UNIVERSIDADE FEDERAL DE PELOTAS PROGRAMA DE PÓS-GRADUAÇÃO EM BIOTECNOLOGIA

UNIVERSIDADE FEDERAL DE PELOTAS

PROGRAMA DE PÓS-GRADUAÇÃO EM BIOTECNOLOGIA

TESE

EFEITO DO QUORUM SENSING NA MOTILIDADE E NA

MULTIPLICAÇÃO DE Salmonella Typhimurium

Rita de Cássia dos Santos da Conceição

Pelotas, dezembro de 2012.

1

RITA DE CÁSSIA DOS SANTOS DA CONCEIÇÃO

Efeito do Quorum Sensing na Motilidade e na Multiplicação de Salmonella Typhimurium

Tese apresentada ao Programa de Pós-Graduação em Biotecnologia da Universidade Federal de Pelotas, como requisito parcial à obtenção do Título de Doutor em Ciências (área do conhecimento: Biotecnologia).

Orientador:

Prof. Dr. Fábio Pereira Leivas Leite (UFPel)

Coorientador:

Prof. Dr. Cláudio Dias Timm

Pelotas, 2012

Dados de catalogação na fonte:

Maria Beatriz Vaghetti Vieira – CRB-10/1032 Biblioteca de Ciência & Tecnologia - UFPel

C744e Conceição, Rita de Cássia dos Santos da

Efeito do Quorum Sensing na motilidade e na multiplicação de Salmonella Typhimurium / Rita de Cássia dos Santos da Conceição. – 82f. : il. – Tese (Doutorado). Programa de Pós-Graduação em Biotecnologia. Universidade Federal de Pelo-tas. Centro de Desenvolvimento Tecnológico. Pelotas, 2013. – Orientador Fábio Pereira Leivas Leite ; co-orientador Cláudio Dias Timm.

1.Biotecnologia. 2. Quorum sensing. 3. Indutores. 4. Salmonella Typhimurium. 5.Motilidade. 6. Multiplicação.7. Auto-indutores.I.Leite, Fábio Pereira Leivas. II.Timm, Cláudio Dias. IV.Título.

Banca examinadora:

Prof. Dr. Fábio Pereira Leivas Leite (orientador) Prof. Dra. Gladis Aver Ribeiro

Prof. Dr. Cláudio Dias Timm Prof. Dr. Geferson Fischer

Aos meus pais, com carinho e gratidão.

AGRADECIMENTOS

Gostaria de agradecer à Universidade Federal de Pelotas por ter colocado ao meu dispor recursos e infraestrutura para poder desenvolver o meu trabalho.

Ao Programa de Pós-Graduação em Biotecnologia e a todos os professores que contribuíram para que o objetivo final fosse alcançado.

Aos meus pais, José e Hercilda, pelo apoio e incentivo sempre que necessitei.

Ao meu noivo, José Edmilson, pelo carinho e dedicação.

Ao meu orientador, o professor Dr. Fábio Pereira Leivas Leite, pela orientação e pela disposição durante a realização do trabalho.

Ao meu coorientador, professor Dr. Cláudio Dias Timm, pela amizade, carinho e por todas as conversas sobre o trabalho que puderem sempre de forma positiva ajudar na realização deste.

Aos funcionários do biotério e do CDTEC, pelo carinho e apoio recebidos, em especial a Fabiane, Vilson e Juliana.

Aos amigos e colegas do CDTEC, pelo bom ambiente de trabalho e pelos momentos compartilhados.

Aos amigos e colegas da Inspeção de Produtos de Origem Animal, pelo carinho e amizade.

À secretária Fabiane, do Programa de Pós-Graduação em Biotecnologia, pelo carinho, incentivo e amizade.

Aos colegas e amigos do Laboratório: Régis, Luciana, Ana Paula, Ana Vianna, Isabel, Tatiana, Rômulo, Mara, Talita, Jéssica, Cleyzer, Mateus, Itauá, Alceu e Luana, pelo apoio recebidos e a Priscila de Leon pelo auxílio no qPCR.

Por fim, agradeço a todos que contribuíram direta ou indiretamente na execução deste trabalho.

“Não há derrota que derrote quem nasceu para vencer”. (Elza Soares)

RESUMO

CONCEIÇÃO, Rita de Cássia dos Santos da. Efeito do Quorum Sensing na Motilidade e na Multiplicação de Salmonella Typhimurium. 2012. 82f. Tese

(Doutorado) – Programa de Pós-graduação em Biotecnologia. Universidade Federal de Pelotas, Pelotas.

Salmonella spp. é um dos principais patógenos transmitidos por alimentos. Os produtos de origem animal são os maiores responsáveis pela distribuição mundial desta bactéria. Salmonella spp. é capaz de induzir uma série de doenças, que vão desde uma febre entérica, septicemia, gastroenterite e infecções focalizadas. Isto é decorrente da bactéria produzir diferentes fatores de patogenicidade e dentre estes fatores, o flagelo foi o alvo no nosso estudo e é um dos fatores de patogenicidade induzidos por Quorum Sensing. Este é um de sistema de sinalização entre as bactérias, através de substâncias denominadas de auto-indutores (AI). As bactérias Gram-negativas produzem três auto-indutores. Estudos verificaram que catecolaminas são capazes de usar a mesma via de sinalização do auto-indutor 3 (AI-3) para ativar determinados genes. Adrenalina e noradrenalina são catecolaminas presentes no trato gastrointestinal de humanos e animais que são capazes de modular a expressão de gênica de bactérias. O presente trabalho teve por objetivos avaliar o sistema de sinalização “Quorum Sensing (AI-3)” na motilidade, no crescimento celular e na expressão de genes envolvidos na montagem do flagelo de Salmonella enterica sorovar Typhimurium (ST) e fazer uma revisão bibliográfica de fatores de patogenicidade de Salmonella spp. induzidos por Quorum Sensing. ST foi exposta a diferentes concentrações de adrenalina e esta associada ao meio condicionado. A combinação de 500 µM de adrenalina + 50% de meio condicionado aumentou a motilidade de ST, o crescimento celular e induziu a expressão dos genes motA, motB, fliA e fliC. Estes resultados sugerem que a maior motilidade de ST foi decorrente de uma maior expressão de genes envolvidos com a montagem do flagelo. Estas observações fornecem dados valiosos sobre a associação da adrenalina com os auto-indutores e seu papel na infecção causada por Salmonella

spp..

Palavras-chave: Quorum Sensing. Salmonella Typhimurium. Patogenicidade. Auto-indutores. Adrenalina. Motilidade.

ABSTRACT

CONCEIÇÃO, Rita de Cássia dos Santos da. Effect of the Quorum Sensing on the

Salmonella Typhimurium Growth and Motility. 2012. 82f. Tese (Doutorado) –

Programa de Pós-graduação em Biotecnologia. Universidade Federal de Pelotas, Pelotas.

Salmonella spp. is the most commonly bacterium transmitted through contamined food. The foods of animal are the most responsible for the worldwide distribution of this bacterium. Salmonella spp. is able to induce a variety of diseases, ranging from an enteric fever, septicemia, gastroenteritis and infections focused. This is due to the bacteria produce different pathogenicity factors and these factors, the flagellum was the target of our study and it is one of the pathogenicity factors induced by Quorum Sensing. Quorum Sensing is a bacterial signaling system that operates through the so-called autoinducer (AI). Gram-negative bacteria produce three auto-inducers. Studies find that catecholamines are able to use the same pathway the autoinducer 3 (AI-3) to active certain genes. Epinephrine and norepinephrine are catecholamines that are present in the mammalian gastrointestinal tract can modulate bacterial gene expression. This work had as objectives to evaluate the Quorum Sensing signaling system on motility, on the growth and flagellar assembly gene expression of Salmonella enterica serovar Typhimurium (ST) and do a review about pathogenicity factors

of Salmonella spp. induced by Quorum Sensing. ST was exposed to different

concentrations of epinephrine and conditioned medium and its association. The combination of 500 µM epinephrine with 50 % conditioned medium increased ST bacterial motility, growth and increased the expression of the fliC, motA, motB and fliA genes. These results suggest that epinephrine in association with conditioned medium increases ST growth and motility, by modulating the expression of genes involved in flagellum assembly. These observations provide valuable insight into the association between catecholamine and autoinducer and their role in the outcome of Salmonella spp. infection.

