• Nenhum resultado encontrado

Transposon-Based Reporter Marking Provides Functional Evidence for Intercellular Bridges in the Male Germline of Rabbits.

N/A
N/A
Protected

Academic year: 2017

Share "Transposon-Based Reporter Marking Provides Functional Evidence for Intercellular Bridges in the Male Germline of Rabbits."

Copied!
15
0
0

Texto

Loading

Imagem

Fig 1. Differential Venus expression in the SB-CAG-VENUS rabbit spermatozoa (FACS). Semen derived from a wild type (black), a hemizygous (# 4004, light gray) and a homozygous (# 4007, gray) buck.
Table 1. Comparative data on litter size and transgene inheritance SB-CAG-Venus hemi- and homozygote bucks and in two independent trans- trans-genic lines, in which the transgene product is not expressed in the spermatozoa.
Fig 3. Comparison of Venus expression in the developing testis of # SB3JT bucks. Venus expression shows an increasing pattern in the 42 days hemizygous (A), 60 days hemizygous (B) 120 days old hemizygous (C) and homozygous testis (D)
Fig 4. Absence of Venus transcript in SB-CAG-VENUS spermatozoa. The following primer pairs were used in RT-PCR experiments: Fig 4A: YFP Venus specific primer:Forward: 5 ’ GGTCCCTCTTCTCGTTAGGG 3 ’ Reverse: 5 ’ TACAAGACCAGAGCCGAGGT 3 ’ Fig 4B: neonatal rabbi
+5

Referências

Documentos relacionados

The probability of attending school four our group of interest in this region increased by 6.5 percentage points after the expansion of the Bolsa Família program in 2007 and

Cells from the spermatogenic lineage were divided in four phases: spermatogonia (primary and secondary), spermatocytes (primary and secondary), spermatids and

Ousasse apontar algumas hipóteses para a solução desse problema público a partir do exposto dos autores usados como base para fundamentação teórica, da análise dos dados

Overall, our group of authors notes diverse issues regarding the Gold OA model where authors must pay—some of us have had positive experiences, whereas others have found it

Os recursos humanos são considerados como um dos elementos essenciais na organização no processo produtivo da empresa. Assim, o desenvolvimento dos recursos humanos terá como

Figure 6. Analysis of MAMDC1 protein expression. IHC analysis of MAMDC1 protein expression in A) testis, showing positive staining in Leydig cells; B) testis, negative control;

social assistance. The protection of jobs within some enterprises, cooperatives, forms of economical associations, constitute an efficient social policy, totally different from

Além disso, o modelo reflete a tendência em direção à prática baseada em evidências, enquanto simultaneamente representa a contribuição singular da Enfermagem para o cuidado