Mapeamento cromossômico de DNAs repetitivos com fins biotecnológicos em peixes marinhos e interesse comercial - Rachycentridae e Lutjanidae

144  Download (0)

Full text

(1)
(2)

                     

MAPEAMENTO CROMOSSÔMICO DE DNAs REPETITIVOS

 

COM FINS BIOTECNOLÓGICOS EM PEIXES MARINHOS DE 

INTERESSE COMERCIAL – RACHYCENTRIDAE E LUTJANIDAE 

 

 

 

Gideão Wagner Werneck Felix da Costa 

 

 

 

                   

Orientador: Prof. Dr. Wagner Franco Molina 

     

Natal/RN 

2015

   

Centro de Biociências 

Laboratório de Genética de Recursos Marinhos 

Tese  apresentada  ao  programa  de  Pós‐

Graduação  em  Biotecnologia  ‐  Rede 

Nordeste  de  Biotecnologia  (RENORBIO) 

como 

parte 

dos 

pré‐requisitos 

(3)

                                                                                         

"Jamais considere seus estudos como uma obrigação,

mas como uma oportunidade invejável para

aprender a conhecer a influência libertadora da

beleza do reino do espírito, para seu próprio prazer

pessoal e para proveito da comunidade à qual seu

futuro trabalho pertencer."

(4)

                                                                                     

(5)

 

Aos  meus  pais  Francisco  Wagner  Felix  da  Costa  e  Maria  Evaneide  Pinheiro  da  Costa,  pela 

educação, incentivo, carinho, compreensão e por tudo que me proporcionou na vida; 

Aos  meus  irmãos  Natanael  e  Otoniel  Wagner,  pelo  convívio  familiar  e  a  Rosa  Maria  pelo 

apoio durante a jornada do doutorado, todo carinho, apoio e amor; 

Aos meus demais familiares, que torcem pelo meu sucesso; Aos mestres que um dia fizeram 

parte da minha formação; 

Aos funcionários da Universidade, que também são parte essencial no processo de ensino; 

A Rede Nordeste de Biotecnologia (RENORBIO) pela oportunidade de realizar e alcançar um 

objetivo; 

A CAPES e ao CNPq pelo apoio fornecido para o desenvolvimento do trabalho; 

Ao Professor Dr. Wagner Franco Molina, primeiro por aceitar‐me como orientando desde a 

graduação  e  agora  por  abraçar  mais  uma  vez  esta  luta  em  conjunto  comigo,  pelo  apoio, 

sugestões , ensinamentos transmitidos e pelo exemplo de profissionalismo, desempenhando 

um papel fundamental na minha formação, muito obrigado!!!!!. 

A todos do L.G.R.M, Rodrigo (Pantera), Clovis Motta, Paulo, Amanda, Karlla, Allyson, Inailson, 

Aparecida,  Juliana,  Josy  e  Jeane,  aos  amigos  que  não  estão  mais  presente  no  laboratório, 

parceiros  nas  coletas  e  análises,  espero  não  ter  esquecido  ninguém,  pelo  incentivo,  apoio, 

pelas horas de descontração e por tornar o laboratório um lugar harmonioso e descontraído; 

Aos professores Dr. Marcelo de Bello Cioffi e Dr. Luiz Antônio Carlos Bertollo, pela parceria 

nas elaborações dos artigos; 

Ao  professor  Dr.  Paulo  Marinho,  pela  participação  e  contribuição  na    qualificação,  e  por 

permitir a utilização do seu laboratório e material; 

A professora Dra. Karina Ribeiro, pela participação e contribuição na  qualificação;  

Aos professores Dr. Marcelo Nóbrega e Dra. Katia Scortecci, pela participação da banca de 

defesa e pelas contribuições; 

A todos os amigos de fora da UFRN pela parte não científica da história, afinal ela é também 

muito importante, diria até essencial, obrigado também; 

A todos aqueles que de forma direta ou indiretamente contribuíram para este momento. 

(6)

SUMÁRIO   

1. INTRODUÇÃO GERAL ...  1.1. Considerações sobre Rachycentron canadum  

1.2. Considerações sobre a família Lutjanidae  1.3. DNA repetitivo  1.4. Função dos elementos transponíveis na evolução do genoma  1.4.1. Retrotransposons  1.4.2. Transposons  2. OBJETIVOS GERAIS ...  3. OBJETIVOS ESPECÍFICOS ...  4. MATERIAIS E MÉTODOS ...  4.1. Materiais  4.2. Métodos  4.2.1. Preparações de cromossomos e células mitóticas  4.2.2. Bandamento cromossômicos  4.2.2.1. Detecção de heterocromatina constitutiva  4.2.2.2. Fluorocromos GC‐ e AT‐ específicos (MM e DAPI)  4.2.2.3. Obtenção das sondas de DNA para FISH por PCR  4.2.2.4. Obtenção de DNA Cot‐1  4.2.2.5. Oligonucleotídeos enriquecidos com microssatélites  4.2.2.6. Hibridação fluorescente in situ (FISH) 

4.2.2.7. Análise das lâminas e idiograma 

REFERÊNCIAS ...  CAPÍTULO  1:  Unusual  dispersion  of  histone  repeats  on  the  whole  chromosomal  complement  and  their  colocalization  with  ribosomal  genes  in  Rachycentron  canadum (Rachycentridae, Perciformes)... 

Resumo   Introdução  Material e Métodos  Resultados  Discussão  Referências 

CAPÍTULO  2:  Transposable  Elements  in  Fish  Chromosomes:  A  Study  in  the  Marine  Cobia Species ...  Resumo   Introdução  Material e Métodos  Resultados  Discussão  Referências  CAPÍTULO 3: Structurally complex organization of repetitive DNAs in the genome of  Cobia (Rachycentron canadum) ... 

(7)

Discussão  Referências 

CAPÍTULO 4: Dinâmica de genes ribossomais e histonas em cinco espécies da família  Lutjanidae  ... 

Resumo   Introdução 

Material e Métodos  Resultados 

Discussão  Referências 

CAPÍTULO  5:  Moderada  compartimentalização  dos  elementos  Rex1  e  Rex3  em  Pargos (Lutjanidae, Perciformes) ... 

Resumo   Introdução 

Material e Métodos  Resultados 

Discussão  Referências 

CONCLUSÕES ...  CONSIDERAÇÕES FINAIS ... 

(8)

  INTRODUÇÃO 

 

Figura 1. Fluxograma do processo produtivo em cativeiro de Rachycentron canadum. 

 

Figura 2. Representação esquemática da constituição dos microssatélites.   

Figura  3.  Representação  de  alguns  elementos  transponíveis  (DNA  Transposons  e  Retrotransposons (LTR e não‐LTR). Figura adaptada de Thomas et al. (2010). 

 

MATERIAIS E METÓDOS   

Figura 4. Rachycentron canadum (Rachycentridae). Fonte: King SailFish.   

Figura  5. Espécies  da  família  Lutjanidae, (a) Lutjanus  analis(b) Lutjanus  jocu(c)  Lutjanus alexandrei(d) Lutjanus synagris (e) Ocyurus chrysurus

 

Capítulo 1   

Figura 1. Cariótipos de R. canadum. (a) coloração com Giemsa; em destaque sítios Ag‐

RON,  FISH  18S  sobre  o  par  organizador  nucleolar  (par  2)  e  marcações  5S;  (b)  bandamento  C;  (c)  genes  das  histonas  H2B‐H2A  (verde)  e  (d)  da  histona  H3  (vermelho). Barra=5µm. 

 

Figura  2.  Idiograma  representativo  dos  cromossomos  de R.  canadum  indicando  a  distribuição do DNAhis H2A‐H2B e H3 e dos sítios ribossomais 18S e 5S.  

 

Capítulo 2   

Figura  1. Cariótipos  de R.  canadum(a)  coloração  Giemsa  e (b)  de  bandas  C  dos 

cromossomos  de  beijupirá.  Em  destaques  nas  caixas  cromossomos  Ag‐NOR‐ rolamento (par de cromossomos 2). (c, d) análises de dual color FISH da distribuição  de DNA genômico. TE Tol2 (verde) e DNAr 18S (vermelho); (d) Tol2 (vermelho) e DNAr  5S (verde) (d)(e, f) FISH com sondas Rex1 (e) e (f) Rex3. Os pares organizadores do  nucléolos estão destacados nas caixas. Barra = 5 µm. 

 

(9)

Capítulo 3   

Figura 1. Gel de Agarose de Cot‐1 do Rachycentron canadum. (M) Marcador; (1) DNA 

genômico;  (2)  DNA  genômico  depois  de  autoclavado  por  5  minutos;  (3)  DNA  Cot‐1  depois de tratamento enzimático.  