Keywords: Quorum Sensing. Salmonella Typhimurium. Pathogenicity. Autoinducers. Epinephrine.Motility.

LISTA DE FIGURAS

Artigo 1 - Effects of epinephrine and conditioned medium on the motility and growth dynamics of Salmonella enterica serovar Typhimurium.

Figure 1 Salmonella Typhimurium motility……….………. 35

Figure 2 Growth dynamics of Salmonella Typhimurium in MEM

medium….……….. 36

Figure 3 qRT-PCR expression for Salmonella Typhimurium motility following to epinephrine and conditioned medium………...

LISTA DE TABELAS

Artigo 1 - Effects of epinephrine and conditioned medium on the motility and growth dynamics of Salmonella enterica serovar Typhimurium.

Table 1 Primers used in this study………. 22

LISTA DE ABREVIATURAS

Ad - Adrenalina AIs - Auto-Indutores

BHI – Caldo Infusão de Cérebro e Coração BHA – Ágar Infusão de Cérebro e Coração

CDTEC – Centro de Desenvolvimento Tecnológico MC - Meio Condicionado

MEM - Minimum Essential Medium mg - Miligramas

mL - Mililitro

RPM – Rotações por Minuto

RT-PCR - Reação em Cadeia da Polimerase em Tempo Real SPI – Salmonella Pathogenicity Island

ST – Salmonella Typhimurium QS - Quorum Sensing μL - Microlitro

SUMÁRIO 1. INTRODUÇÃO ... 12 2. OBJETIVOS ... 14 2.1 Geral ... 14 2.2 Específicos ... 14 3. ARTIGO 1 ... 15 4. ARTIGO 2 ... 38 5. CONSIDERAÇÕES FINAIS ... 62 6. REFERÊNCIAS BIBLIOGRÁFICAS... ..63 ANEXOS...73

1 INTRODUÇÃO

Bactérias do gênero Salmonella spp. estão entre os principais micro-organismos patogênicos veiculados por alimentos (CDC, 2011). A transmissão a humanos ocorre geralmente pelo consumo de alimentos contaminados (FAVRIN, JASSIM, GRIFFITHS, 2001). Alimentos de origem animal são os principais veículos deste patógeno (MURMANN, SANTOS, CARDOSO, 2009; CONCEIÇÃO et al., 2008; DIAS et al., 2008). Salmonella spp. é capaz de causar uma variedade de doenças: febre entérica, septicemia, gastroenterite e infecções focalizadas. A patogenicidade desta bactéria está relacionada a uma série de fatores de virulência. Dentre os fatores de virulência acima citados, o flagelo está entre os fatores de patogenicidade induzidos por Quorum Sensing (BEARSON & BEARSON, 2008; BEARSON et al., 2010)

Quorum Sensing é um termo utilizado para designar um sistema de sinalização entre as bactérias, os quais produzem substâncias denominadas de auto-indutores (AI). As bactérias produzem, liberam, detectam e respondem a estas moléculas sinais e quando estes auto-indutores alcançam uma determinada concentração, ocorre uma ativação de fatores transcricionais que acabam regulando a expressão gênica.

Nas bactérias Gram-negativas têm sido identificados três auto-indutores. O auto-indutor 1 tem sido identificado como uma hemoserina lactona e está primariamente envolvida na comunicação intercelular e o auto-indutor 2 como uma furanona, o qual é produzido pelo produto do gen lux S e está envolvido na comunicação entre as espécies (SURETTE, MILLER, BASSLER, 1999; SPERANDIO et al., 2003)

O AI-2 tem sido utilizado para identificar moléculas de sinalização produzidas por outros gêneros bacterianos. Através de pesquisas foi observado que bactérias como Salmonella spp. e Escherichia coli produzem estes auto-indutores (SURETTE, MILLER, BASSLER, 1999) que são similares ao auto-indutor 2

produzido pelo Vibrio harveyi. Ainda há a produção de um terceiro auto-indutor, denominado AI-3 (Sperandio et al., 2003).

Adrenalina e noradrenalina são produzidas pelos mamíferos para comunicação celular. Estas são catecolaminas liberadas pelo sistema nervoso simpático, que utilizam mesma a via de sinalização do auto-indutor tipo 3 (AI-3) para ativar expressão gênica em bactérias (SPERANDIO et al., 2003). Estudos têm demonstrado in vitro que a adrenalina e a noradrenalina induzem a um maior crescimento celular (BEARSON et al., 2008; FREESTONE, HAIGH, LYTE, 2007; BELAY et al., 2003), a aderência celular (CHEN et al., 2003), ativam a expressão de genes de virulência (BEARSON & BEARSON, 2008; WALTERS & SPERANDIO, 2006) e aumentam a motilidade bacteriana (BEARSON & BEARSON, 2008; SPERANDIO et al., 2003).

A identificação destes auto-indutores tem contribuído para melhor entender a relação patógeno-hospedeiro, onde catecolaminas produzidas pelos mamíferos podem induzir um aumento da patogenicidade de um micro-organismo em decorrência de usarem a mesma via de sinalização do AI-3 e com isso ativar genes durante uma infecção.

A aplicabilidade deste conhecimento abre novas perspectivas principalmente na terapia de infecções, visto que com o aparecimento de bactérias multirresistentes, o uso de antibióticos e antimicrobianos acaba tornando-se cada vez mais limitado. A introdução de fármacos com novos mecanismos de ação, assim como metodologias mais eficazes para o isolamento de patógenos, tem incentivado à pesquisa para novas descobertas, no sentido de cada vez mais entender a relação dos micro-organismos com seu hospedeiro e desta forma, poder descobrir novos fármacos que possam intervir na ação dos micro-organismos e este sistema de sinalização tem contribuído para isso.

2 OBJETIVOS

2.1 Geral

O presente trabalho teve como objetivo utilizar o sistema de sinalização “Quorum Sensing (AI-3)” na motilidade e na multiplicação de Salmonella enterica sorotipo

Typhimurium.

2.2 Específicos

Utilizar indutores (adrenalina) e auto-indutores (através do uso do meio condicionado) nos meios de cultivo com o intuito de estudar a expressão de fatores de virulência.

Analisar através de métodos moleculares (Reação em Cadeia da Polimerase em Tempo Real), a expressão dos genes envolvidos na montagem do flagelo.

3 ARTIGO 1

Effects of epinephrine and conditioned medium on the motility and

growth dynamics of Salmonella enterica serovar Typhimurium

Conceição, Rita de Cássia dos Santos daa; Sturbelle, Régis T.a; Leon, Priscila M. M.a; Lorenzon, Lucas B.a; Timm, Cláudio Diasa; Leite, Fábio Pereira Leivasa*

a_{Universidade Federal de Pelotas – UFPel, Pelotas, RS}

Effects of epinephrine and conditioned medium on the motility and growth dynamics of Salmonella enterica serovar Typhimurium

Conceição, Rita de Cássia dos Santos daa; Sturbelle, Régis T.a; Leon, Priscila M. M.a; Lorenzon, Lucas B.a; Timm, Cláudio Diasa; Leite, Fábio Pereira Leivasa*

a_{Universidade Federal de Pelotas – UFPel, Pelotas, RS}

Abstract

Quorum sensing is a bacterial signaling system that operates through the so-called autoinducer (AI). Catecholamines that are present in the mammalian gastrointestinal tract can modulate bacterial gene expression. This study evaluated the effects of conditioned media (AI) and catecholamine (epinephrine) and its association on motility, flagellar assembly/function gene expression, and the growth of Salmonella enterica serovar Typhimurium (ST). ST was exposed to different concentrations of epinephrine within conditioned medium. The combination of 500 µM epinephrine with 50 % conditioned medium increased ST bacterial growth in twofold, motility in fourfold and increased the expression of the motA, motB, fliC and fliA genes by 16 %, 5.6 %, 5.4 % and 2.5 %, respectively. These results suggest that epinephrine in association with conditioned medium increases ST growth and motility, by modulating the expression of genes involved in flagellum assembly and motor function. These observations provide valuable insight into the association between catecholamine and autoinducer and their role in the outcome of Salmonella ssp. infection.

KEY WORDS: Quorum sensing, Salmonella spp., epinephrine, autoinducer, motility.

