Journal of Agricultural Science; Vol. 11, No. 3; 2019 ISSN 1916-9752 E-ISSN 1916-9760 Published by Canadian Center of Science and Education
Gene Expression Related to Physiological Quality of Soybean Seeds
Kiliany A. A. Moreno1, Raquel M. O. Pires2, Maria L. R. Castro2, Renato C. C. Vasconcellos2,Heloisa O. Santos2 & Édila V. R. V. Pinho2 1 Biology Departament, Del Cauca University, Popayán, Colombia
2 Department of Agriculture, Lavras Federal University, Lavras, Brazil
Correspondence: Raquel M. O. Pires, Department of Agriculture, Lavras Federal University, Lavras, MG, 37200-000, Brazil. Tel: 55-31-97361-1864. E-mail: [email protected]
Received: October 31, 2018 Accepted: December 9, 2018 Online Published: February 15, 2019 doi:10.5539/jas.v11n3p370 URL: https://doi.org/10.5539/jas.v11n3p370
Abstract
Production of soybeans with high physiological quality is important to ensure the productivity of improved plant populations. The objective of this work was to select soybean genotypes for high physiological quality of seeds, through germination and vigor tests, and to study gene expression by transcripts and proteins. In a first trial, seeds of 12 soybean cultivars were evaluated and selected six cultivars with contrasting physiological quality levels. At the protein level, the isoenzyme systems alcohol dehydrogenase (ADH), malate dehydrogenase (MDH), phosphoglucose isomerase (PGI), sorbitol dehydrogenase (SDH), superoxide dismutase (SOD), catalase (CAT), isocitrate lyase (ICL), esterase (EST), glutamate oxaloacetate transferase (GOT), and heat-resistant proteins were evaluated. For the transcript levels, the real-time PCR technique (qRT-PCR) was used, and the genes coding for the SOD, CAT, MDH, PGI, ICL and PRX enzymes were studied. The germination and vigor tests classified the seeds of cultivars CD201, CA115 and MS8400 as high quality, while the cultivars Syn1263, Syn1279 and CD202 were classified as of low quality. The enzymes involved in the process such as dehydrogenase and phosphoglucose isomerase, are promising markers for assessing the physiological quality of soybean seeds. Higher expression of peroxiredoxin enzyme is related to the low physiological quality of soybean seeds.
Keywords: Glycine max, isoenzymes, transcriptomics, proteomics, germination, vigor
1. Introduction
The development of soybean cultivars with good agronomic characteristics in the sowing and grain industry has increased significantly in recent years in Brazil. Through research, genetic diversity for physiological quality has been observed among soybean cultivars. Improving studies in this line of research is important due to climatic conditions in Brazil during the seed production process. Mainly after the physiological maturity of the seeds, the high temperature and the relative humidity that can accelerate the deterioration process, which leads to the reduction of the physiological quality of seeds.
In the process of seed deterioration a few enzymes are involved that act in respiratory processes, such as alcohol dehydrogenase (ADH), malate dehydrogenase (MDH) and phosphoglucose isomerase (PGI), in addition to those related to the removal of free radicals such as superoxide dismutase (SOD) and catalase (CAT) and also those related to the degradation of reserve materials such as isocitrate lyase (ICL), among others.
In breeding programs, it has increasingly sought to improve technologies for the selection of soybean cultivars with high physiological quality of the seeds. In general, germination and vigor tests have been used in this selection process. However, knowledge at the molecular level, mainly through transcriptomic and proteomic techniques, allows advances in obtaining high-quality seed cultivars. The qualitative and quantitative determination of transcript levels related to the physiological quality of seeds allows differentiated genes to be identified and their metabolic function investigated (Kuhn et al., 2001). Studying genes related to the physiological quality of seeds has been a challenge, mainly due to its genetic control.
The objective of this study was to identify soybean genotypes for physiological quality characteristics by germination and vigor tests and to study the expression of genes, transcripts and proteins, related to the physiological quality of seeds.
jas.ccsenet.org Journal of Agricultural Science Vol. 11, No. 3; 2019
2. Material and Methods
The experiments were conducted in the Central Seed Laboratory and the experimental area of the Department of Agriculture of the Lavras Federal University (UFLA), in Lavras, MG, Brazil.
Initially, for the selection of contrasting genotypes for physiological quality, seeds of 12 conventional soybean cultivars were used: CD201, SYN1263, SYN1279, BMX Potência, UFLA1, CA115, MSoy-8400, CD215, CD202, Conquista, Savana and BRS 820, from the germplasm bank of the Lavras Federal University. For seed multiplication, a randomized complete block design with three replications was used. The experimental units consisted of 4 lines of 5m each, considering only the 2 central lines as useful area. The thinning was carried out maintaining a population of 16 plants per linear meter.
The experiment was sowed using the conventional system with previous desiccation of the weeds, before sowing the soybean, which was performed between 15th and 25th of November, 2015. The fertilization and the management were carried out according to the recommendations for the culture.
The seeds were harvested at the R8 stage (95% maturity of the seeds, with a water content of 18%). Subsequently, they were dried naturally to 12% water content. In the processing, circular sieve was used, between 5.55 mm and 6.35 mm, to standardize the seed size. They were then weighed and stored in paper bags under controlled cold chamber conditions at 10 °C until the next stage of the experiment.
