• Nenhum resultado encontrado

Cdx, Wnt signalling and anterior Hox genes in the regulation of the posterior growth zone in mouse embryo

N/A
N/A
Protected

Academic year: 2021

Share "Cdx, Wnt signalling and anterior Hox genes in the regulation of the posterior growth zone in mouse embryo"

Copied!
58
0
0

Texto

(1)

DEPARTAMENTO  DE  BIOLOGIA  ANIMAL  

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Cdx,  Wnt  signalling  and  anterior  Hox  genes  in  

the  regulation  of  the  posterior  growth  zone  

in  the  mouse  embryo.  

 

 

 

 

Ana  Rita  Soares  Monteiro  

 

 

 

Dissertação  

Mestrado  em  Biologia  Evolutiva  e  do  Desenvolvimento  

2012  

(2)

 

 

 

(3)

UNIVERSIDADE  DE  LISBOA  

FACULDADE  DE  CIÊNCIAS  

DEPARTAMENTO  DE  BIOLOGIA  ANIMAL  

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Cdx,  Wnt  signalling  and  anterior  Hox  genes  in  

the  regulation  of  the  posterior  growth  zone  

in  the  mouse  embryo.  

 

 

 

 

Ana  Rita  Soares  Monteiro  

 

 

Dissertação  

Mestrado  em  Biologia  Evolutiva  e  do  Desenvolvimento  

 

Orientadores:  Doutora  Jacqueline  Deschamps  e  Doutora  Sólveig  Thorsteinsdóttir  

 

(4)

 

 

(5)
(6)

 

V  

Abstract  

 

The   Cdx   gene   family   plays   a   fundamental   role   in   the   regulation   of   the   posterior   growth   zone   during   mouse   development.   This   region   contains   populations   of   long–term   neuromesodermal  progenitors  that  contribute  to  axis  elongation  [1].    Cdx2+/-­‐Cdx4-­‐/0  (Cdx2/4)  

mutants   have   a   truncation   of   the   axis   and   defects   in   the   placental   labyrinth   leading   to   embryonic  lethality.  Rescuing  experiments  showed  that  Wnt  signalling  and  Hox  trunk  genes   interact  with  Cdx  genes  in  the  regulation  of  axial  extension  [2].  In  the  first  part  of  this  work   we  studied  the  lethality  in  mutants  that  lack  one  allele  of  Cdx2  and  both  alleles  of  Wnt3a.   We  show  that  Wnt3a  and  Cdx2  interact  in  the  regulation  of  placental  labyrinth  precursors   and  act  upstream  of  Cdx4.    

Previous   findings   revealed   that   trunk   Hox   genes   and   Hox13   differentially   regulate   posterior  axial  growth  [2].  Here  we  tested  the  role  of  an  anterior  Hox  gene  (Hoxb1)  in  the   regulation   of   axial   elongation.   We   showed   that   overexpression   of   Hoxb1   under   the   Cdx2   promoter  in  a  genetic  background  of  Cdx2/4  mutants  aggravates  the  phenotype  instead  of   rescuing  it.  Cdx2/4  Cdx2PHoxb1  transgenic  embryos  present  embryonic  lethality  and  a  more   severe  truncation  of  the  axis  compared  to  their  Cdx2/4  littermates.  Therefore,  we  propose   that   anterior   Hox   genes   are   epistatic   over   the   trunk   Hox   genes.   To   assure   the   right   regulation  of  axis  extension  Cdx  genes  would  interact  in  a  positive  way  with  trunk  Hox  genes.   However,  the  presence  of  anterior  Hox  genes  would  disrupt  the  balance  between  anterior   and  trunk  Hox  genes.  