 

Figura  2.  Metáfases  de Rachycentron  canadum  coloração  com  Mitramicina/DAPI  e 

hibridização com Cot‐1, (TTAGG)n e nove sondas de microssatélites. Os cromossomos  foram contracorados com DAPI (azul). Barra=5µm. 

 

Figura 3. Ideograma dos cromossomos 2 e 3 de Rachycentron canadum. As paletas de 

cores  destaca  a  co‐localização  de  várias  sequências  repetitivas  nos  cromossomos.  Relatado  anteriormente  sequências  repetitivas,  transcricionais  e  não‐transcricional  (Jacobina  et  al.,  2011;  Costa  et  al.,  2013;  Costa  et  al.,  2014)  também  foram 

adicionados aos dados atuais.    Capítulo 4    Figura 1. Cromossomos mitóticos metafásicos de espécies de Lutjanidae hibridizados  com sondas DNAr 18S (vermelho), DNAr 5S (verde; coluna da esquerda), e DNAhis H3  (vermelho,  coluna  à  direita).  Cromossomos  foram  contracorados  com  DAPI  (azul).  Barra = 5µm. 

 

Figura 2. Distribuição das famílias multigênicas 18S, 5S e DNAhis H3 ou sítios Ag‐RONs  em  relação  aos  agrupamentos  filogenéticos  de  espécies  de  Lutjanidae  e  relógio  molecular da divergências dos clados A, B e C (modificado de Gold et al. (2011), que 

incluem as espécies ora analisadas. Os dados para as espécies com asteriscos foram  obtidos de Rocha & Molina (2008); Nirchio et al. (2008). 

(10)

 

A  espécie Rachycentron  canadum,  conhecida  popularmente  como  beijupirá  ou  cobia,  é  o 

único representante da família Rachycentridae o qual vem sendo crescentemente utilizado  na  piscicultura  marinha,  em  cultivos  intensivos.  Como  características  vantajosas,  é  de  fácil  adaptação, prolífica, possui crescimento precoce em cativeiro e elevado valor comercial. Já  as espécies da família Lutjanidae (Lutjanus synagris, Lutjanus jocu, Lutjanus analis, Lutjanus  alexandrei e Ocyurus chrysurus) representam um importante recurso pesqueiro em todas as  áreas de sua ocorrência. No Brasil a exploração comercial dos Lutjanidae que se iniciou na  década de 60 e nos anos 80 já demonstrava um declínio nos volumes de captura. Este fato  aponta  que  os  lutjanídeos  devem  possuir  um  manejo  conservativo.  Apesar  dos  potencias  econômicos,  pouco  se  conhece  sobre  as  características  genéticas  e  citogenéticas  destas  espécies,  principalmente  no  que  diz  respeito  a  análise  de  DNAs  repetitivos,  os  quais  que  representam a maior parte do genoma dos eucariotos e sendo responsaveis por importantes  papeis  evolutivos  no  genoma  dos  peixes.  Dados  citogenéticos  vem  crescentemente  sendo  empregados  em  estudos  populacionais  e  com  fins  biotecnológicos  em  peixes.  As  analises  citogenéticas  foram  realizadas  utilizando  métodos  clássicos  como  coloração  com  Giemsa,  bandamento C e Ag‐RONs, coloração com os fluorocromos base‐específicos (DAPI e MM) e  mapeamento  cromossômicos  de  sequências  repetitivas  dentre  as  quais,  sequências  teloméricas,  transposons  (Tol2),  retrotransposons  (Rex1  e  Rex3),  DNA  repetitivos  (Cot‐1  e  microssatélites) e das regiões transcricionalmente ativas dos genes ribossomais 18S e 5S e  histonas  (H2BA  e  H3),  através  da  hibridação in  situ  com  sondas  fluorescentes  (FISH).  Os  padrões  cromossômicos  obtidos  contribuíram  para  o  conhecimento  da  organização  das  sequências  repetitivas  no  genoma  das  espécies,  bem  como  a  diferenciação  cariotípica.  Padrões incomuns de expansão de sequências histônicas retratam a primeira ocorrência em  peixes marinhos. Os dados obtidos fornecem subsídios  para o conhecimento genético dos   importantes recurso pesqueiros representados pelas espécies aqui analisadas, com vistas a  auxiliar o desenvolvimento da piscicultura marinha. 

 

Palavras‐chave:  Piscicultura  marinha;  DNAs  repetitivos;  processos  biotecnológicos;  Lutjanidae; Rachycentridae 

 

(11)

ABSTRACT   

The Rachycentron  canadum  species,  commonly  known  as  beijupirá  or  cobia  is  the  only 

representative  of  Rachycentridae  family  which  has  been  increasingly  used  in  marine  fish  farming,  in  intensive  cultivation.  As  advantageous  features  it  has  easy  adaptation,  prolific  behavior,  early  growth  in  captivity  and  high  commercial  value.  Additionally,  specie  of  Lutjanidae family (Lutjanus synagrisLutjanus jocuLutjanus analisLutjanus alexandrei and  Ocyurus chrysurus) represents an important fisheries resource in all areas of its occurrence.  In Brazil, the commercial exploitation of Lutjanidae which begun in the 60's and 80's, already  has  showed  a  decline  in  catch  volumes.  This  fact  suggests  that  the  snappers  must  have  a  conservative management. Despite the economic potential, little is known about the genetic  and  cytogenetic  characteristics  of  these  species,  especially  with  respect  to  repetitive  DNA  analysis,  which  represents  the  major  part  of  the  eukaryotes  genome,  playing  important  evolutionary  roles  in  the  fish  genome.  Cytogenetic  data  is  increasingly  being  used  in  population studies and biotechnological purposes in fishes. The cytogenetical analyzes were  performed  using  classical  methods  such  as  Giemsa  staining,  C‐banding  and  Ag‐NORs,  fluorochromes  base‐specific  staining  (DAPI  and  MM)  and  physical  mapping  of  repetitive  sequences  among  which,  telomeric  sequences,  transposons  (Tol2),  retrotransposons  (Rex1  and Rex3), repetitive DNA (microsatellites and Cot‐1) and transcriptionally active regions of  the  18S  and  5S  ribosomal  genes  and  histone  (H3  and  H2BA)  by in  situ  hybridization  with  fluorescent  probes  (FISH).  The  chromosomal  patterns  obtained  contributed  to  the  organization  of  repetitive  sequences  in  the  genome  of  the  species,  as  well  as  karyotypical  differentiation. Unusual patterns of histone sequences expansion depict the first occurrence  in  marine fishes.  The  obtained  data  provided  subsides  to  the  genetic  knowledge  of  the  important fisheries resource represented by the species here analyzed, seeking the marine  pisciculture improvement. 

  

Key words: Marine Fish Farming, Repetitive DNAs, biotechnological processes, Lutjanidae,  Rachycentridae 

(12)

1. INTRODUÇÃO GERAL   

A pesca é uma atividade milenar que passou por profundas modificações no século 

XIX,  uma  vez  que  anteriormente  a  extração  de  organismos  aquáticos  era  realizada  em 

pequenas quantidades, sem grandes impactos ambientais (Marrul‐Filho, 2001). As inovações 

tecnológicas ocorridas após a Segunda Guerra Mundial provocaram uma rápida expansão da 

indústria  pesqueira  contribuindo  para  um  grande  aumento  na  produção  que  passou  de  4 

para 70 milhões de toneladas (Paes, 2002). Entretanto, a partir de 1972, a pesca marítima 

mundial começou a sinalizar queda na captura de pescado (Pauly et al., 2002). Desde 1990, 

essa  atividade  estacionou  em  torno  de  80  a  85  milhões  de  toneladas  em  que  30  milhões 

desta foram, simplesmente, descartadas (Clucas, 1997; Dulvy et al., 2004). 

Estatísticas  da  FAO  (2014)  têm  demonstrado  que  a  captura  de  espécies  aquáticas 

economicamente  viáveis  já  atingiu  a  sua  capacidade  máxima  de  suporte,  cerca  de  100 

milhões  de  toneladas  por  ano.  Isso  se  deve,  isso  se  deve  ao  esforço  de  pesca  que  vem 

aumentando  nos  últimos  anos  para  suprir  a  crescente  demanda  populacional  por  proteína 

de  origem  animal,  indicando  uma  iminente  possibilidade  do  esgotamento  destes  estoques 

pesqueiros em escala global. 

O relatório da FAO (2014) ainda coloca que a produção de pescado global através 

de capturas em 2012 foi de cerca de 91,3 milhões de toneladas, das quais aproximadamente 

87,3%  são  de  espécies  marinhas  com  vum  valor  estimado  de  faturamento  primário  de  93,9 

bilhões  de  dólares.  Quando  este  numero  é  somado  aos  números  da  produção  advinda  da 

aquicultura, obtém‐se um valor estimado de 158 milhões de toneladas de peixes produzidos 

em 2012. 

