Alternative splicing of tumour-related Rac1b is regulated by upstream signalling pathways

Alternative splicing of

Alternative splicing of tumour

tumour--related

related

Rac1b is regulated by upstream

Rac1b is regulated by upstream signalling

signalling

pathways

pathways

Vânia Gonçalves, Paulo Matos and Peter Jordan

Colorectal tumorigenesis

mutated

mutated Cell cycle progression

(30-35%)

The second most frequent cancer in European

countries

B

B--RafRafV600EV600E

Rac1b

Rac1b

K-Ras wt Cell cycle progression Cell survival Matos P, Oliveira C, Velho S, Gonçalves V, da Costa LT, Moyer MP, Seruca R and Jordan P. 2008. Gastroenterology. 135: 899-906 (10-15%) mutated mutated K K--RasRas

Cell cycle progression Cell survival

Rac1 is a member of the Rho-GTPases family(Rho: Ras homologue)

P

Rac1

GDP

Inactive

Inactive Rac1 GTP ActiveActive

Cell motility, adhesion and proliferation Deregulated activity Tumour progression Tumour progression Tumour progression Tumour progression

Rac1b – a Rac1 splice variant

gene RAC1 (27 kb) utr 5’ 2 3 3’ utr 1 3b 4 5 6 (57 bp) Protein Rac1b 1 Switch I Switch II 19 a.a. 211

Rac1b GDP Inactive Inactive Rac1b GTP

Active

Active

GEFs GAPs

Rac1b differs in regulation and signalling

Rac1

GDP

GDI

Cell survival Cell survival

Cell cycle progression Cell cycle progression Cytoplasm Cytoplasm Sequestration Sequestration GDI Rac1b

Rac1b is activated is activated in in vivo

vivo to much higher to much higher levels than Rac1 levels than Rac1

PAK JNK p50 RelA IkB P P

How is Rac1b splice site recognition regulated in colorectal tumour cells? GT AG 5’ splice site 3’ splice site YYYYYYYY Polypyrimidine tract A Branch point Intron Exon Exon Mutation E S E E S S ISS ISE U1

Ex: E1A / hnRNP A1 / p38 MAPK CD44 / Sam 68 / ERK MAPK

Post-translational SF modifications P Nucleus Cytoplasm GU A YYYYYYYY AG U1 snRNP SF1 U2AF 65 35 Relative SF concentration ISS SR

Genomic mutations determine exon 3b inclusion/exclusion? gene RAC1 (27 kb) utr 5’ 2 3 3’ utr 1 3b 4 5 6 (57 bp) SW480 DLD-1 HT29

Active Rac Blot:

α α α α-Rac SW480 DLD-1 HT29 Endogenous expression Rac1b Rac1 RT-PCR

Which are the regulatory sequence elements that determine exon 3b inclusion/exclusion? 3 3b ₄ H A 3 3b 4 H A 3 3b 4 H A 3 3b 4 H A 4.3 kb 1.4 kb pcDNA3-HA-RAC1 Minigene pcDNA3 HT29 SW480 Endogenous expression Rac1b Rac1 HT29 SW480 Transfected RAC1 minigene

Which splicing factors could be involved?

WB

Cotransfected with RAC1 Minigene Cotransfected with RAC1 Minigene

HT29 RT-PCR Extent of exon 3b inclusion (Log₁₀)

Hypothesis:

Antagonistic splicing factor activities regulate Rac1b splicing

R e la ti v e e x p re s s io n o f e n d o g e n o u s R a c 1 b ( L o g 1 0 ) Real-Time PCR

ASF/SF2 activates exon 3b recognition SRp20/9G8 inhibit exon 3b recognition

V e c to r S R p 5 5 S R p 2 0 A S F /S F 2 9 G 8 s iC tr l s iS R p 5 5 s iS R p 2 0 s iA S F /S F 2 s i9 G 8 R e la ti v e e x p re s s io n o f e n d o g e n o u s R a c 1 b ( L o g RT-PCR (endogenous) Overexpression Overexpression Depletion Depletion Rac1b Rac1