 

Keywords:  Axial  extension,  mouse,  Cdx  ,  Hox,  Wnt                                      

(7)

Resumo  

 

Durante   o   processo   de   gastrulação   as   camadas   germinativas   do   embrião   são   formadas  e  o  plano  corporal  do  organismo  é  estabelecido.  Após  a  gastrulação  o  crescimento   do  eixo  em  ratinho  ocorre  por  um  processo  designado  de  extensão  axial.  A  parte  posterior   do   eixo   do   ratinho   cresce   através   da   adição   de   tecidos   provenientes   de   populações   de   progenitores   residentes   na   linha   primitiva   e   tecidos   adjacentes,   mais   tarde   no   “botão   da   cauda”  [1].  Esta  região  é  por  esse  motivo  denominada  de  “zona  de  crescimento  posterior”.   Nesta   região   estão   presentes   progenitores   da   mesoderme   extraembrionária,   células   germinais   primordiais,   mesoderme   somítica,   neuroectoderm,   progenitores   neuro-­‐ mesodérmicos  de  longo  termo  e  precursores  de  endoderme.  A  ordem  referida  é  a  ordem  da   sua  localização  dos  mais  posteriores  para  os  a  mais  anteriores  na  linha  primitiva.  A  regulação   e   manutenção   destes   progenitores   é   essencial   para   extensão   do   eixo,   manutenção   das   células  germinais  primordiais  e  desenvolvimento  da  mesoderme  extraembrionária  que  dará   origem   ao   alantoide.   Esta   regulação   é   assegurada   pela   acção   de   factores   de   transcrição,   como   Cdx   (Caudal   related   homeobox)   que   actua   como   regulador   dos   genes   Hox   e   via   de   sinalização  Wnt/Beta-­‐catenina  [2].  A  família  de  genes  Cdx  é  constituída  por  três  genes  (Cdx1,  

Cdx2   e   Cdx4).   Mutantes   de   Cdx   apresentam   o   eixo   antero-­‐posterior   truncado,   cuja  

severidade  depende  dos  genes  ou  do  número  de  alelos  mutados.  Alguns  destes  mutantes   apresentam   defeitos   nos   tecidos   extraembrionários,   ausência   de   alantoide   no   caso   mais   extremo   e   malformações   no   labirinto   vascular   da   placenta.   Os   defeitos   nos   tecidos   extraembrionários  provocam  letalidade  embrionária  uma  vez  que  os  embriões  são  incapazes   de   estabelecer   correctamente   contacto   com   o   sangue   materno   e   assim   prosseguir   com   a   troca  de  nutrientes.  Mutantes  de  Cdx  também  apresentam  defeitos  na  padronização  do  eixo   axial   com   algumas   transformações   ao   nível   da   identidade   vertebral.   Um   dos   mutantes   de  

Cdx   mais   estudado   é   o   de   Cdx2+/-­‐Cdx4-­‐/0  (Cdx2/4)   [2-­‐4].   O   fenótipo   destes   mutantes  

apresentam  diferentes  penetrâncias  ,  o  nível  de  truncamento  varia  (  no  caso  mais  severo  o   eixo  termina  ao  nível  do  sacro)  assim  como  os  defeitos  que  causam  letalidade  embrionária.   Em  alguns  embriões  o  alantóide  não  se  funde  com  o  córion,  noutros  casos  os  defeitos  são  ao   nível  do  labirinto  placentário.  Apenas  uma  pequena  percentagem  de  embriões  nasce  [4].    

A  primeira  parte  deste  trabalho  tem  como  objectivo  estudar  a  interacção  de  genes  

Cdx   e   a   via   de   sinalização   Wnt   através   do   estudo   de   mutantes   Wnt3a-­‐/-­‐Cdx2+/-­‐.   Trabalhos  

anteriores   demonstraram   que   Wnt   actua   tanto   a   jusante   como   a   montante   de   Cdx   no   processo   de   extensão   axial,   Lef1   (mediador   da   via   Wnt   canónica)   foi   capaz   de   resgatar   o  

(8)

 

VII  

entre  Cdx  e  a  via  de  sinalização  Wnt.  Os  mutantes  gerados,  Wnt3a-­‐/-­‐Cdx2+/-­‐  sofrem  letalidade  

embrionária.   Este   fenótipo   não   era   espectável   uma   vez   que   mutantes  Cdx2+/-­‐     e   mutantes  