Physiological tests were carried out to identify six contrasting cultivars for physiological quality: CD201, CA115, MS8400, CD202, Syn 1263 and Syn1279. These were again sowed in the field for seed maintenance and multiplication. In addition, they were evaluated for physiological quality, and proteins and transcripts expression. For the germination and accelerated aging tests, the seeds were treated with Vitavax Thiram 200SC fungicide at 250 ml/kg of seeds dosage. 200 seeds per cultivar were used in both tests.
In the germination test, the seeds were sowed on Germitest paper moistened with distilled water in the proportion of 2.5 times the weight of the paper, aiming an adequate moistening and uniformity of the test. The seeds remained in the germinator at 25 ºC. Evaluations were performed at five days (first count) and eight days (final count), computing the percentage of normal seedlings, according to the criteria established in the Brazilian Rules for Seed Analysis (Brasil, 2009)
For the accelerated aging test, gerbox minicameras were used, in which 42g of seeds were distributed on a screen suspended inside the box containing 40 mL of water and submitted to 42 ºC for 72 and 82 hours. Afterward the germination test was carried out. A single reading was performed on the fifth day after sowing, and the percentage of normal seedlings was computed (Brasil, 2009).
Controlled deterioration was evaluated using samples of 42 grams of seeds, for each cultivar. These were artificially moistened until reaching a water content of 15%, according to Rossetto and Marcos Filho (1995), and placed in hermetically sealed plastic coated aluminum sachets. These were kept in a water bath at 40 °C for 48 hours. Then, a germination test was performed, and evaluated on the fifth day after sowing, according to the previous item (ISTA, 1995; Rosseto & Marcos Filho, 1995).
For the electrical conductivity test, four replicates of 50 seeds were used for each cultivar, apparently intact and then weighted. They were then placed in plastic cups with a capacity of 200 ml containing 75 ml of deionized water for 24 hours at 25 °C. The conductivity of the seed soak solution of each cultivar was measured by means on a CD 21A (DIGIMED) conductivity equipment, and the results were expressed in μS/cm/g of seeds (Vieira & Carvalho, 1994).
Statistical analysis was performed using the Sisvar software (Ferreira, 2011) and the data were interpreted through the analysis of variance. The Scott-Knott test was used at 5% probability, for comparison of means. After the harvest, part of the seeds was immediately conditioned in liquid nitrogen and stored at -80 °C for further analysis of gene expression related to the physiological quality of seeds. The real-time PCR (qPCR) technique was used for the transcripts analysis and the technique of electrophoresis for protein analysis.
In the gene expression analysis, an amount of 50 seeds per treatment/cultivar, was removed and conditioned in the deep freezer for later analysis of the activities of the main enzymes of the seed metabolism.
The crude enzymatic extracts were obtained by the maceration of the seeds in the presence of PVP (polyvinylpyrrolidone) and liquid nitrogen, and later stored at -86 ºC.
jas.ccsenet.org Journal of Agricultural Science Vol. 11, No. 3; 2019
The electrophoretic run was performed in a discontinuous system of 7.5% polyacrylamide gels (separator gel) and 4.5% (concentrator gel). The gel/electrode system used was Tris-glycine pH 8.9. 50 μl of the sample supernatant was applied to the gel well and the run performed at 150 V for 5 hours.
At the end of the run, the gels were developed for the enzymes alcohol dehydrogenase (ADH-EC 1.1.1.1), malate dehydrogenase (MDH-EC 1.1.1.37), Esterase (EST-EC 3.1.1.1), Catalase (CAT-EC 1.11.1.6), Superoxide dismutase (SOD-EC 1.15.1.1), Isocitrate lyase (ICL-EC 4.1.3.1), glutamate dehydrogenase (GTDH-EC 1.4.1.2), phosphoglucose isomerase (PGI), sorbitol dehydrogenase (SDH) and LEA proteins. The gels for each enzyme were evaluated on a transilluminator, considering the intensity variation of the bands, as well as their absence and presence.
The extraction of RNA was performed by maceration of five seeds of each cultivar, in liquid nitrogen. Afterward, all the materials used were previously submitted H2O treated with 0.1% DEPC (diethylpyrocarbonate) to inhibit the action of the RNAs enzymes. The total RNA was extracted in two biological replicates for each sample using PureLink Plant RNA reagent (Invitrogen) according to the manufacturer’s recommendations and, for 0.1 g of the seeds, 500 μL of PureLink Plant RNA, vortexed for 20 seconds and maintained in the horizontal position for 5 min, for better homogenization of the material. The material was then centrifuged at 14,000 rpm, 4 ºC for 15 min. After centrifugation, the supernatant was transferred to a new microtube, adding 300 μL of chloroform, 100 μL of potassium chloride (5M), followed by stirring.
Centrifugation was performed again at 14,000 rpm, 4 °C for 10 min. The supernatant was transferred to a new microtube with the same volume of isopropyl alcohol and the microtube held for 10 min. Subsequently, the material was centrifuged at 14,000 rpm at 4 °C for 10 min. Thereafter, the supernatant was discarded and 1 ml of 70% ethanol was added and centrifuged at 14,000 rpm at room temperature for 1 min. The supernatant was removed and the pellet dried for 10 min, which was resuspended in 20 μl of water with 0.1% DEPC and stored at -80 °C. The quantification of total RNA extracted was done in a spectrophotometer, measuring the absorbance at 260 and 280 nm, observing the wavelength ratio 260/280, whose values were in the range 1.8 to 2.0, which indicates high-quality extraction. The integrity of the RNA was also analyzed by agarose gel electrophoresis (1.5%), containing 1× TBE buffer and stained with ethidium bromide solution. The race took place at 90 V for 30 min.
