leukocytes of mice treated by Toxoplasma (T.) gondii tachyzoite and its products in vivo using quantitative real time-PCR (Q-PCR) method.
Materials and methods: Three T. gondii products including excretory/secretory products obtained from cell culture and cell free media as well as T. gondii lysate product were prepared. The three mentioned products as well as active tachyzoite, considered as test groups, were injected intraperitoneally to their respective groups each containing 10 inbred BALB/c mice. One control group, receiving phosphate buffered saline (PBS), was also considered. After treating, the mice were euthanized and their peritoneal leukocytes was harvested and their total RNA was extracted, converted to cDNA and the gene expression level of TGF-β1 in the test groups was compared to the control one.
Results: The findings in the present study showed that there was no significant difference statistically for the gene expression level of TGF-β1 in the groups of the ESP from cell culture medium (P=0.41), the ESP from cell free medium (P=0.25) and the active tachyzoite (P=0.37) relative to the control one. There was, of course, a statistical significant difference for the gene expression level of TGF-β1 in the TLP group (P=0.03) relative to the control one.
Conclusion: TGF-β1 upregulation affected by T. gondii lysate product suggests that this compound contains molecules that influence the gene expression level of TGF-β1. This study revealed one aspect of the interaction between host and T. gondii.
Keywords: TGF-β1, Toxoplasma gondii, Gene expression.
1. INTRODUCTION
One-third of people all of the world are thought to be infected with toxoplasmosis, the disease caused by an obligate intracellular parasitic protozoan called Toxoplasma (T.) gondii.[1] This disease is far important in the pregnant women those who are seronegative to this parasite as well as immunocompromised subjects,[1] so the production of a preventive vaccine against it is necessary; however, understanding of all aspects of host-T. gondii interactions are crucial to do it. This parasite has a lot of strains and the host immune response to them is not the same.[2] The
factor for the establishment of the life cycle of T. gondii in nature[5] in view of that the mice lack of IL-10, an antagonist for IFN-γ, will have died after challenge with T. gondii parasite due to overexpression of IFN-γ and its detrimental effects on the host.[6] On the other hand, a study revealed that the mice unable to produce IFN-γ also will have died after challenge with this parasite because of the high parasitic load in the host resulted from more rapidly replication of tachyzoites.[7] Several studies showed that T. gondii controls the host cell defensive reactions induced in response to the parasite invasion,[8]one of which is T. gondii -induced STAT3 pathway in the infected cell, leading to the reduced IFN-γ effects on the infected cell.[9] Since TGF-β has negative effects on IFN-γ, therefore, this study was designed to evaluate the effect of T. gondii tachyzoite and its products on the expression level of TGF-β1 in the mice leukocytes in vivo using quantitative real time-PCR (Q-PCR).
2. MATERIALS AND METHODS Mouse
The inbred BALB/c and outbred Swiss Webster mice were used in this study. The former was used for the experiment and the latter for the maintenance of T. gondii tachyzoite in the laboratory. The use of laboratory animals was approved by the university research ethics committee (UREC), and in accordance with local animal welfare laws, guidelines and policies.
Parasite
The genotype 1 of T. gondii tachyzoite, strain RH, was used for the experiment. The parasite was mentioned in Swiss Webster mice by inoculating of active tachyzoites into the mice peritoneal cavity. In addition, the murine fibroblast culture was used for the maintenance of this parasite in laboratory conditions.[10]
Excretory/secretory product (ESP) from cell culture medium
The whole murine peritoneal leukocytes were used for the preparation of the ESP from cell culture medium. Accordingly, Swiss Webster mice were euthanized and their peritoneal leukocytes were harvested by injecting 4 ml of
RPMI 1640 medium (Gibco Inc.) into the mice peritoneal cavity. The harvested fluids were pooled, centrifuged at 1500 ×g, 4 °C, for 10 min and the supernatant was discarded. The pelleted leukocytes were re-suspended in 5 ml of RPMI 1640 medium with penicillin (100 IU/ml) and streptomycin (100 µg/ml) (Sigma Inc.). Subsequently, about 4 × 106 leukocytes/well was poured into 24-well cell culture plates. The active tachyzoites with a proportion of 2:1 (tachyzoite: leukocyte) was added to the wells. After incubating the plates at 37 °C, 5% CO2 and 95% humidity for 48 hours, the supernatants of the wells were harvested, pooled, centrifuged at 15000 ×g, 4 °C, for 15 min and again the supernatant was harvested, then sterile filtered using 0.22-µm pore size filters (Denville Inc.) and kept at -20 °C as the ESP from cell culture medium until use. No protease inhibitor was added to this product. In addition, no serum was used in cell culture medium.