Wnt3a-­‐/-­‐    não  apresentam  qualquer  letalidade  embrionária.  Colocámos  a  hipótese  de  que  a  

causa  da  letalidade  destes  mutantes  seria  a  mesma  que  a  observada  em  mutantes  Cdx2/4,  e   portanto  que  a  mesma  via  de  regulatória  estaria  a  ser  afectada.  Para  testar  esta  hipótese,   analisaram-­‐se  alantóides  de  embriões  de  dia  embrionário  8.5  (E8.5)  e  placentas  de  embriões   de  E10.5.  Alantóides  dos  mutantes  desenvolvem-­‐se  correctamente  e  a  maioria  funde  com  o   córion.   Cortes   de   placentas   mostraram   defeitos   na   ramificação   dos   vasos   sanguíneos   embrionários,   mas   menos   severos   que   os   descritos   em   mutantes   Cdx2/4.   Devido   à   semelhança   com   Cdx2/4   foi   testada   a   hipótese   da   expressão   de   Cdx4   estar   afectada   em   mutantes  Cdx2+/-­‐Wnt3a-­‐/-­‐  .  Os  baixos  níveis  de  expressão  de  Cdx4  observados  em  mutantes  

confirmou  esta  hipótese.  Estes  resultados  levaram  nos  a  concluir  que  genes  Cdx  e  a  via  de   sinalização  Wnt  actuam  em  conjunto  na  regulação  da  população  de  progenitores  dos  tecidos   que  darão  origem  ao  labirinto  placentário.  

No   segundo   projecto   foi   explorada   a   função   de   genes   Hox   anteriores   (Hox1-­‐3)   na   regulação  da  extensão  axial.  Os  genes  Hox  têm  um  papel  fundamental  no  estabelecimento   da  identidade  dos  segmentos  ao  longo  do  eixo  anterio-­‐posterior.  No  entanto,  os  genes  Hox   do   tronco   (Hox5-­‐9)   também   estão   envolvidos   na   extensão   do   eixo.   Este   papel   é   desempenhado   em   paralelo   com   os   genes   Cdx.   Os   genes   Hox   e   genes   Cdx   têm   um   gene   ancestral   em   comum   e   durante   o   desenvolvimento   partilham   domínios   de   expressão   na   região  posterior  do  embrião  [6].  Sobrexpressão  de  Hoxb8  e  Hoxa5  sob  o  promotor  de  Cdx2   levou   ao   resgate   do   fenótipo   de   mutantes   Cdx2/4,  demonstrando   assim   uma   função   na   regulação  da  extensão  do  eixo.  Estes  embriões  transgénicos  (Cdx2/4  Cdx2PHoxb8  e  Cdx2/4  

Cdx2PHoxa5)  apresentaram  menor  letalidade  e  o  eixo  axial  apresenta  truncamento  menos  

severo,   relativamente   aos   embriões   Cdx2/4   [2].   Neste   projecto   propusemos   testar   se   a   sobreexpressão  de  Hoxb1  (gene  Hox  anterior)  sob  o  mesmo  promotor,  resgataria  o  fenótipo   de   Cdx2/4.     Foram   criadas   diferentes   linhas   transgénicas   com   a   construção   Cdx2PHoxb1   expressa  no  fundo  genético  de  mutantes  Cdx2/4.  A  sobrevivência  e  esqueleto  axial  destes   indivíduos   foram   analisados.   A   presença   do   transgene   Hoxb1   não   resgatou   a   letalidade   embrionária  de  mutantes  Cdx2/4  e  em  algumas  linhas  transgénicas  aumentou  a  letalidade.   De  todas  as  linhas  obteve-­‐se  apenas  um  recém-­‐nascido  com  o  genótipo  Cdx2/4  Cdx2PHoxb1   o   que   indica   que   a   presença   de   Hoxb1   está   a   agravar   o   fenótipo   de   Cdx2/4.   A   análise   do   esqueleto  axial  dos  mutantes  com  e  sem  o  transgene  mostrou  que  em  todos  os  mutantes  de  