The extracted RNA samples were treated with DNase (Ambion) according to the manufacturer’s instructions. To obtain the cDNA, the Hight-Capacity cDNA Reverse Transcription kit (Applied Biosystems) was used.
For the primers design, the NCBI genebank was used. Sequences of the different genes encoding the enzymes evaluated were selected. Subsequently, the primers were designed using the Primer Express 3 program (Applied Biosystems) (Table 1). GAPDH (glyceraldehyde-3-phosphate dehydrogenase) and CYP2 (peptidyl-prolylcis-transisomerase2) genes were chosen as reference for the qRT-PCR analysis.
Table 1. Primers used in the qRT-PCR analysis to selected cultivars of high and low physiological quality
Gene Primer Sequence
GAPDH F 5′ TCCAAGGGGACCTAACGGAGA 3′
GAPDH R 5′ TGGGTCAAGAGCTGGATGGTG 3′
CYP2 F 5’ CGGGACCAGTGTGCTTCTTCA 3’
CYP2 R 5’ CCCCTCCACTACAAAGGCTCG 3’
SOD F 5’ GTTGAAAAGCCA GGGGACA 3’
SOD R 5’ TCTTACCCCTTGA GCGTGG 3’ PRXF 5’ TCCTGACTATTATTTCCGCATCAC 3’ PRX R 5’ TTATCACACATGCGCTTGAATTT 3’ CAT F 5’ TGTTGCTGCAGTTGCGTACA 3’ CAT R 5’ CGGAAAACCAAGTCTCATCAACTA 3’ PGI F 5’ AACAACGGCACTGACAGTTACG 3’ PGI R 5’ GAGCACCACCCTGTTTGGTT 3’ MDH F MDH R ICL F ICL R 5’ GGCACCCTGTTTGGTGGGACA 3’ 5’ GTTGAAAAGCCA GGGGACA 3’ 5′ TGGGTCAAGAGCTGGATGGTG 3′ 5’ CGGGACCAGTGTGCTTCTTCA 3’
jas.ccsenet.org Journal of Agricultural Science Vol. 11, No. 3; 2019
Reaction conditions were 50 ºC for 2 min, 95 ºC for 10 min, 45 cycles of 95 ºC for 2 min, 62 ºC for 30 sec and 72 ºC for 30 sec. The amplification reactions were conducted in a final reaction volume of 20 μL containing: 10 μL of SYBR Green PCR Master Mix (Applied Biosystems), 2 μL cDNA (250 ng), 0.4 μL of each of the forward and reverse primers and 7.2 μL of autoclaved ultrapure water.
After amplification by real-time PCR, each amplification product was analyzed by a dissociation curve, certifying that for each gene and treatment, the amplified product had no non-specific bands and/or formation of primer dimers. Data analysis was performed using the 7500 Software SDS (Version 2.0.1) (Applied Biosystems).
3. Results and Discussion
There was a significant difference in the physiological quality of soybean seeds between cultivars by the majority of germination and vigor tests (P < 0.05) in the first experiment in which seeds of 12 cultivars were evaluated (Table 2).
Table 2. Means obtained from the physiological tests: accelerated aging (E.A), at 72 hours; accelerated aging at 82 hours; first germination count (PC%), final count of germination (GER%); controlled deterioration (D.C) at 5 and 7 days of 12 cultivars of soybean seeds of produced in the first experiment
Cultivars EA (72 hours) EA (82 hours) PC% GER (%) DC (5 days)
Syn1263 92.0 b 13.0 e 95.0 a 97.0 b 98.0 a CD 202 93.0 b 13.0 e 98.0 a 100 a 95.0 a Syn 1279 86.0 b 26.0 d 98.0 a 99.0 a 98.0 a CD 215 87.0 b 27.0 d 99.0 a 99.0 a 97.0 a BRS 820 96.0 a 30.0 d 98.0 a 98.0 a 98.0 a Conquista 93.0 b 31.0 d 91.0 b 96.0 b 94.0 a Savana 91.0 b 32.0 d 88.0 b 95.0 b 90.0 a UFLA 1 93.0 b 34.0 d 96.0 a 97.0 b 98.0 a BMX pot. 91.0 b 41.0 c 96.0 a 97.0 b 96.0 a CA 115 97.0 a 41.0 c 98.0 a 99.0 a 96.0 a CD201 100 a 63.0 b 98.0 a 99.0 a 98.0 a MS 8400 97.0 a 73.0 a 98.0 a 99.0 a 95.0 a CV% 3.88 15.39 2.77 1.73 3.10
Note. Means followed by the same lowercase letter in the column do not differ by Scott-Knott’s test, at 5%
significance.
The accelerated aging test for 82 hours allowed greater separation between cultivars. Under these conditions, higher values of vigor were observed in seeds of cultivar MS8400, followed by cultivar CD 201 and lower values were observed for cultivars Syn1263 and CD202. For the other cultivars, intermediate values were observed. When the seeds were aged for 72 hours and evaluated on the fifth day, there was less distinction among the cultivars regarding vigor.
At the first germination count, lower values were observed for the cultivars Conquista and Savana. In the final count, in addition to the cultivars Conquista and Savana classified with lower seed vigor, also the seeds of cultivars SYN 1263, UFLA 1 and BMX Potência presented low physiological quality.