The ESP from cell free medium
A high yield of freshly harvested tachyzoites, obtained from the mice peritoneal cavity, was used for the preparation of the ESP from cell free medium. The peritoneal fluids of the infected mice were pooled, centrifuged at 1500 ×g, 4 °C, for 10 min and the pellet three times washed with RPMI 1640 medium by centrifugation. Afterwards, the tachyzoites were re-suspended in RPMI 1640 medium with penicillin (100 IU/ml) and streptomycin (100
µg/ml) and divided into smaller parts each
containing 6 × 106 tachyzoites in a centrifuge tube. The tubes were incubated at 37 °C under mid shaking for 3 hours. Subsequently, the tubes were centrifuged at 15000 ×g, 4 °C, for 15 min and their supernatants were harvested, pooled, sterile filtered using 0.22-µm pore size filters and stored at -20 °C as the ESP from cell free medium until use. No protease inhibitor was added to this product.
Toxoplasma lysate product (TLP)
penicillin (100 IU/ml) and streptomycin (100
µg/ml). About 3 × 107 tachyzoites was poured
into separate centrifuge tubes. The tubes were placed in an ultrasonic bath filled with cold water (2-4 °C) and lysed at 25 kHz, 30 s on and 10 s off for 5 min. Afterwards, the tubes were centrifuged at 15000 ×g, 4 °C, for 15 min, the supernatants were then harvested, sterile filtered via 0.22-µm pore size filters and kept at -20 °C as the TLP until use. No protease inhibitor was added to this product.
Lyophilization and protein concentration measurement
Three T. gondii products, including the ESP from cell culture medium, the ESP from cell free medium and the TLP, were lyophilized. For this objective, trehalose (Sigma Inc.) was added to these products at a proportion of 5% (w/v) and they were lyophilized in a lyophilizer. Subsequently, the lyophilized products were reconstituted in phosphate buffered saline (PBS; pH: 7.4) and their protein concentration were measured by Bradford method.[11]
Injection to mice
Injection was performed in 5 groups of 10 mice, four of which, as test groups, received the ESP from cell culture medium, the ESP from cell free medium, the TLP and active tachyzoite, separately. The first three above-mentioned groups received their respective product at doses of 100-1000 µg according to their protein concentration for 1-10 mice, respectively, at tree times and once weekly. The fourth group received 1000-10000 active tachyzoites for 1-10 mice, respectively, once only, three days before samples collection. One of the 5 groups, as control one, received the PBS at doses of
100-1000 µl for 1-10 mice, respectively, at tree times
and once weekly. The injections were carried out intraperitoneally in all of the groups. No adjuvants were used for injection.
Mice peritoneal leukocytes collection The
mice were euthanized three days after the last injection and their peritoneal leukocytes as sample were harvested with RPMI 1640 medium. The samples were centrifuged at 1500 ×g, 4 °C, for 10 min, their supernatant was discarded and 2 ml of RNAlater® solution (Qiagen Inc.) was added to each sample. The samples were then kept at -20 °C until use.
RNA extraction
Total RNA was extracted from all of the samples using Total RNA Purification Kit (Jena Bioscience Inc.) according to manufacturer instruction. In addition, genomic DNA trace was eliminated from the samples by RNase-Free DNase Set kit (Qiagen Inc.) according to the manufacturer instruction. The purity and concentration of the extracted RNA was evaluated by both gel electrophoresis on a 1% agarose gel and NanoDrop® ND-1000 spectrophotometer. The extracted samples were stored at -20 °C until use.
cDNA synthesis
The cDNA was synthesized by reverse transcription-PCR (RT-PCR) procedure. This was performed using Accu Power® Cycle Script RT PreMix (dN6) kit (Bioneer Inc.) according to the manufacturer instruction.
