NEW MICROSATELLITE LOCI FOR WATER YAM (DIOSCOREA ALATA, DIOSCOREACEAE) AND CROSS-AMPLIFICATION FOR OTHER DIOSCOREA SPECIES

e144

American Journal of Botany: e144–e146. 2011.

American Journal of Botany: e144–e146, 2011; http://www.amjbot.org/ © 2011 Botanical Society of America

Water yam ( Dioscorea alata L.) is one of the most widely

distributed species of the genus in the humid and semihumid

tropics (Lebot, 2009). Yam is also an important subsistence

crop associated with traditional agriculture systems worldwide

( Baco et al., 2007 ), known to maintain a wide genetic reservoir

represented by several varieties bearing various vernacular

names. Ethnobotanical studies held in local traditional

commu-nities in Africa revealed the great applicability of

D. alata

leaves in reducing fever and other health problems (Aiyeloja

and Bello, 2006). As for the nutritional quality, D. alata is a

good source of carbohydrates, protein, and vitamins. Despite its

cultural and economic importance in Brazil and other tropical

countries, yam has been poorly investigated. Consequently,

farmers in some countries are reporting the disappearance of

many cultivars, and this leads to signifi cant genetic erosion

( Baco et al., 2007 ).

Only a few microsatellite markers have been developed so

far for D. alata , as well as for other Dioscorea species ( Tostain

et al., 2006 , Hochu et al., 2006 ). In this paper, we describe

ad-ditional microsatellite loci to characterize D. alata accessions

in germplasm banks and to contribute to crop breeding

pro-grams. Five polymorphic microsatellites or simple sequence

repeat (SSR) markers have been developed for D. alata ( Tostain

et al., 2006 ), but additional loci are necessary for the

investiga-tion of genetic diversity and genetic structure of D. alata

variet-ies and populations. Therefore, in this study we isolated 14

additional codominant polymorphic microsatellite markers using

a microsatellite-enriched genomic library technique ( Billotte

et al., 1999 ). Additionally, the microsatellite primers that showed

good results were tested for cross-amplifi cations in three other

Dioscorea species ( D. cayenensis Lam. -D. rotundata Poir, D.

trifi da L., and D. bulbifera L.).

METHODS AND RESULTS

Genomic DNA was isolated from young leaves of 80 genotypes of D. alata , originating from different regions in Brazil (North, Northeast, South, South-east, and Central-West), including mostly landraces and a few commercial va-rieties collected in the States of S ã o Paulo, Santa Catarina, Minas Gerais, Mato Grosso, Pernambuco, Piau í , and Para í ba. Seventeen landraces were obtained from agricultural fi elds in the Northeast region, 18 in the Central-West, 18 in the Southeast, nine in the South and one landrace only was obtained in the North region. The 17 commercial varieties were obtained from germplasm banks, fairs, and local markets. As the genetic diversity of water yam in Brazil-ian territory is unknown, the sample sizes were aimed to cover a large spectrum of the agroecosystem.

For DNA extraction we used the CTAB (Cetyltrimethyl Ammonium Bro-mide) method developed by Sharma et al. (2008) with few modifi cations, such as the use of young expanded lyophilized leaves. A microsatellite-enriched library was obtained using adapted protocols from Billotte et al. (1999) . Genomic DNA samples were digested with RsaI restriction enzyme, and the resulting DNA fragments were linked to RsaI adapters. The library was

1 _{Manuscript received 18 December 2010; revision accepted 27 January 2011.}

This work was supported by FAPESP (Funda ç ã o de Amparo à Pesquisa do Estado de S ã o Paulo) and CAPES (Coordena ç ã o de Aperfei ç oamento de Pessoal de N í vel Superior), Brazil. The authors also thank Karl Schmid, Torsten Gunther, and Inka Gawenda for critical comments.