ASF/SF2 acts as an enhancer

ASF/SF2 acts as an enhancer of alternative Rac1b of alternative Rac1b splicing whereas SRp20 acts as a silencer

Correlation of endogenous expression levels SW480 HT29 Rac1b ASF/SF2 SRp20 SW480 HT29 Rac1 Rac1b SFRS3 SFRS1

Endogenous levels of ASF/SF2 and SRp20 transcripts and proteins correlate in two different colorectal cell lines

with the different Rac1b levels they express

SRp20 Tubulin SFRS3 PolII Western blot RT-PCR (endogenous)

How can the expression or activity of ASF/SF2 and SRp20 be regulated in colorectal cancer cells?

cytoplasm ? Cellular signals ? 3 4 RAC1 pre-mRNA 3b E S S E S E ASF/ ASF/ SF2 SRp20 4 3 3b 3 4 inclusion skipping nucleus

How can the expression or activity of ASF/SF2 and SRp20 be regulated in colorectal cancer cells?

Wnt Wnt Raf MEKK4 Ras Ras PI3K PI3K MEKK1 βcat βcat βcat βcat

Target gene transcription

MEK

ERK

Cell cycle progression Cell survival PDK MKK3/6 p38 AKTAKT MKK7 JNK

Wnt signalling pathway affects Rac1b expression R e la ti v e e x p re s s io n o f e n d o g e n o u s R a c 1 b ( L o g1 0 ) Wnt Wnt Vector TcfDN βββCatCAβ e n d o g e n o u s R a c 1 b ( L o g α αα α-GFP SRp20 Tubulin βcat βcat SRp20 ATG TATA -1606 SFSR3 (SRp20)

Potential TCF/LEF binding sites Responsive promoter region

PI3-kinase signalling pathway affects Rac1b expression R e la ti v e e x p re s s io n o f e n d o g e n o u s R a c 1 b ( L o g1 0 )

Ctrl LY 24h SB 24h Vector PTEN Vector AKT kd Vector p38 kd

1 0 ) LY294002 PI3K PI3K PTEN PTEN Ras Ras ASF/SF2 Tubulin R e la ti v e e x p re s s io n o f e n d o g e n o u s A S F /S F 2 (L o g1 0

Ctrl LY 24h SB 24h Vector PTEN Vector AKT kd Vector p38 kd

SB203580 MKK3/6 p38 MEKK4 AKT AKT

D e p le tio n o f S R P K 1 a ls o a ffe c ts R a c 1 b e x p re s s io n -0 ,2 0,0 0,2 0,4 Relative expression of endogenous Rac1b (Log₁₀)

-0

,2 0,0 0,2 0,4

Relative expression of ndogenous ASF/SF2 (Log₁₀)

-0

,4 -0,2

Relative expression of endogenous Rac1b (Log

T u b u lin S R P K 1 s iC tr l s iS R P K 1 -0 ,4 -0,2 Relative expression of endogenous s iC tr l s iS R P K 1 T u b u lin S R P K 1

Conclusions

:

Splicing factor ASF/SF2 acts as an enhancer of alternativeRac1b splicing whereas SRp20 acts as a silencer.

The levels of ASF/SF2 and SRp20 transcript and protein

The levels of ASF/SF2 and SRp20 transcript and proteincorrelate with Rac1b expression in colorectal cells.

PI3-kinase and Wnt signalling pathways synchronize theexpression of ASF/SF2 and SRp20, respectively, and

together regulate whether alternative exon 3b is included or skipped during splicing of the Rac1 pre-mRNA.