In the controlled deterioration test, there was no statistical difference between the vigor values of the seeds of the twelve cultivars evaluated.
With the result analysis obtained in this first trial, and also based on the previously results in the researches of Baldoni (2013) and Menezes (2008), it was decided to select cultivars and to divide them into two groups: those that presented seeds with high physiological quality (CD201, CA115 and MS8400) and with low physiological quality (YN 1263, SYN 1279 and CD 202).
Table 3 shows the results of germination and vigor tests of the second trial, with the results of the six soybean cultivars, selected as the most contrasting.
In both the first count and the final germination count, the lowest value was verified in seeds of cultivar CD202. For the other cultivars, there was no statistically significant difference between the values. When seeds were
jas.ccsenet. submitted cultivar SY When ana physiologi the MS 8 physiologi in the phys The CD 2 quality. M observed t results wer The CA 11 On the oth but with lo by Meneze Researche germinatio situation d trait is con In the gen promoting CA115, co Figure 1. Baldoni (2 those harv consequen ethanol (Z Carvalho e quality. Th (Veiga et a Regarding evaluated. by the inte (Gasparma reactions, 2007). In a seeds. The org to artificial ag YN 1263. In th alyzing the res ical quality wi 8400 and CD ical quality. Th siological qual 01 is a conven Menezes et al.
that the cultiva re also observe 15 cultivar, cla her hand, cultiv ow vigor seeds es et al. (2009) s related to on and vigor v demonstrates th ntrolled by sev e expression a g the reduction onsidered of hi Isoenzymatic CA 11 2013) observed vested 15 day ntly with highe Zhang et al., 20 et al. (2014) f he seeds can b al., 2010). g the expressio The enzyme m erconversion o alone et al., 20 which justifie addition, as a r erefore, seeds o ging for 72 ho hese evaluation sults of electri th the conduct 202 cultivar he highest valu lity traits. ntional cultiva (2009) made ars CD201 an ed by Baldoni assified as high vars considered s, which make ) and Minuzzi the selection values in seeds he complexity eral genes and analysis, the en n of acetaldehy igher physiolo patterns in soy 15, revealed fo and m d similar resul s after the R8 er production o 008). Similar p found higher A be less suscept on of the MD malate dehydro of malate to ox 007). Thus, thi es its greater ac result of the de of lower physi Journal of A ours and 82 h ns, low vigor w ical conductiv tivity values. T rs, the first b
ues were obser ar and has been
a selection of nd MS-8400 w (2013). h quality, has t d of low qualit s their recomm et al. (2010) c of cultivars s of the same y of the geneti d influenced by nzyme alcohol yde to ethano gical quality (F ybean seeds of or the enzyme a malate dehydro lts in seeds of 8 stage, possib of acetaldehyd atterns for AD ADH expressi tible to the del DH enzyme (F ogenase (MDH xaloacetate du is enzyme assu ctivity in the f eterioration pro ological qualit Agricultural Sci
hours, the lowe was also observ vity it was ver
The lowest val eing classified rved in seeds o n used in diffe f genotypes fo were more vigo the RR 2 Bt te ty, such as Syn mendation in th cultivar CD 20
for their phy cultivars, prod c control for t y the environm l dehydrogena ol, showed hig Figure 1A). f cultivars CD2 alcohol dehydr ogenase (MDH these cultivar bly because th de, considered DH activity wer ion in soybean leterious action Figure 1B), sim H) has been as uring the cycle
umes an impor first stages of ocess, there is ty present less ience est values of v ved in seeds o rified that it w lues of electric d as high qu of cultivars CD ferent studies o or the physiol orous, as verif echnology but i n 1263 and Syn he market unfe 2 was selected ysiological qu duced in diffe this trait in soy ment.
ase (ADH), rel gher activity in
202, SYN 136 rogenase (ADH H) (Figure 1B)
rs, both in seed hey are more more toxic to re found by Vi n cultivars tha n of acetaldeh milar patterns sociated with e of tricarboxy rtant function the germinatio a compromise activity of enz vigor were ob f cultivar CD 2 was not possib cal conductivit uality and the
D 201 and CD of productivity ogical quality fied in the pre is not yet com n 1379, presen easible (Ferreir d as low quality uality traits s rent locations ybean seeds, s ated to the ana n cultivars CD
63, SYN1279, C H) (Figure 1A