5 _{Author for correspondence: eaveasey@esalq.usp.br} doi:10.3732/ajb.1000513

AJB Primer Notes & Protocols in the Plant Sciences

N

EW

MICROSATELLITE

LOCI

FOR

WATER

YAM

( D

IOSCOREA

ALATA

, D

IOSCOREACEAE

)

AND

CROSS

-

AMPLIFICATION

FOR

OTHER

D

IOSCOREA

SPECIES

1

Marcos V. B. M. Siqueira

_{, Thiago G. Marconi}

_{, Maria L. Bonatelli}

_,

Maria I. Zucchi

_{, and Elizabeth A. Veasey}

2 _{Departamento de Gen é tica, Escola Superior de Agricultura “ Luiz de Queiroz, ” Universidade de S ã o Paulo, CP 83, Piracicaba,} SP, Brazil, CEP 13400-970; 3 _{Centro de Biologia Molecular e Engenharia Gen é tica (CBMEG), Universidade Estadual de} Campinas, CP 6010, Campinas, SP, Brazil, CEP 13083-970; and 4 _{P ó lo Regional Centro Sul — Ag ê ncia Paulista de Tecnologia}

dos Agroneg ó cios/APTA, Rodovia SP127, Km 30, Bairro: Vila F á tima, Piracicaba, SP, Brazil, CEP 13400-970 • Premise of the study: Dioscorea alata L. is one of the most widely distributed species of the genus in the humid and semihumid

tropics and is associated with traditional agriculture. Only a few microsatellite markers have been developed so far for this and other Dioscorea species.

• Methods and Results: We isolated 14 codominant polymorphic microsatellite markers using a microsatellite-enriched genomic library technique. Ten microsatellite loci were selected, and 80 D. alata accessions from different regions in Brazil were evalu-ated with nine polymorphic loci. The polymorphism information content (PIC) varied from 0.39 to 0.78 and the power dis-crimination (PD) ranged from 0.15 to 0.91. Six of the markers showed transferability for the species D. bulbifera, D.

cayenensis-D. rotundata, and D. trifi da.

• Conclusions: The SSR markers obtained are an important tool for further studies aiming to characterize the genetic diversity in D. alata and other Dioscorea spp. accessions.

e145

June 2011]

AJB Primer Notes & Protocols — New microsatellite primers for water yam

at 72 ° C, with a fi nal extension at 72 ° C for 8 min ( Tostain et al., 2006 ). The amplifi cation products were submitted to electrophoresis in 7% denaturing polyacrylamide gels under an initial voltage of 60 V for 30 min and 120 V for 3 h. The gels were silver stained according to Creste et al. (2001) .

From the 14 microsatellite markers, 10 were successfully amplifi ed by PCR. Nine microsatellite markers showed polymorphism, and one was shown to be monomorphic. The SSR primers obtained in this study were used as dominant markers to evaluate the genetic divergence among germplasm accessions of D. alata and related species. A total of 47 putative alleles (bands) were obtained for the nine loci. The number of alleles ranged from 3 to 8, with an average of 5.22 alleles per locus. Polymorphism Information Content (PIC) was calculated using the PIC calculator to estimate the markers informativeness. The PIC val-ues of the nine microsatellite loci ranged from 0.39 to 0.78, with an average of 0.65. The highest PIC value was found for the H12 locus (PIC = 0.78), which contained the highest allele number (8 alleles). For the purposes of comparing the effi ciency of the markers in genotype identifi cation, we estimated the power discriminating (PD) of each primer ( Tessier et al., 1999 ). The calculated PD values ranged from 0.15 to 0.91, with an average of 0.68. The higher PD values were found for locus H2 (0.91) and B5 (0.90) ( Table 1 ).

In addition, cross-amplifi cations were done to test their transferability to three other Dioscorea spp.: D. bulbifera , D. cayenensis-D. rotundata, and D.

trifi da , using the experimental protocols described above, except the PCR was

performed using a touchdown system in the following conditions: fi rst denatur-ation phase at 94 ° C for 5 min, followed by a second phase of 10 cycles at 95 ° C for 30s, 55 ° C to 45 ° C for 30 s (gradient temperature reducing one degree in each cycle, initiating at 55 ° C and fi nishing at 45 ° C), and 72 ° C for 50 s. A third phase followed of 30 cycles at 95 ° C for 30 s, 45 ° C for 30 s, and 72 ° C for 50 s. Results of the cross-amplifi cation tests showed that six loci allowed the trans-ferability for the three species of Dioscorea , ranging from 33 to 100% cross-amplifi cation ( Table 2 ) . Primers A4, F1, H12, and H2 showed 100% transferability. When considering each species, six loci showed transferability for D. trifi da, while fi ve loci showed transferability for D. bulbifera, and only four showed cross-amplifi cation for D. cayenensis-D. rotundata ( Table 2 ).