*Corresponding author: Mailing address: Microbiology and Immunology, Biotecnology Center, Universidade Federal de Pelotas. E-mail: fabio@leiv asleite.com.br;fabio_leite@ufpel.edu.br

1. INTRODUCTION

Quorum sensing refers to a bacterial signaling system through so-called autoinducer molecules. When these autoinducers reach a certain concentration because of an increase in cell density, the bacterium detects the autoinducers and responds by altering its gene expression [1, 2]. Quorum sensing studies have reported that this signaling system plays an important role in the modulation of bacterial pathogenicity [3, 4].

Three types of autoinducers have currently been described for Gram-negative bacteria [5-9]. AI-1 is primarily involved in intracellular communication, AI-2 is involved in inter-species communication, and AI-3 is involved in bacterium–host communication [1, 10].

The neurotransmitters epinephrine and norepinephrine are mammalian catecholamines released by the sympathetic nervous system that can act as signaling molecules to activate/repress gene expression in microorganisms using the same signaling pathway as bacterial AI-3 [4, 11]. The epinephrine/norepinephrine/ AI-3 signaling system was first observed by Sperandio [1], studying Enterohemorrhagic Escherichia coli (EHEC) virulence genes. Through in silico studies, the receptor of this signal (QseC) has been identified in other species, such as Salmonella spp., Shigella flexneri, Francisella tularensis, Erwinia carotovoa, Pasteurella multocida, and others [12]. Studies have demonstrated the in vitro action of these signaling molecules in various processes, such as motility [13, 14] and bacterial cell growth [15-19] and in vivo action [11, 20], which establishes a communication pathway between the pathogen and the host.

Salmonella bacteria are among the major pathogenic microorganisms in food and it is currently a leading cause of bacterial foodborne morbidity and mortality in the United States [21].

This study aimed to evaluate the role of the quorum sensing signaling system in the growth and motility dynamics of Salmonella enterica serovar Typhimurium by examining the association between the catecholamine (epinephrine) and conditioned media (AI).

2. MATERIAL AND METHODS

2.1. Bacteria and culture media

A Salmonella enterica serovar Typhimurium (ST) strain which have been isolated from pasty dulce de leche [22] was used in this study. Brain-heart infusion broth (BHI, Acumedia), Brain-Heart Infusion agar (BHA, Acumedia) and Eagle’s minimum essential medium (MEM, Sigma, M0769) were used as culture media. Epinephrine (C9H13NO3, E1635, Sigma) was used at 50, 125, 250 and 500 µM concentrations. A β receptor blocker (atenolol, C14H22N2O3, Farmanostra) was used at a 2000 µM concentration and Ferric Chloride (FeCl3.6H20, Vetec) was used at 20 and 100 µM concentrations.

2.2. Conditioned Medium

Conditioned medium refers to the use of Salmonella Typhimurium (ST) culture (37 o

C for 7 h at 130 rpm in 100 mL of MEM) filtered (0.22 µm filter, Millipore) . ST was grown to obtain a pre-inoculum and then adjusted to OD 1.0 (A600), 2,5 mL of the inoculum was used, corresponding to a ~ 1 x 109 CFU/mL count, in 100 mL of MEM.

2.3. Motility

The motility assay was performed according to Sperandio [3] with some modifications. These modifications were related to the culture medium, treatments and incubation period. ST was grown in MEM incubated at 37 oC for 7 h at 130 rpm in an orbital shaker. From this culture (OD = 0.8), 1 µL (6.5 x 105 CFU) was inoculated into a Petri dish containing MEM solidified with 0.3 % agar. The treatments were as follows: MEM (control); 10 % cm; 10 % cm + 50 µM epinephrine; 10 % cm + 125 µM epinephrine; 10 % cm + 250 µM epinephrine; 10 % cm + 500 µM epinephrine; 50 % cm; 50 % cm + 50 µM epinephrine; 50 % cm + 125 µM epinephrine; 50 % cm + 250 µM epinephrine; and 50 % cm + 500 µM. Atenolol was added to the 50 % conditioned medium + 500 µM epinephrine treatment. The plates were incubated at 37 oC for 12 hours, and the motility halos were measured with a caliper.

2.4. Cell growth dynamics

To evaluate the influence of the conditioned medium on cellular growth, ST was grown in BHI to obtain a pre-inoculum and then adjusted to OD 1.0 (A600); 2 mL of the inoculum was used, corresponding to a ~ 1 x 109 CFU/mL count, in 100 mL for each treatment analyzed: control (MEM); 50 % cm + 500 µM epinephrine, 50 % cm + 500 µM epinephrine + 2000 µM atenolol, 50 % cm + 500 µM epinephrine + FeCl3 (20 and 100 µM). The treatments were incubated at 37 oC in an orbital shaker for 7 h at 130 rpm. An aliquot was taken hourly from each treatment and then quantified by optical density with a spectrophotometer (Biospectro SP-22).

ST was grown in MEM at 37 oC for 7 h at 130 rpm in an orbital shaker. Following this incubation period, the culture was centrifuged at 13,000 g for 15 minutes. The pellet was used to inoculate the MEM medium (control) and the 50 % cm + 500 µM epinephrine. We conduct this experiment using this treatment because this was the treatment wherein we observed the highest motility of all treatments. Samples were collected every thirty minutes, totaling four collections. Each of which was centrifuged, and the pelleted samples were then suspended in Trizol (Invitrogen). Total RNA was extracted according to t he manufacturer’s recommendations (Invitrogen). RNA was then quantified in a spectrophotometer (Nanovue) and standardized at 1 ng for each cDNA synthesis reaction. cDNA synthesis was performed using a High Capacity cDNA Reverse Transcription Kit (Applied Biosystems) following the manufacturer’s instructions, quantified in a spectrophotometer (Nanovue) and then stored at -20 oC before use.

Gene expression was determined by the quantitative real-time polymerase chain reaction (qRT-PCR). The primers used to quantify gene expression are listed in Table 1. The primers used for 16S, motB, and fliC were designed using the PRIMER3 v. 0.4.0 according to the GenBank access number HM583969 for the 16S ribosomal RNA gene, NP_460879 for the motB gene and NP_460912 for the fliC gene.

Reactions were performed in duplicate on an Applied Biosystems® 7300 Real-Time PCR System using a Platinum SYBR Green qPCR SuperMix UDG kit (Applied Biosystems) according to manufacturer’s instructions. The real-time PCR reaction consisted of 236 ng of cDNA, 6.25 µL of Platinum® SYBR® Green, 0.25 µL of Rox Reference Dye, 0.5 µL of each primer and water up to a 12.5 µL volume. The samples underwent 45 cycles under the following thermocycling conditions: 95 oC for

30 seconds, 55 oC for 30 seconds and 72 oC for 60 seconds. The analysis of the resulting data was performed using the Real-Time MxPro–Mx3005P software. The relative amount of mRNA for each gene was determined by the comparative threshold cycle (ΔΔCT) method, which was standardized using the 16S RNA gene sequence.

Table 1: Primers used in this study.

Gene Primer Sequence (5`→ 3`) Reference

gyrB GTCGAATTCTTATGACTCCTCC

CGTCGATAGCGTTATCTACC [13]

16S AGGCCTTCGGGTTGTAAAGT

GTTAGCCGGTGCTTCTTCTG This study

motA GGTTATCGGTACAGTTTTCG TAGATTTTGTGTATTTCGAACG [23] motB ATGAAAAATCAGGCTCATCCCA CATAAAATCGGCGTAGGCAATT This study fliA CGGAGTATCGTCAGATGTTG TTGATGTTCTTCAGTCACCAG [13] fliC GGCACAAGTCATTAATACAAACAGC

TCTTTCGCGCTGTTGATACG This study

2.6. Statistical Analysis

The motility halo and growth dynamics were analyzed by a T test using the 2009 version of the Statistics software (SAS ®, 2009), and p < 0.05 was considered

significant. Each assay was performed in triplicate, and the results were expressed as the mean of three independent experiments.