ds harvested a vulnerable to the seeds, whe idigal (2009). at presented b hyde, with a hi were observe oxaloacetate b ylic acids (Kre in a wide vari on process (G e of the respira zymes related Vol. 11, No. 3; bserved in see 202. ble to associat ty were observ second with 202, also diff y and physiolo y trait of seeds esent work. Sim mmercially avai nt high product ra, 2015). In w y. how variation and harvests. suggesting tha aerobic respira D201, MS8400 CD 201, MS84 A) at the R8 stage o deterioration en compared t better physiolo igher ADH act ed for all cult biosynthesis (O ebs cycle) in p iety of biosynt Gasparmalone e atory activity o to respiration. 2019 ds of e the ed in low fering ogical s and milar ilable. tivity, works ns in This t this ation, 0 and 400, , and n and o the ogical tivity tivars OAA) plants thetic et al., of the
jas.ccsenet. The zymo enzyme w associated for energy expression Figure 2. I For the so high-quali on the met and Praka associating As for the CD 202, S the first t associated present in than acetal lipid perox Figure 3. I 115, r As for the be more a there is ox expression as having activities o org
gram for the e was higher in se d with the effec
y production d n was similar to Isoezymatic pa 115, r orbitol dehydro ty cultivars, C tabolic route o sh (1991) foun g its loss of act
results obtain Syn1263 and S to act in defe d with the high
seeds of these ldehyde, in hig xidation (Resen Isoezymatic pa revealed for th e catalase enzy active in low-q xidative stress n in the seeds o a high physi of this enzyme enzyme phosp eeds of cultiva ctiveness of the during respirat o that observed atterns in soybe revealed for th and s ogenase (SDH CD201, Ms840 of glycolysis a nd a decrease tivity with low ned for the SOD Syn1279, (Figu ense against r er SOD activit e cultivars. Th gh concentrati nde et al., 200 atterns in soybe he enzyme sup yme (CAT), w quality cultiva with consequ of the cultivar iological quali e were observe Journal of A hoglucose isom ars CD 201 an e enzyme in th ion. It is impo d in low-qualit ean seeds of cu he enzyme pho sorbitol dehydr H) enzyme (Fi 00 and CA115 and acting on t in the activity w levels of ATP D enzyme, hig ure 3A). SOD reactive oxyge ty, and it is po he hydrogen pe ons, becomes 3). ean seeds of cu eroxide dismu which removes ars, since this uent increase o s CD 202, Syn ity (Figure 3B d. Agricultural Sci merase (PGI) nd CA 115 cla he glycolysis p ortant to emph ty seeds. ultivars CD202 osphoglucose i rogenase (SDH igure 2B), the . SDH is an im the conversion y of this enzym P production. gher activity w is considered en species (R ossible that this
eroxide, forme toxic, as it can ultivars CD202 utase (SOD) (F hydrogen pero enzyme is par of reactive oxy n 1279 and MS B). In the seed ience is shown in F ssified as high process of phos hasize that in 2, SYN 1363, S somerase (PGI H) (Figure 2B) e highest activ mportant enzy n of glucose to me in maize s was observed i a free radical ROS). The low s behavior is re ed as a produc
n react formin
2, SYN1363, S Figure 3A) and
oxide, it was e rt of the first d ygen species ( S8400 was ob ds of cultivar
Figure 2A. The h quality. This sphorylation o seeds of cultiv
SYN1279, CD I) (Figure 2A)
vity was verifi yme in aerobic fructose. Bas seeds, conside n seeds classif scavenger enz w physiologica elated to the e ct of SOD, alth g hydroxyl rad SYN1279, CD d catalase (CAT expected that t defense system (ROS). In this served, being rs Syn1263 an Vol. 11, No. 3; e expression o high expressi of sugars, impo var MS 8400, D 201, MS8400 ied in seeds o c respiration, a avarajappa, Sh red of low qu fied as low qu zyme and is on al quality ma limination of R hough less rea dicals, which c
D 201, MS8400 T) (Figure 3B)
this enzyme w m of the cell w s study, the hig the latter class nd CA115, sm 2019 f this ion is ortant PGI 0, CA of the acting hetty, ality, ality, ne of ay be ROS, active cause 0, CA would when ghest sified maller
jas.ccsenet. On the oth enzyme ha systems. B In relation Syn1263 a ICL activi CD201, M but in seed Figure 4. CA In soybean metabolism enzyme in proportion lipids of th apical mer The zymo seeds of c growth an with low-q membrane These resu seeds of cu the princip occurs due Regarding observed h important cycle and g the GOT e in corn see org
her hand, Reze as been observ Baldoni (2013) n to the isocitr and Syn1279 c ity in soybean MS 8400 and C ds of cultivar C Isoenzymatic A 115, revealed n seeds, ICL m of stored lip ncreases durin n of degraded he seeds are tr ristems (Cioni ogram related cultivar CD20 nd lipid breaka quality soybea e integrity and ults may be re ultivar CD202 ple that, with e to the loss of g the expressi
higher express role in the elim gluconeogenes enzyme with th eds.