Ainda segundo a FAO (2010 e 2014), a produção mundial da pesca marinha atingiu 

um  pico  de  86,3  milhões  de  toneladas  em  1996  e  depois  diminuiu  ligeiramente  para  79,7 

milhões de toneladas em 2012, com grandes flutuações interanuais. Em 2008, o Noroeste do 

Pacífico  teve  a  maior  produção  com  20,1  milhões  de  toneladas  (25%)  da  pesca  marinha 

mundial,  seguido  pelo  Sudeste  do  Pacífico,  com  uma  captura  total  de  11,8  milhões  de 

toneladas  (15%),  Pacífico  Centro‐Oeste  com  11,1  milhões  toneladas  (14%)  e  do  Atlântico 

Nordeste, com 8,5 milhões de toneladas (11%). 

A indústria pesqueira mudou a maneira de exploração da pesca em todo o mundo, 

(13)

sustentável  (Morato et  al.,  2006;  Norse et  al.,  2012).  O  crescimento  populacional  e  o 

aumento  no  poder  de  compra  fez  com  que  a  demanda  mundial  por  pescado  crescesse, 

aumentando  a  escassez  de  peixes  na  região  da  plataforma  continental  e  impulsionando  a 

pesca industrial oceânica pelágica (Watson & Pauly, 2001). 

Visando reverter essa situação, o cultivo de organismos aquáticos constitui uma das 

alternativas mais viáveis para a continuidade de fornecimento de alimentos para população 

mundial.  Entre  1987  e  1997  a  produção  global  advinda  da  atividade  aquícola  duplicou  em 

produção e valores, assim como sua contribuição no abastecimento para demanda de peixes 

em escala mundial, representando no inicio da década um quarto da quantidade de peixes 

consumidos pela população (Cavalli & Hamilton, 2007; Cavalli et al., 2011). 

O  crescimento  da  aquicultura  pode  ser  a  solução  para  a  preservação  de  espécies 

nas quais seu potencial de exploração pela pesca já não permite um uso sustentável de seus 

estoques selvagens (Naylor et al., 2000). Segundo dados da FAO (2010), a aquicultura produz 

quase  50%  dos  peixes  consumidos pela  população,  e  esta  porcentagem  deverá  aumentar 

para  atender  à  demanda  crescente.  A  aquicultura  mundial  está  concentrada  em  regiões 

tropicais e subtropicais, com atualmente mais da metade do volume produzido proveniente 

de  águas  marinhas  e  salobras  em  regiões  costeiras  e  estuarinas,  onde  destacam‐se  a 

produção de camarões e peixes de alto valor comercial. 

O potencial do Brasil para a piscicultura marinha é enorme, tendo em vista as suas 

dimensões  continentais,  condições  climáticas  e  extensa  linha  costeira,  abrigando  portanto 

condições  edafoclimáticas,  hidrológicas  e  topográficas  muito  favoráveis.  As  práticas 

aquícolas são bastante diversificadas, com técnicas que vão desde estruturas simples como 

criações em nível familiar até iniciativas industriais de larga escala em gaiolas flutuantes no 

mar aberto (offshore) (Cavalli et al., 2011). 

As atividades aquícolas no Brasil iniciaram‐se na década de 30, intensificando‐se a 

partir  da  década  de  70.  Já  na  década  de  90  firmou‐se  no  contexto  econômico  brasileiro 

quanto  ao  fornecimento  de  alimentos,  época  na  qual  a  produção  chegava  à  cerca  25.000 

ton./ano, essa atividade vem se expandindo a cada ano no cenário nacional, estimando‐se 

que  a  produção  dos  diversos  setores  ligados  à  atividade  aquícola  tenha  ultrapassado 

210.000  toneladas  neste  século  (Sonoda,  2006).  Paradoxalmente,  a  piscicultura  marinha 

(14)

Entretanto, o desenvolvimento da biotecnologia nas ultimas décadas tem auxiliado 

a  piscicultura  moderna  através  das  técnicas  de  manipulação  cromossômicas  ou  de  genes. 

Por exemplo, marcadores moleculares vendo sendo utilizados de forma ampla em estudos 

de  variabilidade  genética  em  espécies  com  potencial  para  projetos  de  piscicultura  (Liu  & 

Cordes, 2004). 

Analisando  as  espécies  naturalmente  encontradas  no  litoral  brasileiro,  Cavalli  e 

Hamilton  (2007),  concluíram  que  o Rachycentron  canadum seria  uma  das  espécie  que 

reuniria  as  melhores  condições  para  ser  cultivada  comercialmente,  considerando  três 

critérios de seleção (mercado, potencial de crescimento e disponibilidade de tecnologia de 

cultivo). 

 

1.1. Considerações sobre Rachycentron canadum 

 

R.  canadum,  comumente  conhecido  como  beijupirá,  é  o  único  representante  da 

família Rachycentridae, raramente forma cardumes, entretanto é uma espécie abundante e 

adaptada  a  águas  tropicais  e  subtropicais  do  Atlântico  e  do  Pacífico,  sendo  portanto 

encontrada naturalmente no litoral brasileiro (Shiau, 2007; van der Velde et al., 2010).  

De  hábito  alimentar  predatório,  esta  espécie  inclui  em  sua  dieta  peixes  e 

crustáceos. Entretanto, estudos demonstram que o principal item alimentar encontrado em 

espécimes  capturadas  no  litoral  pernambucano  foram  peixes  ósseos,  com  pouquíssimos 

crustáceos.  Os  mesmos  estudos  também  revelam  que  a  ocorrência  e  a  alimentação  do 

beijupirá devem estar associadas à presença de recifes ao longo do litoral, os quais abrigam 

espécies residentes que possuem deslocamento limitados (Meyer & Franks, 1996; Arendt et 

al.,  2001;  Cavalli et  al.,  2011).  É  uma  espécie  de  comportamento  migratório  e,  por  não 

possuir bexiga natatória, apresenta hábito natatório ativo (Shaffer & Nakamura, 1989). 

A  reprodução  do  beijupirá  ocorre  preferencialmente  na  época  da  primavera  e 

verão.  Estudos  realizados  nos  Estados  Unidos  fornecem  evidências  de  que  a  desova  do R. 

canadum  ocorre  de  forma  parcelada  ao  longo  da  temporada  reprodutiva,  a  qual,  no 

hemisfério norte, se estenderia de abril a setembro (Lotz et al., 1996; Brown‐Peterson et al., 

2001), similar ao que ocorre no litoral de Pernambuco, onde a reprodução ocorre entre os 

(15)

O  potencial  aquícola  dessa  espécie  foi  primeiramente  proposto  por  Hassler  e 

Rainville (1975). No entanto, a primeira tentativa de criação do R. canadum provavelmente 

ocorreu nos anos 1970, quando pesquisadores da Carolina do Norte, EUA, coletaram ovos na 

natureza  e  conseguiram  manter  exemplares  vivos  no  laboratório  por  131  dias  (Hassler  & 

Rainville, 1975; Cavalli et al., 2011). Em 1990, pesquisadores de Taiwan obtiveram a primeira 

desova  do  beijupirá  em  cativeiro  (Liao et  al.,  2004;  Kaiser  &  Holt,  2005)  e  desde  1994, 

desovas vêm sendo obtidas rotineiramente a partir de reprodutores produzidos em cativeiro 

(Liao et al., 2004). 

Examinando  o  desempenho  reprodutivo  de  indivíduos  selvagens  de R.  canadum, 

capturados no  litoral  de  Pernambuco,  Peregrino  Jr.  (2014),  analisou  um  plantel  composto 

por  duas  fêmeas  (peso  de  14  e  16  kg)  e  quatro  machos  (cerca  de  10  kg),  mantidos  em 

cativeiro  em  um  tanque  de  70  t,  e  observou  que  entre  outubro  de  2007  e  junho  de  2008 

produziram 21 desovas espontâneas, sendo que dos 48,7 milhões de ovos produzidos, 49,3% 

foram fertilizados. Em cada desova, as fêmeas liberaram de 1,0 a 4,5 milhões de ovos (média 

de  2,5  milhões  de  ovos/desova),  confirmando  a  facilidade  de  obtenção  de  desovas 

espontâneas  em  cativeiro,  corroborando  com  o  observado  em  outros  países,  bem  como  a 

constatação de que as desovas espontâneas em cativeiro se estendem além do observado 

na natureza (Chang et al., 1999; Brown‐Peterson et al., 2001; Arnold et al., 2002; Gaumet et 

al., 2007).  