(9)

base  nestes  resultados  propomos  que  Hoxb1  interage  com  genes  Cdx/Hox  centrais  de  forma   antagonísitca  no  processo  de  extensão  axial.  Os  genes  Hox  mais  afastados  de  genes  centrais   do   cluster   actuam   de   forma   epistática   sobre   estes,   o   que   explicaria   o   agravamento   do   fenótipo   de   Cdx2/4   Cdx2PHoxb1.   Em   suma,   ao   longo   do   processo   de   extensão   axial   é   necessário   um   balanço   entre   genes   Hox   anteriores   e   posteriores,   estabelecido   através   de   interacções  epistásticas.    

     

Palavras  chave:  Genes  Cdx,  extensão  axial,  sinalização  Wnt,  genes  Hox                              

 

 

 

 

(10)

 

IX  

Abbreviation  List  

 

AP   Anterior-­‐posterior  

C   Celsius  

ADH   Alcohol  dehydrogenase  

AP   Alkaline  phosphatase  

Cdx2/4   Cdx2+/-­‐  Cdx4  null  

CHAPS   3[(3-­‐Cholamidopropyl)dimethylammonio]-­‐propanesulfonic  acid  

Cyp26a1   Cytochrome  P450,  family  26,  subfamily  A,  polypeptide  1  

DEPC   Diethylpyrocarbonate  

DIG   Digoxigenin  

DNA   Deoxyribonuclease  acid  

DNAse   Deoxyribonuclease  

dNTP   Deoxyribonucleotide  triphosphate  

DTT   Dithiothreitol  

E   Embryonic  day  

EDTA   Ethylene  diamine  tetraacetic  acid  

et  al.   et  alii  (and  others)  

EtOH   Ethanol  

FGF   Fibroblast  growth  factor  

FGFR   Fibroblast  growth  factor  receptor  

H   Hour  

ICM   Inner  cell  mass  

LB   Lysogeny  broth  

Lef1   Lymphoid  enhancer-­‐binding  factor  1  

LiCl   Lithium  Chloride  

M   Molar   MetOH   Methanol   MgCl2   Magnesium  dochloride   min   Minutes   ml   Milliliter   mM   Millimolar  

MAB   Maleic  acid  buffer  

NaAC   Sodium  Acetate  

ng   Nanogram  

NTMT   Alkaline  phosphatase  buffer  

PBS0   Phosphate  buffered  saline  (without  calcium  and  magnesium)  

PCR   Polymerase  Chain  Reaction  

PFA   Paraformaldehyde  

PGC   Primordial  germ  cell  

PSM   Presomitic  mesoderm  

RA   Retinoic  acid  

RALDH   Retinaldehyde  dehydrogenase    

Raldh2   Retinaldehyde  dehydrogenase  type  2  

(11)

RDH   Retinol  dehydrogenase  

RNA   Ribonucleic  acid  

RNAse   Ribonuclease  

rpm   Revolutions  per  minute  

RT   Room  temperature  

RXR   Retinoic  X  receptor  

sec   Seconds  

SDS   Sodium  dodecyl  sulphate  

SRY   Sex-­‐determining  region  Y  

SSC   Saline  Sodium  Citrate  

Taq  polymerase   Thermicus  aquaticus  polymerase  

TBS   Tris  buffered  Saline  

TCF   T  cell  factor  

TE   Tris  EDTA  

tRNA   Transfer  ribonucleic  acid  

VE   Visceral  endoderm  

VEGF   Vascular  endothelial  growth  factor    

μg   Microgram  

μl   Microliter  

(12)

  XI  

Table  of  contents  

ABSTRACT  

V  

RESUMO  

VI  

ABBREVIATION  LIST  

IX  

TABLE  OF  CONTENTS  

XI  

GENERAL  INTRODUCTION  

1  

Early  mouse  development   1

 