Primer design
Mouse TGF-β1 mRNA sequence as target gene on chromosome 7 and mouse hydroxy methyl bilane synthase (HMBS) on chromosome 9 as reference gene were extracted from the Gene Bank® home. The primers, reverse and forward, were designed for these genes using Beacon Designer™ software according to SYBR® Green method so that one primer, reverse or forward, was designed to span an exon-exon junction. The sequences of primers have been shown in Table 1.
Table1. Primer sequences designed in this study
Slope: Efficiency Sequence
Primer Accession number
Gene
-3.368: 0.976 CCGAGCCAAGGACCAGGATA
Forward NM_013551.2*
NM_001110251.1** HMBS
TCAGGTACAGTTGCCCATCTTTC Reverse
-3.397: 0.967 AACTATTGCTTCAGCTCCACAGAGA
Forward NM_011577.1
TGF-β1
TGGTTGTAGAGGGCAAGGAC Reverse
*,**
HMBS has two transcript variants, the primers were designed based on the identical region of them determined by MEGA6 software.
Quantitative real time-PCR (Q-PCR)
under study. This was carried out using Applied Biosystems Step One™ Real-Time PCR System and qPCR Green Master with UNG kit (Jena Bioscience Inc.). Times and temperatures for this purpose were: initial denaturation and polymerase activation at 95 °C for 2 min, followed by 40 cycles of denaturation at 95 °C for 15 s, annealing-extension at 60.2 °C for 45s.
3. DATA ANALYSIS
The normal distribution of the data was confirmed by the Kolmogorov–Smirnov (K–S) statistical test. The melting curve of real time-PCRs was examined for the lack of unwanted amplicons (i.e. primer dimer or cross-over contamination). Subsequently, the expression level of the target gene, TGF-β1, in the test groups was compared with the control one. The gene expression analysis and also the calculation of P-values were performed by REST-2009
software (Qiagen Inc.). In all of the groups, the standard error of mean (SEM) was calculated depending on TGF-β1 ∆Ctsfor each group.
4. RESULTS
The findings in the present study showed that there was no significant difference statistically for the gene expression level of TGF-β1 in the groups of the ESP from cell culture medium (P=0.41), the ESP from cell free medium (P=0.25) and the active tachyzoite (P=0.37) relative to the control one. There was, of course, a statistical significant difference for the gene expression level of TGF-β1 in the TLP group (P=0.03) relative to the control one. The expression level of the target gene in all of the groups under study has been shown in Figure1. The SEM values have been also presented in Table 2.
Table2. The standard error of mean (ESM) for TGF-β1 according to ∆Cts obtained for each groups under study
TLP=Toxoplasma gondii lysate product, ESP-CF=excretory/secretory product from cell free medium, ESP-CC=excretory/secretory product from cell culture medium, AT=active tachyzoite, PBS=phosphate buffered saline.