3. RESULTS 3.1. Motility

Using 10 % conditioned medium (cm), the largest motility halo was obtained when associated with 500 µM epinephrine, where was two times higher as compared to the control (1.1 cm) (Fig. 1A).There were no significant differences among the motility halos for the other epinephrine concentrations tested (data not shown) in association with 10 % of conditioned medium. We observed that the addition of epinephrine from 50 to 500 µM to 50 % of conditioned medium increased the motility halo significantly compared to the control. The treatments wherein we used 50 % cm + 500 µM epinephrine showed the largest motility halos, reaching a fivefold increase with respect to the control (Fig. 1B). Using the β-blocker atenolol (2000 µM), we were able to reduce the motility effect by 45 % compared to the 50 % cm + 500 µM epinephrine condition (Fig. 1C).

3.2. Cell growth dynamics

The association of 50 % condition medium with 500 µM of epinephrine increased the growth significantly from the fourth culture hour (1.7 fold), keeping higher up to the seventh hour (1.9 fold) comparing with the control group. The addition of atenolol (2000 µM) to the culture reduced the cell growth significantly and the addition of FeCl3.6H2O at the concentration tested (20 and 100 µM) did not increase the growth (Fig.2).

3.3. Gene expression

We observed a time-dependent modulation on gene expression following bacterial growth in 50 % conditioned medium containing 500 µM epinephrine. motA expression increased 4.7, 5.7 and 16 fold at 60, 90 and 120 min, respectively. fliC expression increased 4.7 at 60 min, reaching peak expression in fold expression of 5.4 at 90 min, and then decreased to 2.7 at 120 min. fliA and motB showed 2.5- and 5.6-fold increases in expression, respectively, at 120 min (Fig. 3A), and atenolol treatment reduced (~13 times) gene expression (Fig. 3B).

4. DISCUSSION

This study evaluated the motility, growth dynamics and flagellar gene expression involved with Salmonella flagellar assembly and function by examining the association between inducers/autoinducers and culture media.

The mammalian intestinal tract is a highly complex heterogeneous site, with most of the microbiota living in the large intestine [24]. The high bacterial density and diversity in this environment suggests that members of this community communicate with each other to coordinate some processes to their advantage [13]. According to Sperandio [1], the catecholamines (epinephrine and norepinephrine) are present in the gastrointestinal tract. Norepinephrine is produced within adrenergic neurons present in the enteric nervous system, and epinephrine is synthesized in both the central nervous system and the adrenal medulla. Bacteria may sense catecholamines via the AI-3 signaling pathway, altering their gene expression.

Studies have shown that the use of catecholamines in culture media promotes the multiplication, motility and expression of genes involved in bacterial virulence [7, 20, 25, 26]. This study verified an increase in ST motility when the bacteria were

grown in conditioned medium containing epinephrine. The largest motility halos (5.5 cm) were obtained when ST was cultured in media containing epinephrine plus conditioned medium (Fig. 1B), suggesting that ST may use host molecules and its own genes to modulate its motility. The use of 10 % to 50 % conditioned medium has been found to increase the motility of different bacteria [3, 13, 14]. However, the use of 10 % and 50 % conditioned medium without the addition of epinephrine did not lead to increased motility in this study, which differs from the results obtained by other researchers [3, 13, 14]. However, we observed an increase in the motility of Salmonella Typhimurium as combining the 50 % conditioned medium with increasing concentrations of epinephrine, as observed in the Figure 1B. Likewise, the different epinephrine concentrations tested alone without condition media (50 µM, 125 µM, 250 µM and 500 µM) did not increase ST motility.

Bearson & Bearson [13] showed enhanced Salmonella Typhimurium motility in DMEM using 50 µM norepinephrine and 10 % conditioned medium separately, whereas Sperandio [3, 14] obtained increased Escherichia coli motility using DMEM, enriched with norepinephrine or conditioned medium separately. The differences between our results and the results of previous studies may be attributed to the different experimental conditions that we adopted, such as the association of catecholamines with conditioned media, the specific catecholamine used (epinephrine/norepinephrine), the culture medium and incubation periods, the sugar supplementation in the medium, and the bacterial strain used.

Growth curves were performed to determine the role of condition media and epinephrine on the Salmonella growth, as suggested by some researchers [17, 26-29]. Our results suggest that the 50 % cm + 500 µM epinephrine treatment induced a higher Salmonella growth compared to the control, as observed Fig. 2A. Plus, AI-3

and epinephrine utilize the same receptor (QseC) what suggest a synergistic between these two molecules in the expression of virulence genes [10]. The effects of AI-3 and epinephrine/norepinephrine can be blocked with adrenergic receptor antagonists. Based on this, we added a β-blocker (atenolol) to analyze the effect on the 50 % cm + 500 µM epinephrine treatment and we observed that the addition of atenolol (2000 µM) to the culture reduced the cell growth significantly, suggesting the effects induced by AI-3 and epinephrine were blocked. Has been reported that epinephrine enhances Salmonella growth by functioning as a siderophore in serum-supplemented medium to provide iron to the bacterial cell [30]. However, it was not observed in our work. In this study, we added iron (FeCl3.6H2O) in the treatment that combined conditioned medium and epinephrine and it did not increase the bacterial growth rate, as observed in Fig. 2B. The use of 500 µM epinephrine alone was analyzed and we observed an inhibitory effect in the Salmonella growth. Freestone and colleagues [17] verified that this concentration (500 µM epinephrine) inhibited Yersinia enterocolitica multiplication. Nevertheless, this same concentration did not inhibit Salmonella enterica and Escherichia coli O157:H7, suggesting that this effect may be related to the bacterial strain or species studied.

The flagellum is a complex structure that provides motility for a microorganism, and it is regulated by the sequential expression of over 50 genes [31]. flhDC encodes a regulator that coordinates the intermediary gene transcription, whose expression results in the assembly of the flagellum intermediary motor structure. Motility genes are expressed in a cascade with ‘‘early, middle, and late’’ genes expressed in a sequential order [32]. The genes studied in this experiment – flhC, fliA, fliY, motA, motB and fliC - were selected to encompass this hierarchical order. Following qRT-PCR analysis the ST cultures, we observed 16-, 5.6-, 2.7- and 2.5-fold increases in

the expression of the motA, motB, fliC and fliA genes, respectively. However, these genes were expressed in a time-dependent manner. motA was first expressed at 60 min, showed increased expression at 90 min, and reached peak expression at 120 min. In contrast, fliC was first expressed at 60 min, reached peak expression at 90 min and showed reduced expression by 120 min. Bearson & Bearson [13] observed an increase in the expression of the fljB, fliA, fliY and flhC genes, which confirmed the enhanced motility of Salmonella Typhimurium following norepinephrine exposure. This study also showed a fifteen-fold increase in the expression of the fljB gene, which encodes the second flagellin. However, our results differed from those obtained by Jesudhasan and colleagues [9], who found a repression of the motility genes examined in their study. Salmonella can express two independent flagellins [31], which are required to invade the host’s cells [33]. This experiment did not evaluate the expression of the fljB gene; however, there was a significant increase in fliC expression, which is also responsible for flagellin assembly [34]. We also observed an increase in fliA gene expression. fliA is an intermediate gene encoding a sigma factor – FliA (σ28) – that is necessary for the transcription of the final genes involved in flagellum assembly through the synthesis of an external filament. Because these expressed genes are mainly involved with ST motor function and flagella expression, as observed by other researchers [3, 13-14], these observations suggest that ST showed increased motility in the presence of epinephrine-containing conditioned medium.

These observations suggest that the effect of epinephrine and condition media on motility was caused by the increased expression of genes involved in flagella movement and by a higher number of cells. However, we can not exclude that cell density and flagella rotation could have simultaneous effects because the motility

assay was performed on solid media and the gene expression experiments were performed in liquid media, but it was not observed in our work.

The effects observed using the condition media suggest that most of its effects might be due to the presence of AI-3, as reported by different authors. Also by the results obtained when the β-blocker atenolol was used, principally in the motility (halo diameter and gene expression), however we cannot exclude that other factor (e.i. AI-2) might be involved in the results observed in this study.

The results of this study suggest that epinephrine in vitro can associate with autoinducers released by Salmonella enterica serovar Typhimurium and activate virulence gene expression, thereby playing a significant role in the outcome of Salmonella infection.