Tostain et al. (2006) found that transferability was higher for species belonging to the same botanical section (sect. Enantiophyllum ), but this result was not found in our study.

CONCLUSIONS

The development of SSR molecular markers for D. alata is

essential for ongoing research on this species. The generated

information is of great importance for the identifi cation,

ratio-nal exploitation, and conservation of the genetic variability of

this species.

enriched for dinucleotide sequences using (CT) 8 and (GT) 8 biotinylated

micro-satellite primers with labeled probes that were bound to Streptavidine Magne-Shere Paramagnetic Particles as described by the manufacturer (Promega, São Paulo, Brazil).

Selected fragments were amplifi ed by polymerase chain reaction (PCR) us-ing primer sequences complementary to the adapters and then ligated into a pGEM-T vector (Promega) (Francine et al., 2009). Plasmids were transformed into competent XL-1 Blue Escherichia coli cells. Transformed cells were culti-vated on agar medium containing 100 µ g ml-1 ampicillin, 50 µ g ml-1 X-galac-tosidase, and Isopropyl b-D-1-thiogalactopyranoside (IPTG). Single white colonies were transferred into microplates for long-term storage at − 80 ° C. A total of 48 positive clones were sequenced in both directions in automated sequencer ABI PRISM 377 (PerkinElmer, Applied Biosystems, São Paulo, Brazil) using T7 and SP6 primers and the v3.1 Big Dye terminator kit (Applied Biosystems). Sequences were assembled and edited with Seqman (DNAStar). The Simple Sequence Repeat Identifi cation Tool (SSRIT) was used to search and identify microsatellites ( Temnykh et al., 2001 ). Twenty-nine sequences containing mic-rosatellite markers and fl anking regions suitable for primer design were selected. The Primer Select (DNAStar) software was used to design the primers, and 14 were suitable for designing the primers.

The PCRs were performed in a fi nal volume of 16 μ L, consisting of 0.2 μ L of Taq Polymerase (5 U/ μ L) (LGC); 1.6 μ L 10 × Buffer; 0.8 μ L MgCl 2 (50

mM); 0.48 μ L of each primer (F/R) (5 pmoles/ μ L); 1.28 μ L dNTP (2.5 mM of each deoxyribonucleotide) (LGC); 7.16 μ L Milli-Q H 2 O and 4.0 μ L DNA

(5 ng). The reactions were carried out using the thermocycler BioRad, MyCy-cler model, in the following amplifi cation conditions: initial denaturalization at 94 ° C for 5 min, followed by 35 cycles of denaturalization at 94 ° C for 30 s, 1 min at the defi ned annealing temperature for each primer ( Table 1 ) , and 1 min

Table 1. Characteristics of nine polymorphic microsatellite markers isolated from Dioscorea alata . Locus

name Repeat Motif Primer sequence (5 ′ – 3 ′ )

GenBank Accession No. No. of alleles Allele size range (bp) PIC D Ta ( ° C) A4 (CT)2(GAA)3GA(GAA) F: TTCGTTCTCGATAGCGGACT GF110447 5 130 – 160 0.706 0.880 53 R: CCAGTTCCCAGCCTCTTGT B5 (TG)8 F: TTCCCCTGTAGGAAAAATAGTGA GF110448 7 150 – 160 0.774 0.902 60 R: CGTCCCTAGAAAATTCAACCTC C5 (TG)7CG(TA)5 F: AACCAATTACCCTTTGTCATGG GF110450 3 145 – 180 0.454 0.488 58 R: GCCTTGCAAGCAATTTTGA