Os  bons  resultados  obtidos  proporcionaram  um  crescimento  rápido  na  produção 

comercial, assim como o desenvolvimento da tecnologia empregada na produção em massa 

de jovens, fazendo com que a reprodução em massa fosse alcançada em 1997 (Liao  et  al., 

2004).  Desta  maneira,  em  2004,  a  produção  de  beijupirá  em  Taiwan  alcançou  4.268 

toneladas, equivalendo a mais de US$ 20 milhões de dólares (Miao et al., 2009). O sistema 

de cultivo, tanques‐rede (ou gaiolas) (Figura 1) adotado em Taiwan, permitiu uma produção 

tanto  para  consumo  interno  quanto  para  a  exportação,  principalmente  para  o  mercado 

japonês (Liao & Leaño, 2007). 

 

 

 

(16)

 

   

Figura 1. Fluxograma do processo produtivo em cativeiro de Rachycentron canadum.   

Entretanto,  no  Brasil,  apesar  da  relativa  facilidade  na  obtenção  de  desovas  em 

cativeiro, a produção de alevinos em larga escala ainda é limitada. Nos poucos laboratórios 

nacionais  que  trabalham  com R.  canadum,  a  criação  de  larvas  é  realizada  intensivamente 

sob condições controladas com o uso de sistemas de manejo de água semiestáticos. Neste 

sistema  as  larvas  são  normalmente  criadas  em  água  marinha (salinidade  de  35  ppm), 

temperatura entre 26 e 29°C, fotoperíodo natural ou com 13 horas diárias de luz e aeração 

constante a uma densidade de até 10 larvas/l (Cavalli & Hamilton, 2009; Cavalli et al., 2011).  

Outras características importantes para a aquicultura também são observadas no R. 

canadum,  como  uma  relativa  tolerância  as  mudanças  de  salinidade  (Faulk  &  Holt,  2006), 

resposta positiva à tratamento de doenças por vacinação (Lin et al., 2006), adaptabilidade ao 

confinamento para o cultivo e aceitação de dietas comerciais extrusadas (Liao et  al.,  2004; 

Liao & Leaño, 2007; Craig et al., 2006). 

A  produção  aquícola  mundial  do R.  canadum  tem  aumentado  rapidamente  e  a 

(17)

2010  (Gráfico  1).  Enquanto  isso,  o  volume  de  capturas  por  meio  da  pesca  manteve‐se 

estável, em torno de 10.000 tonelada/ano (FAO, 2014). Em termos de aquicultura,  China e 

Taiwan são os principais produtores mundiais da espécie segundo estatísticas da FAO (2014). 

Outros países como o Brasil, Vietnã, Estados Unidos, Porto Rico, Belize, Bahamas, República 

Dominicana,  México,  Filipinas,  Japão,  Indonésia,  Tailândia,  Irã,  Martinica,  Panamá    e 

Austrália, veem investindo na produção de R.  canadum em cativeiro  (Liao & Leaño, 2007; 

Benetti et al., 2008; Cavalli & Hamilton, 2009; van der Velde et al., 2010; FAO 2007‐2014). 

 

 

 

 

 

 

 

 

 

 

 

Gráfico  1. Dados  globais  na  produção  em  cativeiro  de Rachycentron  canadum.  Fonte:  FAO 

(2014). 

 

Surpreendentemente,  apesar  da  grande  importância  econômica  apresentada  pelo R. 

canadum  as  informações  genética  sobre  a  espécie  ainda  são  incipientes.  Sendo  assim,  o 

presente estudo teve por objetivo contribuir com o setor produtivo, através do conjunto de 

dados citogenéticos, envolvendo métodos modernos e resolutivos. Procurou‐se a obtenção 

de subsídios para a caracterização genética da espécie, com a identificação de marcadores 

específicos que possam contribuir para programas de manejo e conservação. 

 

1.2. Considerações sobre a família Lutjanidae   

To

n

elad

(x1000)

 

(18)

Lutjanidae é um grupo composto por 17 gêneros e 120 espécies de peixes marinhos 

(Gold et  al.,  2011),  principalmente  associados  a  recifes,  um  dos  principais  recursos  para  a 

pesca  no  Nordeste  (Resende et  al.,  2003).  Representantes  desta  família  encontram‐se 

distribuídos  nos  oceanos  Atlântico,  Indico  e  Pacíficos,  mares  tropicais  e  subtropicais  do 

mundo, com poucas espécies em ambientes estuarinos (Nelson, 2006). 

A  família  é  dividida  em  quatro  subfamílias.  Três  subfamílias  menores  são 

representadas  pelos  Paradichthyinae,  com  dois  gêneros  monotípicos  (Symphorus  e 

Symphorichthys),  Etelinae,  com  cinco  gêneros  (Aphareus,  Aprion,  Etelis,  Pristipomoides e 

Rhandallichthys)  e  19  espécies,  e  Apsilinae,  com  quatro  gêneros  (ApsilusLipocheilus

Paracesio  e Parapristipomoides)  e  12  espécies.  Lutjaninae  é  a  maior  subfamília,  com  três 

gêneros monotípicos (HoplopagrusOcyurus e Rhomboplites), os gêneros Macolor e Pinjalo 

com duas espécies cada, e o gênero Lutjanus, com 64 espécies (Nelson, 2006). 

No Brasil, são relatados quatro gêneros de duas subfamílias (Etelinae e Lutjaninae), 

oito espécies do gênero Lutjanus e os gêneros monotípicos OcyurusRhomboplites e Etelis

difundidos  ao  longo  de  todo  o  litoral  brasileiro  (Menezes et  al.,  2003;  Floeter et  al.,  2003; 

Moura & Lindeman, 2007). Os Lutjanídeos são espécies de médio a grande porte capazes de 

viver  em  grandes  profundidades,  e  são  popularmente  conhecidos  como  pargos  ou 

vermelhos  (Nelson,  2006).  São  grandes  predadores,  ocupando  um  papel  importante  no 

ecossistema  marinho  (España,  2003).  A  maioria  das  espécies  desta  família  possui  um 

desenvolvimento  lento    e  um  extenso  período  de  vida  (20  a  30  anos),  e  são  altamente 

vulneráveis à sobrepesca (Polovina & Ralston, 1987; Coleman et al., 2000). 

As  espécies  desta  família  possuem  um  grande  valor  comercial,  assim  como, 

importante  recurso  para  a  comunidades  ribeirinhas  que  praticam  a  pesca  de  subsistência. 

Dentre  as  espécies  consideradas  comercialmente  importante,  podemos  citar  Lutjanus 

synagris,  Lutjanus  purpureus,  Lutjanus  analisLutjanus  jocu  e Ocyurus  chrysurus,  entre  as 

mais  valorizadas  desta  família  que  são  alvo  da  pesca  comercial  no  litoral  brasileiro, 

principalmente na região nordeste do país (Resende et al., 2003). 

Os dados sobre a pesca de Lutjanidae destacam a preocupação com a sobrepesca 

dos  estoques  comercialmente  explorados.  A  primeira  estimativa  sobre  a  captura  de 

Lutjanidae foi realizada seguindo o modelo de Schaefer (1954) considerando a produção e o 

(19)

nordeste,  no  qual  o  resultados  demonstraram  uma  produção  máxima  de  4.188  t/ano  e 

esforço ótimo de 6,0x105 pescadores‐hora (Coelho, 1974). 

Outras estimativas de captura máximas e esforço ótimo de pesca foram realizadas 

por diferentes estudos, considerando épocas e áreas de pesca distintas. Os maiores valores 

de  produção  máxima  e  esforço  de  pesca  ótimo  foram  estimados  para  a  costa 

Norte/Nordeste,  incluindo  dados  do  período  entre  1967  e  1983,  utilizando  o  método  de 

Schaefer (1954), estimando uma captura máxima de 6.791 t/ano com um esforço de pesca 

ótimo de 184,3 x 104 anzóis/dia. No final da década de 80, Ivo e  Sousa (1988), estimaram a 

captura  máxima  sustentável  de  5.937  t/ano  e  um  esforço  de  pesca  ótimo  de  2.074  x  103 

anzóis/dia, utilizando o método de Fox (1970), que leva em consideração o nível ótimo de 

esforço de captura máxima à ser mantida sem afetar a sustentabilidade do estoque. 

Atualmente, a pesca de Lutjanidae evoluiu para a estratificação e diversificação, ao 

longo  de  toda  a  costa  norte  e  nordeste  do  Brasil,  se  estendendo  até  o  sul  da  Bahia, 

contribuindo  expressivamente  nos  desembarques  controlados  destas  regiões.  Portanto, 

manejar e projetar os rendimentos destas distintas pescarias é o desafio mais relevante na 

preservação da diversidade dos estoques e, sobretudo, da atividade pesqueira, que além de 

sua relevância cultural, representa o principal sustento de muitas populações costeiras nas 

regiões onde os peixes demersais ocorrem (Resende et al., 2003; IBAMA, 2001).  