Figure 1: Salmonella Typhimurium motility. The data represent halo formation in MEM medium using conditioned medium (cm) and different epinephrine (Epi) concentrations. A: control (MEM); 10 % cm and 10 % cm + 500 µM Epi; B: control (MEM); 50 % cm; 50 % cm + 50 µM Epi; 50 % cm + 125 µM Epi; 50 % cm + 250 µM Epi and 50 % cm + 500 µM Epi; C: control (MEM); 50 % cm + 500 µM Epi and 50 % cm + 500 µM Epi + 2000 µM atenolol; D, E and F: motility halos in plates. D: control (MEM); E: 50 % cm + 500 µM Epi and F: 50 % cm + 500 µM Epi + 2000 µM atenolol. Different letters show significant differences in relation to the control (p < 0.05) and between each condition, from three independent experiments (+/- standard deviation).

Figure 2: Growth dynamics of Salmonella Typhimurium in MEM medium. The data represent the mean of three experiments (+/- standard deviation). A: control (MEM), 50 % cm + 500 µM epinephrine, 50 % cm + 500 µM epinephrine + atenolol. After the fourth hour of Salmonella culture, the treatment that contained 50 % conditioned medium + 500 µM epinephrine was significantly different (p < 0.05) from the control. Β-receptor blocker (atenolol) inhibited the Salmonella growth (p < 0.05). B: FeCl3 added 50 % cm + 500 µM epinephrine did not increase the bacterial growth rate.

Figure 3: qRT-PCR expression for ST motility following exposure to epinephrine and conditioned medium. The data represents the ΔΔCT of (A) the increase in the expression of motA, motB, fliC and fliA genes during ST exposure to 50 % conditioned media (cm) and 500 µM epinephrine. (B) The reduction in the gene expression of motA following atenolol treatment (2000 µM) to the ST culture containing 50 % conditioned medium and 500 µM epinephrine.

5. REFERENCES

[1] Sperandio V, Torres AG, Jarvis B, Nataro JP, Kaper JB, Bacteria-host communication: the language of hormones, Proc Natl Acad Sci USA 100 (2003) 8951-8956.

[2] Pillai SD, Jesudhasan PR, Quorum Sensing: how bacteria communicate, Food Technol 60 (2006) 42-50.

[3] Sperandio V, Torres AG, Kaper JB, Quorum Sensing Escherichia coli regulators B and C (QseBC): a novel two-component regulatory system involved in the regulation of flagella and motility by quorum sensing in E.coli, Mol Microbiol 43 (2002) 809-821. [4] Moreira CG, Weinshenker D, Sperandio V, QseC mediates Salmonella enteric serovar Typhimurium virulence in vitro and in vivo, Infect Immun 78 (2010) 914-926. [5] Taga ME, Semmelhack JL, Bassler BL, The luxS-dependent autoinducer AI-2 controls the expression of an ABC transporter that functions in AI-2 uptake in Salmonella Typhimurium, Mol Microbiol 42 (2001) 777-793.

[6] Miller ST, Xavier KB, Campagna SR, Taga ME, Semmelhack MF, Bassler BL, Hughson, FM, Salmonella recognizes a chemically distinct form of the bacterial Quorum-Sensing signal AI-2, Mol Cell 15 (2004) 677-687.

[7] Walters M, Sircili MP, Sperandio V, AI-3 synthesis is not dependent on luxS in Escherichia coli, J Bacteriol 188 (2006) 5668-5681.

[8] Soni KA, Lu L, Jesudhasan PR, Hume ME, Pillai, SD, Influence of autoinducer-2 (AI-2) and beef sample extracts on Escherichia coli O157:H7 survival and gene expression of virulence genes yadK and hhA, J Food Sci 73 (2008) 135-139.

[9] Jesudhasan PR, Cepeda ML, Widmer K, Dowd SE, Soni KA, Hume ME, Zhu J, Pillai S, Transcriptome analysis of genes controlled by luxS/autoinducer-2 in Salmonella enteric serovar Typhimurium, Food Pathog Dis 7 (2010) 399-410.

[10] Walters M, Sperandio V, Autoinducer 3 and epinephrine signaling in the kinetics of locus of enterocyte effacement gene expression in enterohemorrhagic Escherichia

coli, Infect Immun 74 (2006) 5445-5454.

[11] Pullinger GD, Van Diemen PM, Carnell SC, Davies H, Lyte M, Stevens MP, 6-hydroxydopamine – mediated release of norepinephrine increases faecal excretion of Salmonella enteric serovar Typhimurium in pigs, Vet Res 41 (2010) 1-12.

[12] Rasko DA, Moreira CG, Li R, Reading NC, Ritchie JM, Waldor MK, Williams N, Taussig R, Wei S, Roth M, Hughes DT, Huntley JF, Fina MW, Falck JR, Sperandio V, Targeting QseC signaling and virulence for antibiotic development, Science 321 (2008) 1078-1080.

[13] Bearson BL, Bearson SMD, The role of the QseC quorum-sensing sensor kinase in colonization and norepinephrine-enhanced motility of Salmonella enterica serovar Typhimurium, Microb Pathog 44 (2008) 271-278.

[14] Sperandio V, Torres AG, Girón JA, Kaper JB, Quorum sensing is a global regulatory mechanism in enterohemorrhagic Escherichia coli O157:H7, J Bacteriol 183 (2001) 5187-5197.

[15] Belay T, Aviles H, Vance M, Fountain K, Sonnenfeld G, Catecholamines and in vitro growth of pathogenic bacteria: enhancement of growth varies greatly among bacterial species, Life Sci 73 (2003) 1527-1535.

[16] O`Donnell PM, Aviles H, Lyte M, Sonnenfeld G, Enhancement of in vitro growth of pathogenic bacteria by norepinephrine: importance of inoculums density and role of transferrin, Appl Environ Microbiol 72 (2006) 5097-5099.

[17] Freestone PPE, Haigh RD, Lyte M, Specificity of catecholamine-induced growth in Escherichia coli O157:H7, Salmonella enterica e Yersinia enterocolitica, FEMS Microbiol Lett 269 (2007) 221-28.

[18] Bearson BL, Bearson SMD, Uthe JJ, Dowd SE, Houghton JO, Lee I, Toscano MJ, Lay Jr DC, Iron regulated genes of Salmonella enterica serovar Typhimurium in response to norepinephrine and the requirement of fepDGC for norepinephrine-enhanced growth, Microbes Infect 10 (2008) 807-816.

[19] Methner U, Rabsch W, Reissbrodt R, Williams PH, Effect of norepinephrine on colonization and systemic spread of Salmonella enterica in infected animals: role of catecholate siderophore precursors and degradation products. Int J Med Microbiol 298 (2008) 429-439.

[20] Bearson BL, Bearson SMD, Lee IS, Brunelle BW, The Salmonella enteric serovar Typhimurium QseB response regulator negatively regulates bacterial motility and swine colonization in the absence of the QseC sensor kinase, Microb Pathog 48 (2010) 214-219.

[21] CDC, Estimates of foodborne illness in the United States, 2011, Available at: www. cdc.gov/foodborneburden.

[22] Timm CD, Conceição RCS, Coelho FJO, Roos TB, Tejada T, Quevedo PS, Hentges A, Brasil NDA, Avaliação microbiológica de doce de leite pastoso, Rev Inst Adolfo Lutz 66 (2007) 275-277.

[23] Fink RC, Evans MR, Porwollik S, Vasquez-Torres A, Jones-Carson J, Troxell B, Libby SJ, Mcclelland M, Hassan HM, FNR is a global regulator of virulence and anaerobic metabolism in Salmonella enteric serovar Typhimurium (ATTCC 14028s), J Bacteriol 189 (2007) 2262-2273.

[24] Guarner F, Malagelada JR, Gut flora in health and disease, Lancet 360 (2003) 512-518.

[25] Freestone PPE, Haigh RD, Williams PH, Lyte M, Stimulation of bacterial growth by heat-stable, norepinephrine – induced autoinducers, FEMS Microbiol Lett 172 (1999) 53-60.

[26] Belay T, Sonnenfeld G, Differential effects of catecholamines on in vitro growth of pathogenic bacteria, Life Sci 71 (2002) 447-456.

[27] Pullinger GD, Carnell SC, Sharaff FF, van Diemen PM, Dziva F, Morgan E, Lyte M, Freestone PPE, Stevens MP, Norepinephrine augments Salmonella enterica-induced Enteritidis in a manner associated with increased net replication but independent of the putative adrenergic sensor kinases QseC and QseE, Infect Immun 78 (2010) 372-380.