0 1 2 3 4 5 6 7 8 9 10
TLP ESP-CF ESP-CC AT
6.53*
0.55
1.54
0.7
Re
la
ti
v
e
g
en
e
e
x
p
re
ss
io
n
The groups under study
Fig.1. The relative gene expression level of TGF-β1 in the groups under study relative to the control one. Asterisk (*) means significant statistically (P<0.05). TLP, Toxoplasma gondii lysate product; ESP-CF, excretory/secretory product from the cell free medium; ESP-CC, excretory/secretory product from the cell culture medium; AT, active tachyzoite
5. DISCUSSION
During early stage of infection with T. gondii a high level of cytokines related to both type 1 and
2 of helper T-cells is secreted.[12] It has been demonstrated that T helper 1 (Th-1) cytokines, especially IFN-γ, are of main protective Average ± SEM
TLP ESP-CF ESP-CC AT PBS
cytokines against the infection developed by this parasite.[13] As noted earlier, the balance between the immune responses is crucial during the infection developed by T. gondii .[6,7] In one study, authors showed that TGF-β1-induced signaling pathway is a key factor to inhibit the central nervous system (CNS) damage during T. gondii infection.[14] Another study also revealed that the secretion of proinflamatory cytokines such as TNF-α and IL-6 are decreased affected by TGF-β1 during this infection.[15] Moreover, authors elsewhere showed that TGF-β1 is able to induce T. gondii proliferation in some and not all kinds of cell types.[16] It seems that
TGF-β1 evokes the parasite replication and decreases TNF-α production, an anti-toxoplasmiccytokine, in the infected cell.[17]
Likewise, one study revealed the results similar to the recent study.[18] In addition to the induction of T. gondii proliferation, another role of TGF-β1 during T. gondii infection seems to be the induction of apoptosis in the infected cell.[19] The findings of a study also showed that T. gondii products can effect on serum level of TGF-β1.[20] Moreover, the study conducted by Hunter et al.[21] showed that T. gondii is capable of increasing the TGF-β1 level in the infected mice; however, authors stated that no difference in the expression level of TGF-β1 was shown in the treated groups as compared to control one. Contrary to the results of the recent study, Dogruman-Al et al.[22] showed that the level of TGF-β1 in the murine model infected with T. gondii s decreased. Furthermore, the results of a study also illustrated thatTGF-β1 reduces the effect of IFN-γ during the T. gondii infection,[23] seemingly the presence of TGF-β1 at a given level is crucial to balance the immune responses in the central nervous system (CNS) of infected host to prevent the host from the detrimental effect of IFN-γ.[24] Most importantly, one study showed that T. gondii extract is capable of inducing
TGF-β1 production even in the absence of
accessory immune cells.[25] The results of the current study is also agree with the result of the recent one; however, the findings showed that only the TLP, neither the active tachyzoite nor
the ESPs from cell culture and cell free media, can increase TGF-β1 production.
6. CONCLUSION
Given the results of the aforementioned studies, it can be concluded that TGF-β1 playa multifunctional role in T. gondii infection and in the present study TGF-β1 upregulation affected by T. gondii lysate product suggests that this compound contains molecules that influence the gene expression level of TGF-β1. This study revealed one aspect of the interaction between host and T. gondii.
ACKNOWLEDGEMENT
This study was funded by the deputy of research at the Isfahan University of Medical Sciences.
REFERENCES
1) Dubey JP. The history and life cycle of Toxoplasma gondii. In: Louis M, Kim W, Kim K, eds. Toxoplasma gondii. 1st ed. UK: Elsevier; 2007.p. 1-12.
2) Araujo FG, Slifer T. Different strains of Toxoplasma gondii induce different cytokine responses in CBA/Ca mice. InfectImmun 2003;71:4171-4.
3) Bhadra R, Cobb DA, Khan IA. Donor CD8+ T cells prevent Toxoplasma gondii de-encystation but fail to rescue the exhausted endogenous CD8+ T cell population. Infect Immun 2013;81:3414-5. 4) Filisetti D, Candolfi E. Immune response to
Toxoplasma gondii. Ann I SuperSanita2004;40:71-80.
5) Blanchard N, Dunay IR, Schlüter D. Persistence of Toxoplasma gondii in the central nervous system: a fine-tuned balance between the parasite, the brain and the immune system. Parasite Immunol 2015;37:150-8.
IFN-gamma and TNF-alpha. J Immunol 1996;157:798-805.
7) Norose K, Mun HS, Aosai F, Chen M, Hata H, Tagawa Y, Iwakura Y, Yano A. Organ infectivity of Toxoplasma gondii in interferon-gamma knockout mice. J Parasitol2001;87:447-52.
8) Blader IJ, Saeij JP. Communication between Toxoplasma gondii and its host: impact on parasite growth, development, immune evasion, and virulence. APMIS 2009;117:458-6.