Devido ao seu alto valor econômico e importância alimentar, algumas espécies da 

família  Lutjanidae  estão  em  sobrepesca,  e  projetos  relacionados  a  aquicultura  marinha 

dessas  espécies  vem  sendo  desenvolvido  o  cultivo  de  juvens  ajude  a  reconstruir  as 

populações selvagens em programas de melhoria do estoque pesqueiro, o cultivo vem sendo 

usado de forma crescente nos Estados Unidos e em outros países como uma ferramenta de 

manejo para superar as limitações de capturas (Lorenzen et al., 2010; Saillanti et al., 2013 ). 

Apesar  da  importância  ecológica  e  econômica  das  120  espécies  conhecidas  de 

Lutjanidae,  estudos  citogenéticos  ainda  são  incipientes.  Das  espécies  conhecidas  poucas 

foram  cariotipadas,  como  por  exemplo, Lutjanus  argentimaculatus  (2n=48a)  (Raghunath  & 

Prasad,  1980),  L.  russelli  (2n=48a,  RONs  1  par)  (Ueno  &  Ojima,  1992), Lutjanus  analis 

(2n=48a, RONs 1 par), L. alexandrei (2n=48a, RONs 1 par), L. synagris (2n=48, RONs 1 par), L. 

(20)

1‐2  pares),  Ocyurus  chrysurus (2n=48a,  RONs  1  par)  (Rocha  &  Molina,  2008;  Nirchio et  al., 

2008) e Rhomboplites aurorubens (2n=48 (46a+2st), RONs 1 par) (Nirchio et al., 2009).  

Entretanto,  a  maioria  das  espécies  de  Lutjanidae,  se  conhece  apenas  o  número 

cromossômico. Dados sobre a distribuição cromossômica, a composição da heterocromatina 

constitutiva,  e  a  distribuição  de  genes  citomarcadores,  úteis  na  investigação  das  relações 

filogenéticas entre espécies dentro de uma família, ainda não foram bem analisados (Sola et 

al., 2007). 

 

1.3. DNA repetitivos   

Compreendendo cerca de 50% do genoma dos eucariotos, os DNAs repetitivos estão 

presentes  na  maioria  dos  organismos.  O  acúmulo  dessas  sequências  repetitivas  é 

responsável  pela  variação  no  tamanho  do  genoma  nos  eucariotos  (Walsh,  2001;  Lopez‐

Flores & Garrido‐Ramos, 2012). Embora não se saiba ao certo a função dos DNAs repetitivos, 

estudos  sugerem  o  envolvimento  destas  sequências  no  processo  de  replicação  de  DNA, 

recombinação,  expressão  gênica  e  na  diferenciação  de  cromossomos  sexuais  (Biet et  al., 

1999; Liu et al., 2001; Li et al., 2002; Parise‐Maltempi et al., 2007). Segundo Kidwell (2002), 

sequências repetitivas também são responsáveis pelas variações cariotípicas observadas em 

muito  grupos,  envolvidas  nos  rearranjos  cromossômicos,  tais  como  deleções,  duplicações, 

inversões e translocações recíprocas.  

Entretanto,  as  sequências  repetidas  exercem  seu  principal  papel  nos  centrômeros  e 

telômeros  dos  cromossomos  dos  eucariotos,  desempenhando  funções  importantes  na 

manutenção  e  propagação  do  material  genético,  seu  estudo  proporciona  uma  melhor 

esclarecimento  sobre  inúmeras  questões  relacionadas  a  origem  e  evolução  dos 

cromossomos sexuais e dos cromossomos B em peixes (Martins et al., 2004).  

Essas regiões, assim como, as posições intersticiais dos cromossomos, são compostas 

de heterocromatina, ricas em sequências repetidas que desempenham funções importantes 

no  comportamento  dos  cromossomos  durante  a  divisão  celular  (Csink  &  Henikoff,  1998). 

Entretanto, as sequências repetidas não é exclusividade das regiões heterocromáticas, mas 

(21)

Estudos  genéticos  e  citogenéticos  utilizando  a  técnica  de  hibridização in  situ  com 

fluorescência  (FISH),  vem  demonstrando  que  sequências  de  DNAs  repetidos  são  uma 

poderosa  ferramenta  genética  para  estudos  evolutivos,  de  transgenia,  da  origem  dos 

cromossomos  sexuais  e  cromossomos  supranumerários  em  peixes  (Costa  et  al.,  2013). 

Adicionalmente, a aquicultura moderna vem utilizando marcadores de DNAs repetidos, com 

o  objetivo  de  melhorar  traços  importantes,  como  aumento  do  crescimento,  resistência  a 

doenças,  análise  de  características  quantitativas,  cruzamentos  seletivos  e  acesso  à 

variabilidade genética das populações (Ferreira & Martins, 2008; Oleksiak, 2010; Beardmore 

et al., 2001; Jankun et al., 2007). 

Classificados de acordo com suas características, os DNAs repetidos compreendem as 

famílias  multigênicas,  as  sequências  repetidas in  tandem  e  as  sequências  dispersas  no 

genoma (Richard et al., 2008).  

As  famílias  multigênicas  são  compostas  por  sequencias  repetidas  de  DNAs 

codificadores,  a  exemplo  das  histonas  e  dos  RNAs  ribossomais,  formadas  por  eventos  de 

duplicação  durante  a  evolução  e  que  as  diferenças  observadas  hoje  entre  esses  genes  são 

produtos  de  acúmulos  de  mutações  ocorridas  ao  longo  do  tempo.  Contudo,  são  DNAs 

repetidos que possuem um número considerável de pseudogenes, mostrando semelhanças 

com  os  genes  funcionais  da  mesma  família,  entretanto,  perderam  a  capacidade  de  se 

expressar devido as mutações adquiridas (Farah, 2007; Martins, 2007; Richard et al., 2008).  

As  sequências  repetidas  in  tandem  são  classificadas  em  três  tipos,  levando  em 

consideração  o  tamanho  da  unidade  de  repetição.  Primeiramente,  são  as  sequências 

satélites,  que  consiste  em  sequências  altamente  repetidas  e  organizadas  em  cadeias, 

possuem  unidades  de  repetição  com  aproximadamente  de  100  a  300  pares  de  base  (pb), 

podendo  variar  de  1.000  a  mais  de  100.000  cópias,  estão  localizadas  principalmente  nas 

regiões  terminais  e  centroméricas  dos  cromossomos,  constituindo  o  principal  componente 

da heterocromatina (Timberlake, 1978). Os DNAs satélites foram encontrados em todos os 

genomas das espécies estudadas até o momento, podendo variar de 5% a 30% do tamanho 

genômico total (Walsh, 2001). 

O  segundo  tipo  de  sequências  organizadas in  tandem,  consiste  nos  minissatélites  ou 

sequências com número variável de repetições (VNTR – variable number of tandem repeats). 

(22)

genoma,  assim  como  agrupados  nos  telômeros.  Cada  indivíduo  apresenta  um  padrão 

particular quanto à quantidade e comprimento das cadeias de minissátelites (Jeffreys et al., 

1985).  Com  a  utilização  dos  minissatélites,  foi  possível  a  realização  de  estudos  de 

mapeamento genômico, genética de população, evolução, de seleção e melhoramento e de 

ecologia e preservação de espécies, empregando a técnica de DNA fingerprint ou impressão 

digital  do  DNA,  com  marcadores  polimórficos  capazes  de  distinguir  o  genoma  de  um 

organismo do outro (Harris & Wright, 1995). 

O  último  tipo  de  elementos  repetidos in  tandem  são  os  microssatélites,  repetições 

curtas entre 1 a 5 pb, e pelo menos 30.000 loci diferentes de microssatélites estão presentes 

em  humanos.  Estas  sequências  são  polimórficas  devido  sua  variações  em  número  de 

repetições e a alta taxa de mutação, podendo ser mono‐, di‐, tri‐ e tetranucleotídicos (Figura 

2). Por apresentarem essas características os microssatélites são utilizados em investigações 

criminais e paternidade (Ellegren, 2004; Chistiakov et al., 2006) 

 

 

 

 

 

 

 

Figura 2. Representação esquemática da constituição dos microssatélites.   

Os  microssatélites  estão  localizados  em  sua  maior  proporção  na  região 

heterocromática  do  genoma,  entretanto,  sequências  na  região  eucromática  já  foram 

relatados  (Tóth  et  al.,  2000).  Assim,  funções  importantes  vem  sendo  atribuídas  aos 

microssatélites como a participação na organização da cromatina, na replicação do DNA, na 

recombinação e na expressão gênica (Epplen et al., 1996; Biet et al., 1999; Liu et al., 2001; Li 

et  al.,  2002).  Adicionalmente,  em  consequência  da  sua  herança  ser  co‐dominante, 

proporcionam a distinção de homozigotos e heterozigotos, empregando apenas a técnica de 

PCR (Polymerase Chain Reaction) com uma limitada quantidade de DNA. Pelas características 

que apresentam, estas sequências são excelentes marcadores nos estudos de mapeamento  Mononucleotídeos  GATCCGATAAAAAAAAAAAAAACGTCGAT 

Dinucleotídeos         GCTAGCACACACACACACACACATCGATG 

Trinucleotídeos        CATCGCATCATCATCATCATCATCATGCGT 

(23)

genômico,  genética  de  populações,  epidemiologia  molecular,  patologia  e  conservação  de 

espécies (Chistiakov et al., 2006). 