ende, Salgado, ved, being abl ) also observed ate lyase (ICL classified as o cultivars with CA115, classifi CD 202, there w
patterns in soy d for the enzym is considered pids in oilseeds ng the germin lipids occurs f ransformed int et al., 1981). to enzyme est 2, followed b age in the germ ans, a higher a seed deteriora elated to those 2, followed by the deteriorat f the integrity o on of the glu sion in seeds c mination of nit sis (Tanksley, he process of s Journal of A and Chaves (2 le to be associ d variations of L) enzyme (Fig of low physiolo h better physio ied as of high p was a greater e ybean seeds of me isocitrate ly a key enzym s and in the de nation of the for sucrose syn to soluble suga terase (EST) i by cultivars M mination proce activity of this ation (Veiga et e obtained in t cultivars MS8 ion process, l of the cell mem utamate oxalo classified as lo trogen from am 1983). Tunes seed deteriorati Agricultural Sci 2003) reported iated with the this enzyme, b gure 4A), ther
ogical quality ological quality physiological q expression of t
f cultivars CD2 yase (ICL) (Fig me in regulatin
evelopment of e seeds, obtai nthesis (Bewle ars such as suc is shown in F MS8400 and C ess, especially enzyme has b al., 2010). the conductivi 8400 and CA1 eaching of the mbranes system oacetate transa ow quality: CD mino acids, an et al. (2007) a ion. Similar re ience d that in deteri lower efficien both in high an re was a lower of seeds. Car y. In the prese quality, a high this enzyme. 202, SYN 136 gure 4A) and e g the glyoxyla f activities in g ining maximu ey & Black, 1 crose, which is Figure 4B. Hig CA 115. This y in oilseeds su been observed, ity test, where 15. The electr e cellular cons ms (Hepburn e aminase (GOT D 202, Syn12 d in the forma associated chan
esults were obs
iorated seeds, ncy of the free nd low-quality r expression in rvalho et al. (2 ent research on her expression 63, SYN1279, C esterase (EST)
ate cycle and glyoxysomes. T um values wh 994). In this c s easily displa gher expressio enzyme acts o uch as soybea , probably due e higher values rical conductiv stituents of w t al., 1984). T) enzyme (F 263 and Syn12 ation of keto gr nges in the num
served by Silva Vol. 11, No. 3; less activity o e radical scave seeds. n seeds of cult 2014) found h n seeds of cult was also obse
CD 201, MS84 (Figure 4B)
is involved in The activity o hen the maxi cycle, the inso aced to the roo on was observe
on embryonic an. In some stu e to changes in s were observ vity test is base
ater-imbibed s Figure 5A), it
279. GOT play roups for the K mber of isoform a Neta et al. (2 2019 f this enger tivars igher tivars rved, 400, n the f this mum luble t and ed in axis udies n cell ed in ed on seeds was ys an Krebs ms of 2014)
jas.ccsenet. Figure 5. In the zym observed i are expres act to main Cultivars w respiration expression high qualit the seeds o enzymes w with the p with high q In the gen cultivars S proteomic were obse There was cultivars C Figure 6. R C When ana results obs org Isoenzymatic CA 11 mogram refer in seeds of cul sed mainly du ntain the germ with seeds cla n, examples of n of the enzym ty. These enzy of these cultiva was also observ physiological q quality. e expression b SYN1279 and analysis, ther erved in seeds s no statistica CA 115 and CD Relative quanti CA115, MS84 alyzing the ab served in the p patterns in soy 15, revealed fo a rring to the ex ltivars classifie uring seed deve mination rate un assified as high f alcohol dehy mes isocitrate ly
ymes are invol ars, the expres ved. For the ca quality of the s by the qRT-PC d SYN1263, b re is also a hig of cultivars C ally significant D 202. itative expressi 400) and low p bsolute express physiological a Journal of A ybean seeds of or the enzyme g
and heat resista xpression of ed as low-qual elopment, and nder stress con h quality show ydrogenase, ma yase and estera ved in lipid m ssion of the sup
atalase, there w seeds. For hea CR technique, h both classified gher activity of CD201, CA 1 t difference b ion profile of S hysiological q sion values ob analyzes of tran Agricultural Sci f cultivars CD2 glutamate oxal ant proteins (F heat-resistant lity CD202, S their expressio nditions (Rosa wed higher exp alate dehydrog ase were also o metabolism, imp peroxide dism was no way to at-resistant pro higher express d as of low p f the SOD enz 15 and MS84 between the e
SOD genes (Fi quality soybean
bserved for th nscript and pro
ience 202, SYN 136 loacetate (GOT Figure 5B) proteins (Fig yn 1263 and S on is reduced a et al., 2005). pression of enz genase, and ph observed in see portant during mutase and glut correlate the e oteins, lower e sion of the SO physiological zyme in seeds 00, classified xpression valu
igure 6A) and C n seeds (CD20 his enzyme, th otein expressio 63, SYN1279, C T) (Figure 5A) gure 5b), high Syn 1279. Hea after germinat zymes in the p hosphoglucose eds of most cu
the seed germ tamate oxaloac expression res xpression was D gene was ob quality (Figur of these cultiv as of low phy ues of this en CAT (Figure 6 02, Syn 1279, S
here was a rel on. In seeds of Vol. 11, No. 3; CD 201, MS84 ) her expression at-resistant pro ion. These pro processes relat isomerase. H ultivars classifi mination proces
cetate transam ults of this enz s observed in s bserved in see re 6A). As in vars. Lower v ysiological qu nzyme in seed B) in high (CD Syn1263) lation between f low physiolo 2019 400, was oteins oteins ed to igher ed as ss. In inase zyme seeds ds of n the alues ality. ds of D201, n the ogical