9) Carey AJ, Tan CK, Ulett GC. Infection-induced IL-10 and JAK-STAT: A review of the molecular circuitry controlling immune hyperactivity in response to pathogenic microbes. JAKSTAT 2012;1:159-67. 10) Daryani A, Sharif M, Kalani H, Rafiei A,
Kalani F, Ahmadpour E. Electrophoretic patterns of Toxoplasma gondii excreted/secreted antigens and their role in induction of the humoral immune response. Jundishapur J Microbiol2014;7:e9525. 11) Bradford MM. A rapid and sensitive
method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. AnalBiochem1976;72:248-54.
12) John B, Weninger W, Hunter CA. Advances in imaging the innate and adaptive immune response to Toxoplasma gondii. Future Microbiol 2010;5:1321-8. 13) Takács AC, Swierzy IJ, Lüder CG.
Interferon-γ restricts Toxoplasma gondii development in murine skeletal muscle cells via nitric oxide production and immunity-related GTPases. PLoS One 2012;7:e45440.
14) Cekanaviciute E, Dietrich HK, Axtell RC, Williams AM, Egusquiza R, Wai KM, et al. Astrocytic TGF-β signaling limits inflammation and reduces neuronal damage during central nervous system Toxoplasma infection. J Immunol2014;193:139-49. 15) Barbosa BF, Lopes-Maria JB, Gomes AO,
Angeloni MB, Castro AS, Franco PS, et al. IL10, TGF beta1, and IFN gamma modulate intracellular signaling pathways and cytokine production to control
Toxoplasma gondii infection in Be Wotrophoblast cells. Bio Reprod 2015;92:82.
16) Barbosa BF, Silva DA, Costa IN, Mineo JR, Ferro EA. BeWotrophoblast cell susceptibility to Toxoplasma gondii is increased by interferon-gamma, interleukin-10 and transforming growth factor-beta1. ClinExpImmunol 2008;151:536-45.
17) Seabra SH, de Souza W, Damatta RA. Toxoplasma gondii exposes phosphatidylserine inducing a TGF-beta1 autocrine effect orchestrating macrophage evasion. BiochemBiophys Res Commun2004;324:744-52.
18) Santos TA, PortesJde A, Damasceno-Sá JC, Caldas LA, Souza WD, Damatta RA, et al. Phosphatidylserine exposure by Toxoplasma gondii is fundamental to balance the immune response granting survival of the parasite and of the host. PLoS One 2011;6:e27867.
19) D'Angelillo A, De Luna E, Romano S, Bisogni R, Buffolano W, Gargano N, et al. Toxoplasma gondii dense granule antigen 1 stimulates apoptosis of monocytes through autocrine TGF-β signaling. Apoptosis 2011;16:551-62.
20) Abdollahi SH, Ayoobi F, Khorramdelazad H, NasiriAhmadabadi B, Rezayati M, Kazemi Arababadi M, et al. Levels of transforming growth factor-beta after immunization of mice with in vivo prepared Toxoplasma gondii excretory/secretory proteins. Jundishapur J Microbiol 2015;8:e17802.
21) Hunter CA, Bermudez L, Beernink H, Waegell W, Remington JS. Transforming growth factor-beta inhibits interleukin-12-induced production of interferon-gamma by natural killer cells: a role for transforming growth factor-beta in the regulation of T cell-independent resistance to Toxoplasma gondii. Eur J Immunol1995;25:994-1000. 22) Dogruman-AF, Fidan I, Celebi B, Yesilyurt
23) Langermans JA, Nibbering PH, Van Vuren-Van Der Hulst ME, Vuren-Van Furth R. Transforming growth factor-beta suppresses interferon-gamma-induced Toxoplasma static activity in murine macrophages by inhibition of tumour necrosis factor-alpha production. Parasite Immunol 2001;23:169-75.
24) Rozenfeld C, Martinez R, Seabra S, Sant'anna C, Gonçalves JG, Bozza M, et al. Toxoplasma gondii prevents neuron degeneration by interferon-gamma-activated microglia in a mechanism involving inhibition of inducible nitric oxide synthase and transforming growth factor-beta1 production by infected microglia. Am J Pathol 2005;167:1021-31. 25) Clemente AM,Severini C, Castronovo G,