[28] Ali A, Sarmah R, Rahman H, Effect of norepinephrine on growth and enterotoxin production of Salmonella, J Vet Pub Hlth 1 (2003) 37-41.

[29] Freestone PP, Williams PH, Haigh RD, Maggs AF, Neal CP, Lyte M, Growth stimulation of intestinal commensal Escherichia coli by catecholamines: a possible contributory factor in trauma-induced sepsis, Shock 18 (2002) 465-470.

[30] Freestone PP, Lyte M, Neal CP, Maggs AF, Haigh RD, Williams PH, The mammalian neuroendocrine hormone norepinephrine supplies iron for bacterial growth in the presence of transferrin or lactoferrin, J Bacteriol 182 (2000) 6091-6098. [31] McQQuiston JR, Fields PI, Tauxe RV, Logsdon Jr RV, Do Salmonella carry spare tyres?, Trends Microbiol 16 (2008) 142-148.

[32] Chilcott GS & Hughes KT, Coupling of Flagellar Gene Expression to Flagellar Assembly in Salmonella enterica serovar Typhimurium and Escherichia coli, Microbiol Mol Biol Rev 64 (2000) 694-708.

[33] Tallant T, Deb A, Kar N, Lupica J, Veer MJ, DiDonato JA, Flagellin acting via TLR5 is the major activator of key signaling pathways leading to NF-kB and

proinflammatory gene program activation in intestinal epithelial cells, BMC Microbiol 4 (2004) 1-24.

[34] Metcalfe HJ, Best A, Kanellos T, La Ragione RM, Werling D, Flagellin expression enhances Salmonella accumulation in TLR5-positive macrophages, Dev Comp Immunol 34 (2010) 797-804.

Figure 1: Salmonella Typhimurium motility. The data represent halo formation in MEM medium using conditioned medium (cm) and different epinephrine (Epi) concentrations. A: control (MEM); 10% cm and 10% cm + 500 µM Epi; B: control (MEM); 50% cm; 50% cm + 50 µM Epi; 50% cm + 125 µM Epi; 50% cm + 250 µM Epi and 50% cm + 500 µM Epi; C: control (MEM); 50% cm + 500 µM Epi and 50% cm + 500 µM Epi + 2000 µM atenolol; D, E and F: motility halos in plates. D: control (MEM); E: 50% cm + 500 µM Epi and F: 50% cm + 500 µM Epi + 2000 µM atenolol. Different letters show significant differences in relation to the control (p < 0.05) and between each condition, from three independent experiments (+/- standard deviation).

Figure 2: Growth dynamics of Salmonella Typhimurium in MEM medium. The data represent the mean of three experiments (+/- standard deviation). A: control (MEM), 50% cm + 500 µM epinephrine, 50% cm + 500 µM epinephrine + atenolol. After the fourth hour of Salmonella culture, the treatment that contained 50% conditioned medium + 500 µM epinephrine was significantly different (p < 0.05) from the control. Salmonella growth (p < 0.05). B: FeCl3 added 50% cm + 500 µM epinephrine did not increase the bacterial growth rate.

Figure 3: qRT-PCR expression for ST motility following exposure to epinephrine and conditioned medium. The data represents the ΔΔCT of (A) the increase in the expression of motA, motB, fliC and fliA genes during ST exposure to 50% conditioned media (cm) and 500 µM epinephrine. (B) The reduction in the gene expression of motA following atenolol treatment (2000 µM) to the ST culture containing 50% conditioned medium and 500 µM epinephrine.

4 ARTIGO 2

REVISÃO: QUORUM SENSING E A EXPRESSÃO DE FATORES DE PATOGENICIDADE EM Salmonella spp.

Conceição RCS1; Sturbelle RT.1; Timm CD1; Leite FPL1* Universidade Federal de Pelotas – UFPel, Pelotas, RS

REVISÃO: QUORUM SENSING E A EXPRESSÃO DE FATORES DE PATOGENICIDADE EM Salmonella spp.

Conceição RCS1, Sturbelle RT1, Timm CD1, Leite FPL1*

1_{Universidade Federal de Pelotas – UFPel, Pelotas, RS}

*Autor para correspondência: ritinhaconceicao@hotmail.com

Resumo

Salmonella spp. está entre os principais micro-organismos patogênicos veiculados por alimentos no mundo, sendo os produtos de origem animal os principais veículos deste micro-organismo. Os principais sorotipos isolados de alimentos são Enteritidis e Typhimurium. Salmonella spp. é capaz de induzir uma série de doenças, que vão desde uma febre entérica, septicemia, gastroenterite e infecções focalizadas. Isto é decorrente da bactéria produzir diferentes fatores de patogenicidade. Dentre estes fatores podemos citar: o lipopolissacarídeo, as fimbrias, plasmídeos de virulência, flagelos e sistema de secreção tipo III, etc. O presente trabalho teve por objetivo fazer uma revisão bibliográfica sobre Quorum Sensing e sobre fatores de patogenicidade de Salmonella spp. que são induzidos por este sistema de sinalização. Quorum Sensing é um termo utilizado para designar um sistema de sinalização entre as bactérias, os quais produzem substâncias denominadas de auto-indutores. As bactérias Gram-negativas produzem três tipos de auto-indutores, ou seja, auto-indutor tipo 1 (AI-1), AI-2 e AI-3. Adrenalina e noradrenalina são produzidas pelos mamíferos (hospedeiro) para comunicação celular. Estas são catecolaminas liberadas pelo sistema nervoso simpático e utilizam a mesma via de sinalização do auto-indutor tipo 3 (AI-3) para ativar a expressão gênica em bactérias. Uma maior expressão de flagelo, um maior crescimento celular, produção de toxinas, resistência ao estresse oxidativo são alguns dos fatores de patogenicidade relacionados com Quorum Sensing, sendo alguns necessários para a sobrevivência de Salmonella durante a infecção. Este sistema de

sinalização tem contribuído para melhor entender à relação patógeno – hospedeiro e desta forma melhor entender o processo que ocorre durante uma infecção.

Palavras - chave: Quorum sensing, Salmonella spp., patogenicidade, auto-indutores e auto-indutores.

REVIEW: QUORUM SENSING AND EXPRESSION OF FACTORS IN PATHOGENICITY Salmonella spp.

Abstract

Salmonella spp. is among the main pathogenic microorganisms foodborne worldwide, and products of animal origin the main vehicles of this micro-organism. The main serotypes isolated from food are Enteritidis and Typhimurium. Salmonella spp. is able to induce a variety of diseases, ranging from an enteric fever, septicemia, gastroenteritis and infections focused. This is due to the bacteria produce different pathogenicity factors. These factors include: the lipopolysaccharide, the fimbriae, virulence plasmids, flagella and type III secretion system, etc. This study aimed to review existing literature on Quorum Sensing and on pathogenicity factors of Salmonella spp. that are induced by this signaling system. Quorum Sensing is a term used to designate a system for signaling between bacteria, which produce substances called auto-inducers. The Gram-negative bacteria produce three types of autoinducers, as autoinducer 1 (AI-1), AI-2 and AI-3. Adrenaline and noradrenaline are produced by mammalian (host) for cellular communication. These are catecholamines released by the sympathetic nervous system and use the same signaling pathway of autoinducer 3 (AI-3) to activate gene expression in bacteria. A higher expression of the flagellum, further cell growth, production of toxins, oxidative stress resistance are factors of pathogenicity-related Quorum Sensing, some being necessary for the survival of Salmonella during infection. This signaling system has helped to better understand the relationship host - pathogen and thus better understand the process that occurs during infection.

Keywords: Quorum sensing, Salmonella spp., pathogenicity, autoinducers and inducers.