Working

model

βcat βcat PI3K PI3K AKT AKT PTEN PTEN PIP₃ PIP₂ Ras Ras WntWnt ? Transcriptional and translational modulation ? TCF/LEF mediated transcription SRPK1 SRPK1 3 4 RAC1 pre-mRNA 3b E S S E S E ASF/ ASF/ SF2 SRp20 4 3 3b 3 4 inclusion skipping ?(de)phosphorylation? SRPK1 SRPK1 ?phosphorylation?

Acknowledgements:

• Margarida Gama-Carvalho and Maria Carmo Fonseca, Harald König, Javier Cáceres, Donald Tindall, BM Burgering, Stefan Ludwig and Ulf Rapp, Chris Smith and Juan Valcárcel for providing plasmids used in this study

• FCT for the funding of this PhD

• Peter Jordan and the Onco lab for everything

Alternative splicing of

Alternative splicing of tumour

tumour--related

related

Rac1b is regulated by upstream

Rac1b is regulated by upstream signalling

signalling

pathways

pathways

Vânia Gonçalves, Paulo Matos and Peter Jordan

E ffe c t o f S F 2 a n d S R p 2 0 o n s p lic in g o f d iff e re n t m in ig e n e s Alternative vs. constitutive transcript (Log₁₀) R A C 1 m in ig e n e p G 1 1 m in ig e n e F A S m in ig e n e Vector SRp20 ASF/SF2 9G8 SRp55 Vector SRp20 ASF/SF2 9G8 SRp55 Vector SRp20 ASF/SF2 9G8 SRp55 Alternative vs. transcript (Log

Contribution of intronic regulatory elements

3b 4 KspI clone JF4c 3b KspI 4 clone JF4d 3b 4 KspI clone JF4e 3b 4 KspI clone JF4f 3b 4 KspI clone JF4

clone JF4a (+78nt Intron1 WNK2)

3b 4

KspI

clone JF4b (+78nt Intron1 BRCA1)

3b 4 KspI 3b KspI ₄ RAC NL7 RT-PCR pG11 NL7 HT29

TGGTGGGGCTGTCTGGGCGTGGCTGTGCAGTGCTGCTGAGCTAACCCCACCGTGCTTGAGATGGTGTGCTGGGTGCCGCGGTGATTCTTGGACGAGCTTGTGCATG Intron 3b mutations

SFs endogenous depletion by specific siRNAs / ASF/SF2 EMSA Probe E2.0 Probe E1.0 Probe wt Tubulin SR protein SRp55 SRp20 ASF/SF2 9G8 Pol II SFRS7 s iC tr l s iA S F /S F 2 A s iA S F /S F 2 B s iC t rl s iS R p 2 0 A s iS R p 2 0 B s iC t rl s iS R p 5 5 A s iS R p 5 5 B s iC t rl s i9 G 8 A s i9 G 8 B Western blot RT-PCR Probe E2.0 Probe E1.0 Probe wt + + + + + + + + − − − − − − − − − − − − − − − − − −− −− −− − Cold Probe − −− −− −− − ASF/ NE − − − − − − − − −−−−−−−− − − − − − − − − − − − − − − − − − − − − − − − − − −− −− −− − α α α α-ASF/SF2 ++++++++ −−−−−−−− − − − − − − − − − − − − − − − − − − − − − − − − − −− −− −− − α α α α-GFP −−−−−−−− ++++++++ + + + + + + + + − −− −− −− − − − − − − − − − − −− −− −− − − −− −− −− − − −− −− −− − −−−−−−−− − − − − − − − − − −− −− −− − − − − − − − − − − −− −− −− − ++++++++ −−−−−−−− − − − − − − − − − −− −− −− − − − − − − − − − − −− −− −− − −−−−−−−− ++++++++ + + + + + + + + − − − − − − − − − −− −− −− − − − − − − − − − − − − − − − − − − −− −− −− − −−−−−−−− − − − − − − − − − −− −− −− − − −− −− −− − − − − − − − − − ++++++++ −−−−−−−− − − − − − − − − − −− −− −− − − −− −− −− − − − − − − − − − −−−−−−−− ++++++++ ASF/SF2 -containing complex Free probe 1 11 11 11 1 1 11 11 11 1 .. 5 5 0 00 00 00 0 µ µ µ µg nucl extr 11111111 11111111 .. 11111111 11111111 5 5 0 00 00 00 0 11111111 11111111 .. 11111111 11111111 5 5 0 00 00 00 0 11111111 11111111

Which are the regulatory sequence elements that determine exon 3b inclusion/exclusion?