jas.ccsenet. quality, th it is inferr requiring t The CAT were obser expected t hydrogen also showe in the valu there was results wer seed qualit For the M seed expre observed i 8400 and S not possib the highes that in the analysis of Figure (CD20 In Figure 7 Syn 1263, respiration electropho MDH and (Figures 1A Regarding classified CA 115, M is observe cultivars S comparing noted that org
ere was a grea red that in soy the expression gene (Figure 6 rved in seeds that the higher peroxide from ed higher valu ues observed in a relation whe re observed by ty and by Silva MDH gene (Fig ession of culti in seeds of cult Syn 1279. Wh le to identify a t expression w e proteomic an f transcripts, o 7. Relative qu 01, CA115, MS 7B, the transcr , followed by n process and oresis techniqu ADH, lower a A and 1B). g the expressio as high and lo MS8400 and C ed a lower exp Syn1279 and g these results there was also
ater expression ybean seeds of of this enzym 6B), is also inv of cultivars SY r the H2O2 pro m the cells. Th ues of expressio n the seeds of en comparing y Baldoni et a a Neta et al. (2 gure 7A), it wa ivars CA 115 tivars CD 201 hen comparing a relation betw was observed in
nalysis the exp nly the expres
uantitative expr S8400) and low ript expression Syn127 and l is expressed i ue (Figure 2A), activity of thes on of the ICL ow physiologi CD20, respectiv pression of IC CD202. Thes with those obs o a lower expr
Journal of A
n of SOD. This f low physiolo me for its the re volved in the f YN 1263 and C oduction by SO
hus, when ana on for the sam cultivars CA 1 CAT expressi l. (2013), work 2014), working as observed hi , CD202 and and CD 202. T these results w ween them. In t n seeds classif pression of th ssion of the gen
ression profile w physiologica n profile of PG lower express in glycolysis. , in general, th se enzymes we L gene (Figure cal seed quali vely. These cu CL in seeds of e three cultiv served in the p ression in low Agricultural Sci s enzyme is ass ogical quality moval. free radical sca CD201, classi OD, the greate alyzing the abs me cultivars. A
115, MS 8400, ions through p king with diffe g with seed dry
igher expressi CD 201, with The lowest exp with those obs the results of th fied as of high he MDH isoen ne was evaluat e of MDH gene al quality (CD2 GI is found. Th ion in cultivar When the exp he lowest activ
ere observed in e 8A), there w ity. The highe ultivars were c f Syn1263 cul vars were clas proteomic anal w-quality seeds ience sociated with t there is the gr avenging syste fied as low an er the expressio solute express lso in relation , SYN1279 an proteomic and ferent soybean ying in coffee p on in seeds of h no statistica pression was o erved in the ge he proteomic a physiological nzyme is evalu ted. es (Figure 7A) 202, Syn 1279 he highest exp r CA115. PGI pression of th ity was observ n seeds of cult were significan st expression lassified as hig ltivar, followed sified as of lo lysis by the ele s, especially in the H2O2 form reater formatio em. Higher an nd high quality on of catalase ion values ob to CAT, there nd CD202. It sh transcriptomic cultivars in th plants. f Syn 1263 cu al difference b observed in see ermination and analysis, as dis quality. It sho uated. On the ) and PG1 (Fig 9, Syn1263) for pression was ob I is an import is enzyme wa ved in low-qua tivars classifie nt differences was verified i gh-quality phy d by those ob ow physiologi ectrophoresis t n seeds of Syn Vol. 11, No. 3; mation in cells. on of free rad nd lower expre y, respectively for the remov served for SO e was no differ hould be noted c analyzes. Sim he determinatio ultivar, followe between the v eds of cultivar d vigor tests, it scussed previo ould be empha other hand, in gure 7B) in hig r soybean seed bserved in see tant enzyme in as evaluated by ality seeds. Als ed as of low qu between cult in seeds of cul ysiological see bserved in seed ical quality. W technique, it ca n1263 and Syn 2019 Thus, icals, ssion . It is val of OD, it rence d that milar on of ed by alues s MS t was ously, sized n the gh ds ds of n the y the so for uality tivars ltivar ds. It ds of When an be 1279
jas.ccsenet. cultivars. L physiologi Figure 8. R in high so Regarding seeds of cu The lowes having hig control of quality, th characteris marker for When eva that the ph correlating 4. Conclus The accel physiologi Enzymes promising Higher exp Acknowle The author Reference Baldoni, A Thesi Basavaraja chang Bewley, J. York: Brasil.(200 2009. org Lower values ical quality in Relative quant oybean seeds ( g the expressio ultivars Syn 12 st expression v gh physiologic oxidation cell he higher exp stic of this enz r selection of s aluating the res
hysiological q g, in the presen
sions
lerated aging ical quality and involved in t markers for as pression of the edgements rs especially th es A. (2013). Exp is (Ph.D. in Fit appa, B. S., S ges, associated . D., & Black, : Plenum. https 09). Ministerio . of expression research devel titative express (CD201, CA1 on of transcript 279 and Syn12 values were ob cal quality. Th l redox by its a pression of th zyme is that it i soybean cultiva sults of germin quality trait in nt study, the re test for 82 d the cultivars the respiration ssessing the ph e peroxiredoxin hank to CAPE pressão de gen totecnia), Lavr Shetty, H. S., & d with accelara , M. (1994). S s://doi.org/10.1 o da Pecuaria Journal of A of this gene w loped by Baldo sion profile of 15, MS8400) a for s ts for peroxire 263, followed b bserved in seed he PRX enzym ability to reduc his gene may is controlled b ars.
nation and vig nvolves the ex esults of transc hours classif Syn1263, Syn n process, su hysiological qu n enzyme is re S, FAPEMIG nes relacionad ras Federal Un & Prakash, H ated ageing of m Seeds: Physiolo 1007/978-1-48 a e Abastecim Agricultural Sci
were also obse oni (2013).