1. Introdução

Bactérias do gênero Salmonella spp. estão entre os principais micro-organismos patogênicos veiculados por alimentos. São bastonetes Gram-negativos pertencentes à família Enterobacteriacea, não formadores de esporos, móveis com flagelos peritríquios, com exceção dos sorotipos Pullorum e Gallinarum, que são imóveis.20 De acordo com o CDC13 (2011), o gênero Salmonella spp. apresenta duas espécies, Salmonella enterica e Salmonella bongori. Salmonella enterica está divida em seis subespécies, sendo estas, enterica (I), salamae (II), arizonae (IIIa), diarizonae (IIIb), houtenae (IV) e indica (VI). Há aproximadamente 2579 sorotipos descritos em Salmonella spp..13 Dentre os sorotipos citados, 60% pertencem à subespécie enterica e 99% destes já foram isolados de humanos.13

A transmissão deste micro-organismo a humanos ocorre geralmente pelo consumo de alimentos contaminados.24 Os produtos de origem animal são os principais veículos desta bactéria.11,19,22,51 No que se refere aos alimentos contaminados por Salmonella spp., os produtos de origem avícola têm sido os mais comumente relacionados com este micro-organismo, no entanto ressalta-se a importância deste patógeno em produtos frescais.12,66 Apesar de todos os sorotipos serem potencialmente patogênicos para os humanos, a maioria dos surtos causados por alimentos contaminados têm sido relacionados a alguns sorotipos. Os sorotipos Enteritidis e Typhimurium têm sido os principais sorotipos isolados de fontes humanas.13,25

Salmonella spp. é capaz de induzir uma série de doenças, que vão desde uma febre entérica, septicemia, gastroenterite e infecções focalizadas. Isto é decorrente da bactéria produzir diferentes fatores de patogenicidade e variáveis entre os distintos sorotipos e cepas. Dentre estes fatores podemos citar: o lipopolissacarídeo,52 as fímbrias,60,74 plasmídeos de virulência,16 flagelos64,76 e sistema de secreção tipo III.62

O presente trabalho teve por objetivo fazer uma revisão bibliográfica sobre o sistema de sinalização Quorum Sensing em Salmonella spp. e sobre os fatores de patogenicidade que são induzidos por este sistema de sinalização.

2. Quorum Sensing

Quorum Sensing é um termo utilizado para designar um sistema de sinalização entre as bactérias, as quais produzem substâncias denominadas de

auto-indutores (AI). Este sistema de sinalização permite que as bactérias monitorem sua própria densidade populacional e com isso ocorre uma indução ou repressão de determinados genes. As bactérias ao se multiplicarem, produzem, liberam, detectam e respondem a estes auto-indutores.36

Este sistema de sinalização tem sido usado para regular diversas funções nas bactérias, incluindo bioluminescência,36,53,81 formação de biofilme,85 síntese de antibióticos,72 indução de fatores de virulência, diferenciação celular e fluxo de nutrientes, dentre outros eventos fisiológicos da bactéria.41 Este sistema de sinalização tem sido utilizado para melhor entender a patogenicidade das bactérias.5,65,69

2.1. Uso de Bactérias Marinhas para Identificação de Auto-indutores

Um dos mais estudados sistemas de sinalização entre as bactérias é o do Vibrio harveyi e do Vibrio fischeri. Duas bactérias marinhas que induzem a bioluminescência em resposta à alta densidade celular.4 Ensaios com Vibrio harveyi têm sido utilizados para identificar estes auto-indutores produzidos por esta bactéria em outras espécies e outros gêneros bacterianos.28,68,69,83 Estes ensaios têm utilizado cepas que respondem somente ao AI-1 (Vibrio harveyi BB 886) ou somente ao AI-2 (Vibrio harveyi BB 170), e desta forma identificando em outros micro-organismos a presença destes auto-indutores, assim como cepas que produzem somente ao auto-indutor 2 (Vibrio harveyi BB 152) ou os dois auto-indutores (Vibrio harveyi BB 120). 68,69

Surette et al69 (1999) verificaram que bactérias entéricas como Escherichia coli e Salmonella, produzem auto-indutores similares aos produzidos por Vibrio harveyi em decorrência destes induzirem a bioluminescência utilizando a cepa BB 170, que responde somente ao auto-indutor 2 (AI-2). No entanto, estes autores verificaram Salmonella e Escherichia coli não produzem o auto-indutor 1 (AI-1).

A luciferase é uma enzima que catalisa reações biológicas transformando energia química em energia luminosa e atua no processo de bioluminescência em Vibrio fischeri é regulada por duas proteínas, LuxI, o qual é responsável pela síntese do AI-1 e LuxR, o qual é ativado por esse auto-indutor para aumentar a transcrição do operon da luciferase luxCDABE.23 O AI-1 tem sido referido como um sistema de sinalização específico, relacionado à comunicação intra-espécie e tem como

molécula sinalizadora N-Acil–L-Hemoserina Lactonas (AHLs). Estudos in vitro usando proteínas da família LuxI têm mostrado que AHL são sintetizadas de ácidos graxos e aminoácidos do metabolismo.54 Homólogos de LuxR e LuxI têm sido identificados em outros gêneros bacterianos.

2.2. Auto-indutores Produzidos por Bactérias Gram-Negativas e Indutores Como mencionado, Salmonella spp. não produz o AI-1 por não apresentar o gene luxI e nem homólogos a este, no entanto apresenta um homólogo LuxR, denominado SdiA, sendo capaz de responder aos AIs-1 produzidos por outras espécies bacterianas.47,63,78

O AI-2 já foi identificado tanto em bactérias negativas como Gram-positivas, sendo utilizado tanto na comunicação intra como interespécies.21 É produzido principalmente na metade da fase exponencial de crescimento celular na presença de certas fontes de carbono e é degradado quando a bactéria entra na fase estacionária.68 Diversas condições do meio em que os micro-organismos se encontram, influenciam os níveis de produção e degradação do AI-2. O rápido crescimento logarítmico, a presença de certas fontes de carbono, através do uso de carboidratos, pH baixo e/ou alta osmolaridade ocasionam um aumento na produção do auto-indutor, enquanto que condições como a ausência destas fontes de carbono, fase estacionária de crescimento, pH neutro e uma baixa osmolaridade induzem a degradação do AI-2. A produção do AI-2 difere entre cepas patogênicas e não patogênicas, sendo que a produção do AI-2 é maior nas cepas patogênicas.69

O gene responsável pela produção do AI-2 foi identificado como luxS.69 LuxS é uma enzima (sintase) envolvida no metabolismo de adenosilmetionina. adenosilhomocisteína é metabolizada em adenina e ribosilhomocisteína. S-ribosilhomocisteína é o substrato para LuxS. Esta enzima converte S-ribosil-homocisteína em homocisteína e 4,5-dihidroxi-2,3-pentanodiona (DPD). Homocisteína não apresenta atividade auto-indutora (MILLER et al., 2004). DPD é um componente instável que reage com água, forma compostos cíclicos espontaneamente e forma o AI-2.15,82,83 Em mutantes de luxS, S-ribosil – homocisteína se acumula dentro da célula bacteriana desde que não tem outras enzimas para utilizar este substrato, ou seja, apenas LuxS.8 A acumulação de

S-ribosil-homocisteína não é tóxica para a célula, pois o acúmulo deste substrato não interferiu no crescimento celular de Salmonella Typhimurium.8

A maior expressão de LuxS não resulta em uma maior produção de AI-2, sugerindo que esta é limitada a disponibilidade de substrato e as condições do meio.8 Neste sentido, podemos dizer que o intestino apresenta condições favoráveis para a produção do AI-2 por Salmonella Typhimurium, em decorrência de ser um ambiente rico em nutrientes (incluindo carboidratos), apresentar um pH baixo e uma alta osmolaridade, sugerindo que durante a infecção por este patógeno pode ocorrer a produção de grandes quantidades de AI-268 e desta forma aumentando a patogenicidade deste micro-organismo.

A estrutura do AI-2 tem sido identificada como um Furanosil Borato Diéster.15 Vibrio harveyi e Salmonella spp. produzem duas moléculas distintas de AI-2, provenientes do DPD, sendo estas: 2-metil-2,3,3,4-tetrahidroxitetrahidrofuranona-borato e 2-metil-2,3,3,4-tetrahidroxitetrafuranona, respectivamente. Salmonella spp. produz uma molécula de AI-2 que não apresenta boro na sua composição.48 A detecção do AI-2 por Vibrio fischeri requer duas proteínas LuxP e LuxO.3 O receptor para AI-2 é uma proteína de membrana denominada LuxP e o AI-2 se liga em Salmonella Typhimurium em um homólogo de LuxP, denominado Lsr (luxS regulated).71 Proteínas Lsr estão envolvidas na ligação, internalização e metabolismo do AI-2.70,71 A internalização do AI-2 é dependente de um transportador ABC, denominado transportador Lsr em Salmonella Typhimurium. 71 Como mencionado, Salmonella spp. produz uma forma distinta de AI-2 que não contém boro na sua composição,48 assim também como o receptor LsrB difere de LuxP por não apresentar boro.48

Ainda em relação às bactérias Gram-negativas, há a produção de um terceiro auto-indutor, denominado auto-indutor 3 (AI-3). Este sistema de sinalização foi identificado primeiramente por Sperandio et al.64 (2003), durante uma investigação envolvendo a expressão de genes de virulência em Escherichia coli entero-hemorrágica (EHEC), que mostraram que AI-3 produzido pela microbiota gastrointestinal é capaz de ativar os genes envolvidos na virulência deste patógeno.