A  ultima  classe  de  sequências  repetidas  de  DNA,  são  as  sequências  dispersas  no 

genoma, compreendendo dois tipos de elementos, os transposons e retrotransposons.  São 

considerados  os  principais  representantes  do  genoma  dos  eucariotos,  e  devido  a  grande 

diversidade  de  elementos  de  transposição  existente  nos  diferentes  genomas  e  distintas 

sequências  nucleotídicas  encontradas,  foi  necessário  criar  uma  classificação  que  facilitasse 

os  estudos  destas  sequências,  de  acordo  com  sua  organização  estrutural  e  mecanismo  de 

transposição (Feschotte, 2004; Martins, 2007).  

O primeiro tipo são os retrotransposons ou elementos de classe I que transpõem via 

transcrição reversa do seu RNA, e o segundo tipo são os transposons ou elementos de classe 

II  que  se  movimentam  pelo  genoma  através  de  cópias  de  DNA.  Diversas  famílias  de 

elementos transponíveis já foram identificados, por exemplo, TC1/mariner em C. elegans 

Drosophila, hobo em Drosophila e Helitrons em Arabdopsis thaliana C. elegans (Volff et al., 

1999; Volff, 2005; Martins, 2007). 

 

1.4. Funções dos elementos transponíveis na evolução do genoma   

Compondo  grande  parte  do  genoma  de  eucariotos  e  procariotos,  os  elementos 

transponíveis  são  conhecidos  por  mudarem  de  local  dentro  do  genoma,  um  processo 

conhecido como transposição, catalisado por suas próprias enzimas, a transposase. Através 

desse  movimento  de  excisão  e  inserção,  a  adição  de  cópias  em  outros  locais  do  genoma 

pode causar mutações e possíveis mudanças fenotípicas, e essas mutações podem contribuir 

com  o  aumento  da  diversidade  existente  na  natureza,  impulsionando  a  força  evolutiva 

(Böhne et al., 2008).  

Adicionalmente,  os  elementos  transponíveis  exercem  um  papel  fundamental  na 

estrutura  e  organização  dos  cromossomos  podendo  induzir  rearranjos  cromossômicos  ou 

atuando  na  prevenção  de  perdas  teloméricas,  perdendo  o  estereotipo  de  “parasita 

genético” presente no genoma (Charlesworth et al., 2001; Böhne et al., 2008). 

Em peixes, alvo de estudo do presente trabalho, uma característica importante do seu 

(24)

transposons como retrotransposons (Volff et al, 2003), muitos deles também presentes no 

genoma  de  invertebrados,  provavelmente  fruto  de  transferência  horizontal  elementos.  No 

peixe  medaka  7%  do  seu  genoma  é  composto  por  elementos  transponíveis,  Takifugu 

rubripes  e Tetraodon  nigroviridis,  contem  cerca  de  3  a  4%  do  seu  DNA  constituído  por 

transposons (Aparicio et al., 2002; Jaillon et al., 2004; Kasahara et al., 2007). 

Embora  a  diversidade  de  elementos  transponíveis  em  peixes  seja  alta  o  número  de 

cópias  de  transposons  é  aparentemente  mais  baixo  do  que  em  humanos  e  camundongo. 

Muitas classes de retrotransposons foram perdidas na linhagem dos tetrápodes e mantidas 

em  teleósteos  (Böhne et  al.,  2008).  Os  retrotransposons  encontrados  em  peixes  estão 

extremamente  compartimentalizados  e  aglomerados  nas  regiões  heterocromáticas  dos 

cromossomos,  sugerindo  uma  pressão  seletiva  contra  a  inserção  destes  elementos  em 

regiões que contenham genes ativos, evitando causar mutações e rearranjos desfavoráveis. 

Entretanto,  estudos  recentes  com  peixes  mostram  que  esses  elementos  também  se 

encontram dispersos nos cromossomos, corroborando com o que também é observado em 

mamíferos. (Volff et al., 2003; Ferreira et al 2011; Costa et al., 2013). 

Compreender a dinâmica e a evolução dos elementos transponíveis é algo de extrema 

importância, uma vez que vem encontrando aplicações em técnicas de biotecnologia como a 

transgenia  (Davidson et  al.,  2003),  permitindo  a  inserção  de  genes  no  DNA  de  outros 

organismos usando a sua propriedade de inserção e excisão (Miskey et al. 2005; Peng et al., 

2010;  Valenzano  et  al.,  2011).  Estudos  de  resistência  a  doenças  ou  para  obtenção  de 

biofármacos também vem utilizando elementos transponíveis (Rocha et al., 2003). 

 

1.4.1. Retrotransposons   

Encontrados  tanto  em  eucariotos  quanto  em  procariotos,  constituem 

aproximadamente  de  2%  do  genoma  de Drosophila  e  mais  de  40%  em  plantas,  estando 

ainda presente nos mais diversos organismos como leveduras, moscas e mamíferos. São os 

principais  responsáveis  pelo  aumento  ou  diminuição  do  tamanho  dos  genomas  dos  

organismos (Feshotte & Prithman, 2007).  Eles podem ser classificados em duas categorias, 

dependendo da estrutura nucleotídica que flanqueia a sequência:  

(25)

a. Non‐LTR retrotransposons (non‐Long Terminal Repeat): são os retrotransposons ou  retroposons. Não possuem repetições terminais longas (non‐LTR) e consistem em dois tipos, 

(1)  os  SINEs  (Short  Interspersed  Nuclear  Elements),  que  não  codificam  as  proteínas 

necessárias  para  a  transcrição  reversa  e  (2)  os  LINES  (Long  Interspersed  Nuclear  Elements

capazes  de  codificar  as  proteínas  necessárias  para  a  transcrição  reversa  (Volff et  al.,  2003; 

Volff, 2005; Richard et al., 2008). 

Com  sua  estrutura  e  modo  de  dispersão  no  genoma,  os  SINEs  formam  um  classe  de 

DNA  diferenciado  de  outros  DNAs  repetitivos,  não  apresentando  sequências  para  a 

produção dos elementos necessários a sua própria retrotransposição, sugerindo a utilização 

da  maquinaria  de  transposição  de  elementos  do  tipo  LINEs  (Smit,  1996).  São  encontrados 

em eucariotos distintos como plantas e mamíferos (Ohshima et al., 1993). Correspondendo 

cerca de 21% do genoma humanos, os elementos LINEs são encontrados em uma variedade 

de  organismos  incluindo  protistas,  plantas,  insetos,  moluscos  e  vertebrados  (Lander et  al., 

2001).  

b.  LTR  retrotransposons  (Long  Terminal  Repeats):  são  elementos  estruturalmente  semelhantes aos retrovírus, de diferente tamanhos e sequências de nucleotídeos, possuindo 

a  mesma  estrutura  básica:  uma  região  central  codificante  ORF  (Open  Reading  Frames

flanqueada por longas repetições  terminais, sendo em geral limitadas por repetições curtas 

invertidas,  como  encontradas  em  outros  tipos  de  elementos  transponíveis.  Esta  região 

codificante  possui  um  pequeno  número  de  genes,  homólogos  aos  genes  gag pol 

encontrado  em  nos  retrovírus,  capazes  de  codificar,  respectivamente,  uma  proteína 

estrutural da capsula do vírus e uma transcriptase reversa/integrasse. Esses dois genes tem 

papeis importante no processo de transposição (Böhne et al., 2008; Richard et al., 2008). As 

três  principais  famílias  de  retrotransposons  LTR  descritas  em  vertebrados  são:  Ty1/copia, 

Ty3/gypys e família BEL (Eickbush & Malik, 2002). 

 

 

 

 

 

(26)

 

 

 

 

 

 

 

 

 

 

 

 

 

Figura 3. Representação de alguns elementos transponíveis (DNA Transposons  e Retrotransposons (LTR e não‐LTR). Figura adaptada de Thomas et al. (2010). 

 

 

1.4.2. Transposons   

A segunda classe dos elementos repetidos dispersos, são os transposons de DNA, um 

componente  importante  do  genoma,  contribuindo  para  a  alta  taxa  de  mutação.  São 

divididos  em  subclasses  ou  famílias  de  acordo  com  similaridade  entre  as  suas  sequências 

(Kidwell, 2002; Feshotte & Prithman, 2007; Böhne et al., 2008). 