Axis  elongation  and  axial  progenitor  cells   1

 

Wnt  signalling   2

 

Retinoic  acid  signalling   2

 

FGF  signalling   3

 

Cdx  genes   3

 

Cdx  null  mutants  and  the  genetic  control  of  axial  extension   5

 

AIM  OF  THIS  THESIS  

7  

CHAPTER  I  -­‐  INVOLVEMENT  OF  THE  CANONICAL  WNT  PATHWAY  DOWNSTREAM  OF  

CDX  GENES  IN  THE  FORMATION  OF  THE  PLACENTAL  LABYRINTH  

9  

Introduction   9

 

Placental  labyrinth  development   9

 

Cdx  genes  and  Wnt  signalling  pathway  in  placenta  formation   9

 

Methods   11

 

Mice   11

 

Isolation  embryos  and  processing   11

 

Genotyping   11

 

Histological  analysis   11

 

In  situ  hybridization   12

 

Results   14

 

Wnt3a-­‐/-­‐  Cdx2+/-­‐  embryos  have  defects  in  placental  labyrinth  similar  to  Cdx2/4  mutants   14

 

Cdx4  is  downregulated  in  Wnt3a-­‐/-­‐Cdx2+/-­‐  mutants   14

 

Discussion   16

 

CHAPTER  II  –  ANTERIOR  HOX  GENES  AND  AXIAL  ELONGATION  

17  

Introduction   17

 

The  vertebrate  axis   17

 

Hox  genes  and  vertebrate  axis   17

 

Hox  genes  expression  and  regulation   18

 

(13)

Generation  of  transgenic  constructs  and  mice   21

 

Isolation  of  embryos   21

 

Bone  and  cartilage  staining   21

 

Genotyping   21

 

RNA  isolation   22

 

DNAse  treatment   22

 

cDNA  synthesis   23

 

Quantitative  RT-­‐PCR  analysis   23

 

Results   24

 

Hoxb1  is  overexpressed  in  the  Cdx2PHoxb1  transgenic  mice   24

 

Hoxb1  transgene  does  not  recue  defects  from  the  placental  labyrinth  of  Cdx2/4  mutants.   25

 

Hoxb1  does  not  rescue  the  axial  defects  of  Cdx  mutants   26

 

Analysis  of  the  phenotype  of  Hoxb1  transgenic  embryos   31

 

Discussion   33

 

CONCLUDING  REMARKS  

35  

REFERENCES  

37  

ANNEXES  

43  

Annex  I   43

 

Annex  II   44

 

                                         

(14)

 

1  

General  Introduction    

 

 

 

Early  mouse  development  

The   early   patterning   of   the   embryo   and   the   onset   of   subsequent   morphogenesis   occurs   during   what   could   be   considered   the   most   important   process   in   development,   gastrulation.   Gastrulation   is   characterized   by   morphogenetic   movements   accompanied   by   cell   proliferation   and   differentiation   which   will   eventually   convert   the   embryo   into   three   germ   layers,   the   ectoderm,   mesoderm   and   endoderm   [7].   The   mouse   gastrulates   by   the   ingression  of  cells  from  the  epiblast  through  the  primitive  streak,  a  structure  that  emerges  in   the  posterior  region  of  the  embryo  at  embryonic  day  (E)  6.2  [8].  During  gastrulation,  nodal-­‐ dependent  signals  from  the  VE  have  a  role  in  the  regionalization  in  the  primitive  streak,  with   the   node   in   the   most   anterior   region   [9].  Fate   maps   provided   by   clonal   analysis   of   single   epiblast  cells  show  that  the  epiblast  is  regionalized;  however  individual  cells  can  contribute   to  multiple  germ  layers  [10].  The  node  organizes  the  ingression  of  epiblast  cells  through  the   primitive   streak.   Once   ingressed,   mesodermal   tissues   differentiate   in   lateral   mesoderm   (circulatory  system,  limb  bud  mesenchyme  and  wall  of  the  digestive  organs),  intermediate   mesoderm   (urogenital   system)   or   paraxial   mesoderm   (presomitic   mesoderm   and   somites)   [8].    