RAC1(Ctrl) - GTTGGAGAAACGTACGGTAAGGATATAACCTCCCGGGGCAAAGACAAGCCGATTGCC (Conserved nt) Exon 3b

Mut E1.0 - GTTGGACAAATGTACGGTAAGGATATAACCTCCCGGGGCAAAGACAAGCCGATTGCC

Mut E2.0 - GTTGGAGAAACGTACGGCAAGGATATAACCTCCCGGGGCAAAGACAAGCCGATTGCC Mut E3.0 - GTTGGAGAAACGTACGGCAAGGATATAACCACCCCGGGCAAAGACAAGCCGATTGCC GTTGGACAAACGTACGGTAAGGATATAACCTCCCGGGGCAAAGACAAGCCGATTGCC

Mut E1.1

-Mut E1.2 - GTTGGAGAAATGTACGGTAAGGATATAACCTCCCGGGGCAAAGACAAGCCGATTGCC Mut E1.C - GTTGGAGACACGTACGGTAAGGATATAACCTCCCGGGGCAAAGACAAGCCGATTGCC

Mut E2.1 - GTTGGAGAAACGTACGGTCAGGATATAACCTCCCGGGGCAAAGACAAGCCGATTGCC Mut E2.C - GTTGGAGAAACGTACGGCAAAGATATAACCTCCCGGGGCAAAGACAAGCCGATTGCC Mut E4.0 - GTTGGAGAAACGTACGGCAAGGATATAACCTCCCGGTGCTAAGACAAGCCGATTGCC Mut E5.0 - GTTGGAGAAACGTACGGCAAGGATATAACCTCCCGGGGCAAAGACATGCCGATTGCC

Alternative exon 3b contains an exonic splice Alternative exon 3b contains an exonic splice enhancer element followed by a silencer element enhancer element followed by a silencer element

Alternative vs constitutive transcript (Log₁₀) E 5 .0 E 4 .0 E 3 .0 E 2 .C E 2 .1 E 2 .0 E 1 .C E 1 .2 E 1 .1 E 1 .0 C tr l

enhancer element followed by a silencer element enhancer element followed by a silencer element

Rac1 exon 3b contains binding sites for ASF/SF2 and SRp20

250

Western blot

Probe wt Probe E1.0 Probe E2.0

250

EMSA

(electrophoretic mobility shift assay)

Alternative exon 3b is recognized by Alternative exon 3b is recognized by

ASF/SF2 and SRp20 ASF/SF2 and SRp20 anti-ASF/SF2 − −− −− −− − + + + + + + + + + ++ ++ ++ + + ++ ++ ++ + + + + + + + + + Probe wt − − − − − − − − rASF/SF2 75 + + + + + + + + − − − − − − − − − − − − − − − − − −− −− −− − − −− −− −− − + + + + + + + + − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − + ++ ++ ++ + − −− −− −− − − −− −− −− − − −− −− −− − Cold Probe − −− −− −− − rASF/SF2 75 Free probe ASF/SF2 and SRp20 ASF/SF2 and SRp20

B

B--RafRaf

K-Ras wt

Implications for colorectal tumorigenesis

Wnt Wnt βcat βcat ASF/ SF2 PI3K PI3K B B--RafRaf V600E V600E mutant mutant

Rac1b

Rac1b

Cell cycle

progression Cell survival