Dependendo  da  família  dos  transposons  e  da  espécie  analisada,  o  número  de  cópias 

por genoma pode variar de 10 a milhares (Tafalla et al., 2006), podendo ser encontrados em 

diferentes  eucariotos,  sugerindo  que  esses  elementos  divergiram  cedo  durante  a  evolução 

do  genoma,  antes  mesmo  da  divergência  ocorrida  entre  as  linhagens  dos  eucariotos 

(Feschotte,  2004).  A  habilidade  de  dispersão  no  genoma  é  relacionada  ao  mecanismo  de 

transposição que varia entre os elementos. 

O  mecanismos  mais  conhecido  de  transposição  em  transposons  é  o  “cut  and  paste”, 

(27)

em  aumento  no  número  de  cópias.  Adicionalmente,  o  elemento  excisado  nem  sempre  é 

reinserido  no  genoma,  o  que  pode  levar  à  perda  da  cópia.  Entretanto,  a  mobilização  pode 

resultar  em  um  aumento  no  número  de  cópias  dos  transposons  (transposição  replicativa) 

em  duas  situações  distintas.  A  primeira,  durante  a  replicação  do  cromossomo,  quando  a 

sequência se mobiliza de uma cromátide já sintetizada para um local ainda não replicado. E 

o  segundo,  quando  o  gap  originado  pela  mobilização  de  uma  cópia  é  “reconstruído”  pela 

maquinaria  de  reparo  de  DNA  do  genoma  hospedeiro,  seja  a  partir  do  cromossomo 

homólogo que também possui o transposon, por recombinação de homólogos, ou durante a 

fase S do ciclo celular, a partir da cromátide irmã (Kaufman et al., 1992; Miskey et al., 2005; 

Feschotte & Pritham, 2007). 

Os transposons podem ser classificados em três subclasses: (a) os que se movimentam 

pelo  mecanismo  de  “cut  and  paste”,  são  os  transposons  propriamente  ditos  e  são 

conhecidas  dez  famílias  para  tais  elementos:  TC1/mariner,  haT,  elemento  P, 

MuDR/Fokdback, Cacta, PiggyBac, Pif/Harbinger, Merlin, Transib e Banshee; (b) aqueles que 

utilizam  provavelmente  um  mecanismo  de  replicação  por  círculo  rolante, Helitrons;  e  (c) 

Mavericks, cujo mecanismo de transposição não está ainda bem compreendido. Todos esses 

transposons  são  encontrados  nos  eucariotos,  assim  como  nos  procariotos  (Feshotte  & 

Pritheman, 2007). 

Esses elementos podem causar mutações e afetar a expressão ou alterar a estrutura 

de  genes,  durante  o  seu  movimento  de  transposição,  o  que  pode  levar  a  uma  perda  de 

função dos genes no genoma do organismos (Kappitonov & Jurka, 2007). Entretanto, esses 

elementos  exercem  a  funções  estruturais  e  funcionais  importantes  na  evolução  genômica 

(28)

2. OBJETIVO GERAL   

Diante do que foi apresentado, o presente estudo teve por objetivo a obtenção de 

distintos marcadores cromossômicos em espécies das famílias Rachycentridae e Lutjanidae, 

contribuindo  assim  para  o  conhecimento  da  organização  genômica  dessas  espécies,  suas 

tendências  evolutivas,  com  vistas  igualmente  a  aplicações  futuras  voltadas  ao  campo  da 

(29)

 

3. OBJETIVOS ESPECÍFICOS   

Diante  das  informações  apresentadas  o  presente  trabalho  teve  como  objetivos 

específicos:    

• Investigar  a  distribuição  de  DNAr  e  DNAhis  nos  cromossomos  de  R.  canadum 

utilizando a hibridação in situ fluorescente (FISH) com sondas de DNAr 5S, 18S e 

DNAhis  H2B‐H2A  e  H3,  com  fim  de  estabelecer  a  associação  entre  essas 

sequências; 

 

• Mapear  sequências  de  DNAr  5S,  18S  e  DNAhis  H3  em Lutjanus  analisL.  jocuL. 

alexandrei,  L.  synagris  e Ocyurus  chrysurus  a  fim  de  identificar  marcadores 

citogenéticos e inferências filogenéticas entre as espécies; 

 

• Mapear  sequências  repetitivas  de  DNA  transponíveis  (Tol2)  e  retrotransponíveis 

(Rex1  e  Rex3)  nos  genoma  cromossômico  de R.  canadum,  com  o  intuito  de 

evidenciar  a  distribuição  e  a  associação  dessas  sequências  com  as  regiões 

heterocromáticas;  

 

• Averiguar  a  composição  heterocromática  nas  quatro  espécie  de Lutjanus  e  em O. 

chrysuru por meio de mapeamento cromossômico de sequências repetidas Rex1 

e Rex3; 

 

• Analisar  a  organização  e  a  associação  das  porções  heterocromáticas  com  DNA 

repetitivos  nos  cromossomos  de R.  canadum,  por  mapeamento  cromossômico 

(30)

Figura  5.    Espécies  da  família  Lutjanidae, (a) Lutjanus  analis(b) Lutjanus  jocu(c) Ocyurus chrysurus(d) Lutjanus synagris (e) Lutjanus alexandrei.  Barra = 10 cm. Fonte: LGRM/UFRN 

 

4. MATERIAIS E MÉTODOS   

4.1. Materiais   

Espécimes  de Rachycentron  canadum  (n=40)  (Figura  4)  foram  obtidos  a  partir  de 

criadores,  em  Porto  de  Galinhas,  no  estado  de  Pernambuco.  Já  espécies  da  família 

Lutjanidae, Lutjanus  synagris (n=10),  Lutjanus  analis (n=8),  Lutjanus  jocu (n=8),  Lutjanus 

alexandrei (n=10) e  Ocyurus  chrysurus (n=5)  (Figura  5)  foram  coletados  no  litoral  do  Rio 

Grande do Norte, Carnaubinha (5°12'49.53"S; 35°26'2.58"O) e  Barra do Rio (5°45'13.21"S; 

35°11'48.05"O).  Os  espécimes  foram  selecionados,  mediantes  suas  condições  físicas, 

acondicionadas  em  sacos  plásticos  com  adição  de  oxigênio  puro,  ate  a  sua  chegada  e 

acomodação  em  tanques,  nas  dependências  do  Laboratório  de  Genética  de  Recursos 

Marinhos da Universidade Federal do Rio Grande do Norte para posterior desenvolvimento 

das práticas citogenéticas. 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Figura 4.  Rachycentron canadum (Rachycentridae). A imagem não está em 

(31)

   

4.2. Métodos   

4.2.1. Preparações de cromossomos e células mitóticas   

Após estimulação da divisão celular por meio da inoculação de agentes mitogênicos 

nos  indivíduos  por  24‐48  horas  (Molina  et  al.,  2010),  os  animais  foram  eutanasiados 

utilizando óleo de cravo, para retirada do tecido renal adequados às análises citogenéticas.  

Fragmentos  de  tecido  renal  foram  imersos  em  meio  de  cultura  RPMI  1640  de 

acordo com a técnica in vitro preconizada por Gold et al. (1990), onde sucintamente, foram 

dissociados em 10 ml de meio de cultura RPMI 1640 através de aspirações com seringas de 

vidro de 10 ml até obter um mistura homogênea, onde foi adicionado aproximadamente 125 

µl  de  colchicina  0,025%,  deixando  agir  por  28  minutos  em  temperatura  ambiente. 

Posteriormente, o  material  foi  centrifugado  por  10  minutos  à  900  rpm.  Após  descarte  do 

sobrenadante,  foi  adicionado  10  ml  da  solução  hipotônica  de  KCl  à  0,075M,  que  após  ser 

homogeneizada agiu por 30 minutos em temperatura ambiente. A suspensão celular foi pré‐

fixada com 125 µl de fixador de Carnoy [Metanol e Ácido acético (3:1)] recém–preparado e 

mantido  à  ‐20oC.  Após  homogeneização, a  suspensão  foi  centrifugada  por  10  minutos.  O 

processo de fixação do material foi repetido por três vezes com 6 ml de fixador Carnoy à ‐

20˚C antes das suspensões celulares serem estocadas à ‐20oC em tubos Eppendorf de 2,5 ml. 