 

Axis  elongation  and  axial  progenitor  cells    

By   the   end   of   gastrulation,   only   the   most   rostral   tissues   are   formed   and   the   elongation  of  the  anterior-­‐posterior  (AP)  axis  continues  by  the  addition  of  tissues  from  the   primitive  streak  and  adjacent  epiblast,  and  later  from  the  tail  bud  [1,11].  The  source  of  these   axial  tissues  is  a  pool  of  progenitors,  some  of  which  have  stem  cell  properties  [1].  These  axial   structures   are   added   in   an   rostral-­‐to-­‐caudal   sequence   as   the   embryo   grows   [11].   For   this   reason   both   the   primitive   streak   plus   the   adjacent   epiblast,   together   with   tail   bud   can   be   called  “posterior  growth  zone”.  This  region  comprises  the  border  region  between  the  node   and  anterior  primitive  streak  and  the  epiblast  adjacent  to  the  streak  [1,12,13].  Cell  lineage   tracing  studies  revealed  the  relative  positions  of  the  different  progenitor  populations,  and   they  indicate  a  temporal  order  of  cell  emergence  that  corresponds  to  the  building  of  the  AP   axis   [7].   More   recently   clonal   analysis   showed   that   the   stem   cell-­‐like   precursors   are   neuromesodermal   progenitors   which   persist   after   the   segregation   of   endodermal   and  

(15)

surface  ectoderm  layers  [14],  suggesting  that  neurectoderm  and  mesoderm  are  more  closely   related  than  mesoderm  and  endoderm.    

As  mentioned  above  some  of  these  progenitors  of  the  posterior  growth  zone  have   stem  cell  characteristics.  Therefore  an  equilibrium  between  the  generation  of  differentiated   axial   tissues   and   the   maintenance   of   a   posterior   progenitors   is   required   [1].   The   genetic   control   of   the   process   of   axial   elongation   and   maintenance   of   the   posterior   growth   zone   involves   a   series   of   highly   conserved   genes   and   signalling   pathways.   Among   the   known   signalling  pathways  involved  are  Wnt,  Retinoic  acid  (RA)  and  Fgf  [1,2,15,16]  and  among  the   transcription  factor-­‐encoding  genes  are  Cdx  [3,17]  and  T  brachyury  [2,3,17,18].    

 

Wnt  signalling  

Wnt  signalling  is  essential  during  vertebrate  development  and  is  associated  with  the   regulation  of  many  processes.  Wnt  is  the  ligand  that  activates  the  canonical  pathway  and  the   other  main  components  are  the  transmembrane  receptor  Frizzled  (Fz),  and  the  downstream   effectors  of  the  pathway,  Dishevelled  (Dsh),  β-­‐catenin  and  T  cell  factor/Lymphoid  enhancer-­‐ binding   factor   1   (Tcf/Lef1)   [19].   During   early   development   the   Wnt   pathway   controls   cell   proliferation,   stem   cell   maintenance,   cell   fate   decisions,   organized   cell   movements   and   establishment  of  tissue  polarity  [20].  Wnt3  and  Wnt3a  have  been  shown  to  be  essential  for   axis   formation   and   elongation   of   vertebrate   embryos,   respectively.   Wnt3a   is   expressed   in   the   presumptive   mesoderm   in   the   posterior   region   of   the   developing   embryo   [5].   Null   mutants   for   Wnt3a   have   a   severe   axial   truncation,   a   disrupted   notochord   and   a   deficient   tailbud  [21].  Galceran  et  al.  showed  that  Wnt3a  acts  trough  Lef1/Tcf1  since  Lef1-­‐/-­‐Tcf1-­‐/-­‐  mice  

have   a   phenotype   similar   to   that   of   Wnt3a-­‐/-­‐   mice   [22].   Wnt3a   is   also   involved   in   the  

regulation  of  somitogenesis  acting  on  the  presomitic  mesoderm  (PSM)  [23].  Wnt3-­‐/-­‐  mice  do  

not  develop  a  primitive  streak  and  therefore  lack  mesoderm  and  node  [24],  and  thus  Wnt3  is   required  in  a  much  earlier  developmental  stage  compared  to  Wnt3a.  