Dos três sistemas de Quorum Sensing presentes em bactérias Gram-negativas, o sistema AI-3 é o menos estudado. A estrutura deste auto-indutor ainda não é totalmente conhecida, sabe-se apenas que é um composto aromático e

solúvel em metanol. Estudos18,64 ainda demonstraram que AI-3 é semelhante as catecolaminas adrenalina e noradrenalina, isso porque o AI-3 e as catecolaminas são reconhecidos pelo mesmo receptor, o qual está provavelmente na membrana externa da bactéria. A atividade de ambos os sinais, AI-2 e AI-3 pode ser diferenciada pelo uso do ensaio de bioluminescência, visto que o AI-3 não induz a produção de luz em Vibrio harveyi. Outra característica que pode diferenciar o AI-2 do AI-3, é que o AI-3 se liga a colunas de C18, é menos polar e é eluído somente com metanol, enquanto que AI-2 é uma furanona polar, que não se liga a colunas de C18 e é eluído com tampão.64

Auto-indutores 2 e 3 são produzidos pela flora normal do trato gastrointestinal e por bactérias saprófitas e patogênicas.80 Similar ao AI-2 e AI-3 produzidos pelas células bacterianas, adrenalina e noradrenalina são produzidas pelos mamíferos (hospedeiro) para comunicação celular. Estas são catecolaminas liberadas pelo sistema nervoso simpático e as bactérias utilizam as catecolaminas para ativar sua expressão gênica. 64 Noradrenalina é produzida pelo sistema nervoso entérico.32 Metade desta catecolamina presente nos mamíferos é sintetizada e utilizada no sistema nervoso entérico e a adrenalina é sintetizada no sistema nervoso central e na medula adrenal e não pelo sistema nervoso entérico. Fagócitos (macrófagos e neutrófilos) têm sido identificados como fontes de catecolaminas (noradrenalina ou adrenalina).26,27

Inicialmente, foi sugerido que luxS estava envolvido na síntese de AI-3, porque amostras mutantes para o gene luxS tiveram a produção de AI-3 alterada.64 Isso pode ter sido decorrente do fato que a mutação no gene luxS parece alterar o metabolismo celular, diminuindo a produção de AI-3, possivelmente pela redução dos níveis de tirosina na célula.80 Resultados obtidos por Walters et al.80 (2006) sugeriram que aminoácidos aromáticos, como tirosina, são importantes para a síntese do AI-3 e alterações metabólicas criadas pela própria mutação do luxS pode levar a uma diminuição na produção do AI-3.

A detecção de AI-3/adrenalina/noradrenalina é realizada através de um sistema de dois componentes formado por um sensor quinase, QseC, e um regulador da resposta, QseB.18 QseC liga-se diretamente a estas moléculas, QseC se autofosforila e, em seguida, transfere seu fosfato para QseB, ativando uma

cascata de sinais que culmina na transcrição de genes, como por exemplo, genes de virulência.5,7

Homólogos de QseC já foram identificados (já estão presentes) em ao menos 25 patógenos de importância em humanos e em plantas. Recentemente, foi identificada uma molécula denominada LED 209 (N-Phenyl – 4 – {[(phenylamino) thioxomethyl] amino} – benzenesulfonamide], que inibe a ligação do AI-3/adrenalina/noradrenalina ao receptor QseC, prevenindo a auto-fosforilação e consequentemente inibindo a ativação de genes de virulência. A expressão destes genes dependentes do receptor QseC em resposta à adrenalina e ao AI-3 foi inibida na presença de 5 pM de LED 209.59 Esta não é tóxica e não inibe o crescimento de patógenos, no entanto esse componente inibe a virulência de diversos patógenos e oferece uma estratégia para o desenvolvimento de drogas (fármacos) que poderão futuramente ser usadas no tratamento de infecções.59

2.3. Quorum Sensing e Patogenicidade de Salmonella Typhimurium

Auto-indutores e indutores produzidos por Salmonella Typhimurium estão envolvidos com a patogenicidade deste patógeno. Trabalhos tem mostrado que o gene luxS tem um papel na patogenicidade em muitos patógenos34,48 e isto também foi observado em Salmonella por Choi et al. (2007).17 O gene luxS responsável pela produção do AI-2 é exigido para que ocorra a eficiente invasão de Salmonella às células do hospedeiro, por diminuir a expressão de proteínas do Sistema de Secreção tipo III da Ilha de Patogenicidade tipo 1.17

Ainda relacionado ao luxS, Karavolos et al.37 (2008) demonstraram que o luxS em Salmonella Typhimurium tem um papel na variação de fase do flagelo e esta está relacionado à expressão da segunda flagelina de Salmonella codificada pelo gene fljB e uma importância menor por ser menos imunogênica, reprimindo a flagelina codificada pelo gene fliC, sendo esta altamente imunogênica.37 No entanto, esta participação do luxS na patogenicidade de Salmonella não foi observado por Perret e colaboradores56 (2009). Estes verificaram que a cepa mutante em luxS usada no experimento não diferiu da cepa controle na expressão e na secreção das proteínas do Sistema de Secreção tipo III, da SP-1, exigidas para a invasão.

QseC também está relacionado à patogenicidade bacteriana, visto que o uso de mutantes diminuiu a virulência da cepa usada.5,18,40,49. Cepas mutantes de QseC mostraram uma diminuição na motilidade, na invasão de células HeLa, na sobrevivência dentro de macrófagos e na virulência da infecção sistêmica de camundongos de Salmonella Typhimurium (MOREIRA et al.; 2010). Os resultados obtidos por Moreira e colaboradores49 (2010) sugerem que este sistema de sinalização AI-3/Adrenalina/Noradrenalina tem um importante papel durante uma infecção causada por este patógeno.

Estudos têm mostrado in vitro e in vivo que estas catecolaminas induzem um maior crescimento celular,2,6,9,29,58 a aderência celular,14 a expressão de genes de virulência,5,79 a produção de enterotoxina2 e aumentam a motilidade bacteriana.5,44,65 A indução do crescimento celular por estas catecolaminas está relacionada à habilidade em remover o ferro ligado a proteínas como transferrina e lactoferrina, atuando como sideróforos.6,31 A resposta ao crescimento celular também está relacionada a uma série de fatores, como: a especificidade e a concentração usada, a densidade celular e o próprio micro-organismo. Freestone et al.29 (2007) verificaram que a noradrenalina é a catecolamina mais potente na indução do crescimento celular das cepas testadas. Estes autores mencionam ainda que a habilidade das catecolaminas em afetar o crescimento bacteriano é mais evidente inicialmente em baixas densidades celulares (< 104 UFC/mL), sendo as maiores diferenças observadas com uma concentração < 102 UFC/mL, ou seja, simulando concentrações iniciais na infecção. Foi observado ainda por Freestone et al.30 (2002), que uma exposição de 2 a 4 horas à noradrenalina é exigida para afetar o crescimento bacteriano.

Trabalhos demonstram que noradrenalina tem um papel na patogenicidade de Salmonella. Bearson & Bearson5 (2008) pesquisaram a expressão de genes flagelares de Salmonella Typhimurium em resposta à exposição desta à concentração de 2mM de noradrenalina. Em resposta à catecolamina usada, houve uma maior expressão dos genes fliA, fliY e fljB, sendo esta confirmada por ensaios de motilidade em placas, contendo 0,3% de ágar. Cepas mutantes de QseC mostraram uma motilidade diminuída, sugerindo que noradrenalina modula a motilidade de Salmonella Typhimurium via receptor QseC. Somado ao exposto, Bearson et al.7 (2010), ainda verificaram que cepas mutantes de QseC apresentaram