 

4.2.2. Bandamento cromossômicos   

A partir da suspensão celular obtida pelos procedimentos supracitados, foi realizada 

a  caracterização  cariotípica  dos  espécimes  com  uso  de  coloração  convencional.  Após 

preparação de lâminas coradas com Giemsa 5% em tampão fosfato (pH 6,8), as metáfases 

foram  selecionadas  para  definir  o  número  diploide  e  confecção  do  cariótipos  dos  animais 

analisados.  Os  cromossomos  foram  classificados  morfologicamente  de  acordo  com  a 

literatura e organizados no cariótipo em ordem decrescente de tamanho conforme proposto 

(32)

 

4.2.2.1. Detecção de heterocromatina constitutiva   

A  análise  das  regiões  heterocromáticas  foi  realizada  através  do  bandamento‐C, 

segundo  Sumner  (1972).  Foram  utilizadas  lâminas  com  material  envelhecido  em  estufa  a 

37°C  por  no  mínimo  3  dias,  após  esse  período  a  lâmina  foi  imersa  em  HCl  0,2  N  por  14 

minutos  em  temperatura  ambiente,  sendo  lavada  com  água  destilada  e  seca. 

Posteriormente a lâmina foi mergulhada em uma solução a 5% de Ba(OH)2.8H2O à 42°C por 

cerca de 1 minuto e 45 segundos sendo rapidamente lavadas em HCl 0,1N e posteriormente 

água destilada. Após secar ao ar, a lâmina foi então imersa em solução salina 2xSSC à 60°C 

em estufa por 40 minutos. Para análise o material foi corado com Giemsa 5% por 8 minutos. 

 

4.2.2.2. Fluorocromos GC ‐ e AT‐ específicos (MM e DAPI)   

Fluorocromos  base‐específicos  foram  utilizados  para  detectar  regiões  ricas  em 

pares de bases, como a mitramicina (MM) para pares de bases GC e DAPI para regiões ricas 

em pares de bases AT, de acordo com Schweizer (1976). As lâminas com suspensão celular 

foram  coradas  com  30μl  de  MM  0,5  mg/ml  cobertas  com  lamínulas  e  depositadas  em 

câmara úmida, no escuro, sendo lavadas com água destilada após 30 a 60 minutos, coradas 

com  30  μl  de  DAPI  0,3µg/ml,  cobertas  por  lamínulas  e  colocada  em  câmara  úmida,  no 

escuro,  por  15  minutos.  Posteriormente  as  lâminas  foram  lavadas  com  água  destilada  e 

montadas  com  tampão  glicerol‐Mcllvaine  pH  7,0  (1:1)  coberto  com  lamínula  e  selado  com 

esmalte incolor.  As  lâminas  foram  então  guardadas  à  4  ˚C  em  câmara  escura  e  analisadas 

após  3  dias  com  fotomicroscópio  de  epifluorescência  (OlympusTM  BX51)  com  filtros 

apropriados, em aumento de 1.000x. As preparações foram capturadas pelo sistema digital 

Olympus DP73 com uso do software CellSens Standard 1.7 Full (Olympus Optical Co. Ltd.). 

 

4.2.2.3. Obtenção das sondas de DNA para FISH por PCR   

Sondas de DNAr 5S e DNAr 18S foram obtidas por PCR a partir do DNA nuclear de R. 

(33)

e B 5’‐CAG GCT GGT ATG GCC GTA AGC‐3’ (Pendás et  al., 1994), NS1 5’‐GTA GTC ATA TGC 

TTG  TCT  C‐3’  e  NS8  5’‐TCC  GCA  GGT  TCA  CCT  ACG  GA‐3’  (White  et  al.,  1990), 

respectivamente. A primeira sonda continha uma cópia de DNAr 5S de 200pb e a segunda de 

DNAr 18S de 1400pb. A sonda de DNAr 5S foi marcada com biotina‐14‐dATP e a sonda de 

DNAr  18S  com  digoxigenina‐11‐dUTP,  ambas  por  nick  translation,  seguindo  as 

recomendações do fabricante (Roche, Mannheim, Alemanha). 

As  sondas  teloméricas  foram  obtidas  utilizando  o  primer  (TTAGGG)n,  amplificado 

segundo  Ijdo  et  al.  (1991)  e  marcadas  usando  DIG‐Nick  Translation  Mix  seguindo  a 

recomendações do fabricante (Roche, Mannheim, Alemanha). 

Sondas do DNA transponível (Tol2) foi obtido por PCR a partir do DNA nuclear de R. 

canadum, utilizando os primers Tol2 4 F 5’‐ ATA GCT GAA GCT GCT CTG ATC ‐ 3’ e Tol2 4 R 5’‐ 

CTC AAT ATG CTT CCT TAG G ‐ 3’, Tol2 5 F 5’‐ CTG CTC TGA TCA TGA AAC AG ‐ 3’ e Tol2 5 5’‐ 

CTT CCT TAG GTT TGA TGG CG ‐3’ (Kawakami & Shima 1999). Ambas as sondas continham 

cópia  de  DNA  Tol2  de  200pb.  A  sonda  amplifica  com  os  primes  Tol2  4  foi  marcada  com 

biotina‐14‐dATP  e  a  sonda  com  Tol2  5  com  digoxigenina‐11‐dUTP,  ambas  por  nick 

translation, seguindo as recomendações do fabricante (Roche, Mannheim, Alemanha). 

A amplificação do DNA retrotransponível (Rex1 e Rex3), a partir do DNA genômico 

de R. canadum  e O.  chrysurus,  foi  realizada  utilizando  os primers  Rex1  F  5’‐    TTC  TTC  AGT 

GCC  TTC  AAC  ACC  ‐  3’  e  Rex1  R  5’‐  TCC  CTC  AGC  AGA  AAG  AGT  CTG  CTC  ‐  3’,  desenhados 

para amplificar segmentos Rex1 correspondentes aos domínios de codificação 3‐7 do gene 

da transcriptase reversa (RT), e os primers Rex3 F 5’‐ CGG TGA YAA AGG GCA GCC CTG ‐ 3’ e 

Rex3  R  5’‐  TGG  CAG  ACN  GGG  GTG  GTG  GT  ‐  3’,  para  Rex3,  utilizados  para  amplificar  os 

domínios de codificação 1, 2, 2A, A e B do gene da RT, ambos desenhados a partir dos genes 

de Xiphophorus (Volff et al., 1999; Volff et al., 2000) e amplificados segundo Valente et al., 

(2011).  As  sondas  de  retrotransposons  foram  marcadas  utilizando nick  translation,  com 

biotina‐14‐dATP  para  Rex1  e  digoxigenina‐11‐dUTP  para  Rex3,  seguindo  a  recomendações 

do fabricante (Roche, Mannheim, Alemanha). 

A amplificação dos genes das histonas, a partir do DNA genômico de R. canadum 

O. chrysurus  foi realizada utilizando os primers H2BAF 5’‐CCC GAG ATG TGA TGG TAG A‐3’ e 

H2BAR 5’‐AGT ACA GCC TGG ATG TTT GGT AA, para H2A‐H2B, e os primers H3F 5’‐ATG GCT 

Figure

Figura 1. Fluxograma do processo produtivo em cativeiro de Rachycentron canadum.   

Figura 1.

Fluxograma do processo produtivo em cativeiro de Rachycentron canadum. p.16
Gráfico  1.  Dados  globais  na  produção  em  cativeiro  de  Rachycentron  canadum.  Fonte:  FAO  (2014). 

Gráfico 1.

Dados globais na produção em cativeiro de Rachycentron canadum. Fonte: FAO (2014). p.17
Figura  5.    Espécies  da  família  Lutjanidae,  (a)  Lutjanus  analis;  (b)  Lutjanus 

Figura 5.

Espécies da família Lutjanidae, (a) Lutjanus analis; (b) Lutjanus p.30
Figure  1.  Karyotypes  of  R.  canadum.  A  Giemsa  staining  and  B  C‐banding  of  cobia  chromosomes. The box highlights Ag‐NOR‐bearing chromosomes (chromosome pair 2). C, D  Two‐color  FISH  analyses  of  the  genomic  distribution  of  the  DNA  TE 

Figure 1.

Karyotypes of R. canadum. A Giemsa staining and B C‐banding of cobia chromosomes. The box highlights Ag‐NOR‐bearing chromosomes (chromosome pair 2). C, D Two‐color FISH analyses of the genomic distribution of the DNA TE p.70
Figure  3  summarizes  the  distribution  pattern  of  multiple  repetitive  sequences  on  chromosomes 2 and 3 of R. canadum, which are carrying rDNA sites in this fish species.                                         

Figure 3

summarizes the distribution pattern of multiple repetitive sequences on chromosomes 2 and 3 of R. canadum, which are carrying rDNA sites in this fish species. p.86
Figure 2. Metaphase chromosomes of Rachycentron canadum stained with Mitramycin/DAPI  and  hybridized  with  Cot‐1,  (TTAGG) n   and  nine  microsatellites  probes.  The  chromosomes  were counterstained with DAPI (blue). Bar=5µm.                         

Figure 2.

Metaphase chromosomes of Rachycentron canadum stained with Mitramycin/DAPI and hybridized with Cot‐1, (TTAGG) n and nine microsatellites probes. The chromosomes were counterstained with DAPI (blue). Bar=5µm. p.87

References