E11 (CCA)4(CA)7 F: ATGGTGTTCTCCCATGCTTC GF110452 4 240 – 280 0.594 0.589 55

R: ACCAAAAATCAGGCTTGTGC F1 (TA)5 F: ATGGCTCAAGAGCACACG GF110453 6 130 – 180 0.637 0.586 58 R: GGGCCTCATAAACATGCAAT G4 (CA)10 F: TGAGCCTCCTATTTCCCAAG GF110454 5 190 – 210 0.696 0.746 62 R: ATCAAGTCCAGGATCGCTCA H12 (AT)6 F: TTGTAATTGGGTGTTGTATTTGC GF110455 8 140 – 160 0.778 0.884 53 R: CGGCCAAAACATTTTCTGAT H2 (CA)9 F: AAACCAAACAGGCAAAGCAT GF110456 6 160 – 250 0.776 0.916 58 R: TGCCCTGCTTGTAAGATTGA

E10 (CA)12 F: GAATACTGATGATGCATAAAGCAA GF110626 3 150 – 175 0.393 0.153 58

R: CCATGGTGAAGAGGATGGAT

Average 5.22 0.645 0.683 —

PIC, Polymorphism Information Content; Ta, annealing temperature of the primer pairs; D, Discriminating power.

Table 2. The cross-amplifi cation of nine microsatellites loci from D.

alata in three other Dioscorea species.

Locus D. bulbifera D. cayenensis-D. rotundata D. trifi da

A4 + + + B5 — — — C5 + — + E11 — — — F1 + + + G4 — — — H12 + + + H2 + + + E10 — — +

+, successful amplifi cation with one or more bands of a size similar to that of the original sequenced clone; – , no amplifi cation.

e146

American Journal of Botany

[Vol. 0

LITERATURE CITED

Aiyeloja , A. A. , and O. A. Bello . 2006 . Ethnobotanical potentials of common herbs in Nigeria: A case study of Enubu state. Educational

Research Review 1 : 16 – 22 .

Baco , M. N. , G. Biaou , and J. P. Lescure . 2007 . Complementarity between geographical and social patterns in the preservation of yam ( Dioscorea sp.) diversity in Northern Benin. Economic Botany 61 : 385 – 393 . Billotte , N. , P. J. L. Lagoda , A. M. Risterucci , and F. C. Baurens .

1999 . Microsatellite-enriched libraries: Applied methodology for the development of SSR markers in tropical crops. Fruits 54 : 277 – 288 .

Creste , S. , A. Tulmann-Neto , and A. Figueira . 2001 . Detection of single sequence repeat polymorphisms in denaturing polyacrylam-ide sequencing gels by silver staining. Plant Molecular Biology 19 : 299 – 306 .

Francini , I. B , D. A. Sforça , A. C. B. Sousa , T. Campos , F. W. Cidade , M. I. Zucchi , A. P. Souza , C. G. Nunes-Silva , and G. A. Carvalho-Zilse . 2009 . Microsatellite loci for an endemic stingless bee Melipona

seminigra merrillae (Apidae, Meliponini) from Amazon. Conservation Genetic Resources 1 : 487 – 490 .

Hochu , I. , S. Santoni , and M. Bousalem . 2006 . Isolation, character-ization and cross-species amplifi cation of microsatellite DNA loci in the tropical American yam Dioscorea trifi da. Molecular Ecology

Notes 6 : 137 – 140 .

Lebot , V. 2009 . Tropical root and tuber crops: Cassava, sweet potato, yams and aroids. 17th Edition, CABI, Wallingford .

Sharma , K. , A. K. Mishra , and R. S. Misra . 2008 . A simple and ef-fi cient method for extraction of genomic DNA from tropical tuber crops. African Journal of Biotechnology 7 : 1018 – 1022 .

Temnykh , S. , G. Declerck , A. Lukashova , L. Lipovich , S. Catinhour , and S. McCouch . 2001 . Computational and experimental analysis of microsatellites in rice ( Oryza sativa L.): Frequency, length varia-tion, transposon associations, and genetic marker potential. Genome 11 : 1441 – 1452 .

Tessier , C. , J. David , P. This , J. Boursiquot , and A. Charrier . 1999 . Optimizations of the choice of molecular markers for varietal identifi ca-tion in Vitis viniferal L. Theoretical and Applied Genetics 98 : 171 – 177 . Tostain , S. , N. Scarcelli , P. Brottier , J. L. Marchand , J. L. Pham ,

and J. L. Noyer . 2006 . Development of DNA microsatellite mark-ers in tropical yam ( Dioscorea sp.). Molecular Ecology Notes 6 :