ICL (Figure 8 and low physio soybean seeds edoxin (PRX) by cultivar CD ds of cultivars me is part of th ce peroxide lik be associated y only a few g gor tests, and t xpression of se cripts or protein fied the cultiv n1279 and CD2 uch as dehydr
uality of soybe elated to the lo
and CNPq, for
dos com a qua
niversity, Brazi . S. (1991). M maize seeds. S ogy of develop 899-1002-8 mento (p. 395) ience erved in seeds
8A) and peroxi ological quality (Figure 8B), t D202, classified s CA 115, CD he peroxidase ke H2O2. Thus d with the re genes in plants the transcript a everal genes, ns with the phy vars CD201, 202 as low phy rogenase and ean seeds. w physiologic r partially supp alidade fisiolog il). Membrane dete Seed Science a pment and ger
). Regras para of cultivars, c redoxin (PRx) y (CD202, Syn there was a gr d as of low ph 201, and MS group, which , in seeds with emoval of H2 , which charac and protein ev which explain ysiological qu CA115 and ysiological qu phosphogluco cal quality of so porting this wo gica de semen erioration and nd Technology rmination (2nd a análise de s Vol. 11, No. 3; classified as of ) genes (Figure n 1279, Syn12 reater expressio ysiological qu 8400, classifi h contributes t h low physiolo 2O2. An impo cterizes it as a valuations, it sh ns the difficul ality of seeds. MS8400 as uality. ose isomerase oybean seeds. ork. ntes de soja (p other biochem y, 19(2), 279-2 d ed., p. 445). sementes. Bra 2019 f low e 8B) 263) on in ality. ed as o the ogical ortant good hows ty of high , are p. 57, mical 286. New asilia,
jas.ccsenet.org Journal of Agricultural Science Vol. 11, No. 3; 2019
Carvalho, E. R. (2014). Alterações isoenzimáticas em sementes de cultivares de soja em diferentes condições de armazenamento. Pesquisa Agropecuária Brasileira, 38(4), 967-976. https://doi.org/10.1590/s0100-204x20 14001200007
Cioni, M., Pinzauti, G., & Vanni, P. (1981). Comparative biochemistry of the glyoxylate cycle. Comparative
Biochemistry and Physiology, 70(1), 1-26. https://doi.org/10.1016/0305-0491(81)90118-8
Ferreira, V. F. (2015). Adubação com potássio nas características agronômicas e na qualidade de sementes de
soja Lavras-MG (p. 105, Thesis (Ph.D. in Fitotecnia), Lavras Federal University, Brazil).
Gasparmalone, P. D. (2007). Expressão diferencial de isoenzimas durante o processo de germinação. Revista
Brasileira de Sementes, 29, 61-67. https://doi.org/10.1590/s0101-31222007000100009
ISTA (International Seed Testing Association). (1995). Handbook of vigor test methods. Bassersdorf.
Menezes, M. (2008). Aspectos genéticos asociados a calidad fisiológica de semillas de soya (p. 112, Thesis (Ph.D in Agronomy), Lavras Federal University, Brazil).
Menezes, M. (2009). Aspectos químicos e estruturais da qualidade fisiológica de sementes de soja. Pesquisa
Agropecuária Brasileira, 44(12), 1716-1723. https://doi.org/10.1590/s0100-204x2009001200022
Minuzzi, A. (2010). Qualidade de sementes de quatro cultivares de soja, colhidas em dois locais no estado do Mato Grosso do Sul. Revista Brasileira de Sementes, 32, 176-185. https://doi.org/10.1590/s0101-312220 10000100020
Resende, M. L. V., Salgado, S. M. L., & Chaves, Z. M. (2003). Espécies ativas de oxigênio na resposta de defesa de plantas a patógenos. Fitopatologia Brasileira, 28(2), 123-130. https://doi.org/10.1590/s0100-415820030 00200001
Rosa, S. D. V. F. (2005). Free radical-scavenging enzymes and lea proteins associated to maize seed tolerance to high drying temperature. Revista Brasileira de Sementes, 27(2), 91-101. https://doi.org/10.1590/S0101-31 222005000200014
Rossetto, C. A. V., & Marcos Filho, J. (1995). Comparação entre os métodos de envelhecimento acelerado e deterioração controlada para avaliação da qualidade fisiológica de sementes de soja. Scientia Agricola,
52(1), 99-105. https://doi.org/10.1590/s0103-90161995000100020
Silva Neta, I. C. (2014). Expressão de genes relacionados à tolerância à baixa temperatura de germinação em
sementes de milho (p. 81, Dissertação (Mestrado em Fitotecnia), Universidade Federal de Lavras, Lavras,
Brazil).
Tunes, L. M. (2007). Influence of different harvest times on isozyme expression in barley seeds. Revista Ceres,
58(2), 178-184. https://doi.org/10.1590/S0034-737X2011000200008
Veiga, A. D. (2010). Influência do potássio e da calagem na composiçao química, qualidade fisiológica e na atividade enzimática de sementes de soja. Ciência e Agrotecnologia, 34(4), 953-960. https://doi.org/10.159 0/s1413-70542010000400022
Vidigal, D. P. D. (2009). Alterações fisiológicas e enzimáticas durante a maturação de sementes de pimenta (Capsicum annuum L.). Revista Brasileira de Sementes, 31(2), 129-136. https://doi.org/10.1590/s0101-3 1222009000200015
Vieira, R., & Carvalho, N. M. (1994). Testes de vigor em sementes (pp. 103-132). Jaboticabal: FUNEP.
Zhang, M. (2008). A mechanism of seed deterioration in relation to the volatile compounds evolved by dry seeds themselves. Seed Science Research, 4(1), 49-56. https://doi.org/10.1017/s0960258500001999
Copyrights
Copyright for this article is retained by the author(s), with first publication rights granted to the journal.
This is an open-access article distributed under the terms and conditions of the Creative Commons Attribution license (http://creativecommons.org/licenses/by/4.0/).