 

Retinoic  acid  signalling  

Retinoic  acid  (RA)  signalling  is  involved  in  a  range  of  developmental  processes,  for   example  the  control  of  progenitor  cell  populations,  including  the  axial  precursors  [25].  RA  is   a  vitamin  A-­‐derived  compound  and  its  biological  action  is  restricted  by  the  localization  of  its   synthesis   regulated   by   retinol   and   alcohol   dehydrogenase   (RDHs   and   ADHs)   and  

(16)

General Introduction

 

3  

retinaldehyde   dehydrogenases   (RALDHs)   and   the   presence   of   enzymes   that   degrade   it,   cytochrome  P450s  (CYP26s)  [25].    

Raldh2-­‐/-­‐  embryos  die  during  development  from  defective  heart  morphogenesis  and  

have  severe  developmental  defects  like  body  axis  truncation  [26].  Cyp26a-­‐/-­‐  mutant  embryos  

show   several   defects   among   which   a   truncation   of   the   posterior   body   region,   posterior   transformations  of  cervical  vertebrae  and  abnormal  hindbrain  patterning  [27,28].  

 

FGF  signalling

 

Fibroblast   growth   factors   (FGFs)   are   a   family   of   ligands   that   bind   tyrosine   kinase   receptors,  the  FGF  receptors  (FGFRs).  FGF  ligands  bind  the  extracellular  domain  of  the  FGFRs   to   form   a   complex   leading   to   the   transphosphorylation   of   specific   intracellular   tyrosine   residues  [29].  

Fgf  signalling  is  required  for  ingression  of  epiblast  cells  through  the  primitive  streak   [30,31].   During   axial   elongation   Fgf8   is   expressed   in   the   primitive   streak   and   posterior   mesoderm  [1,4,32-­‐34].  A  caudal-­‐to-­‐rostral  gradient  of  Fgf8  is  formed  from  the  node  region   where  low  Fgf8  levels  allow  mesoderm  to  differentiate  and  high  concentrations  maintain  the   stemness  of  the  progenitors  in  the  posterior  growth  zone  [1,16].  Fgf  signalling  is  confined  to   the  posterior  region  of  the  embryo  as  a  result  of  the  antagonistic  interaction  with  RA.      

Cdx  genes  

The  vertebrate  Cdx  genes  (Cdx1,  Cdx2  and  Cdx4)  are  the  homologs  of  the  Drosophila  

caudal  (cad)  gene  [35]  ,  which  is  known  for  playing  a  role  in  patterning  the  AP  axis  of  the  

early  fly  embryo  and  acts  as  a  posterior  homeotic  gene  [36].  Both  Cdx  and  Hox  gene  families   arose   from   a   common   ancestor,   the   ProtoHox   cluster   thought   to   confer   anteroposterior   identity   to   axial   tissues   in   all   bilatarians   [6].   Given   their   common   origin,   high   similarities   between  these  two  families  exist.  The  three  Cdx  genes  are  initially  expressed  in  the  primitive   streak  at  the  late  primitive  streak  stage.  Slightly  later,  Cdx1  has  the  most  anterior  expression   boundary   whilst   the   expression   of   Cdx2   and   Cdx4   is   more   posteriorly   restricted.   This   situation  is  transient  and  at  E9.0  all  three  Cdx  genes  are  expressed  in  the  posterior  growth   zone.    

Expression  of  Cdx1  is  initiated  at  E7.2  in  the  ectodermal  and  mesodermal  cells  of  the   primitive   streak   [37].   Cdx1-­‐/-­‐   mutant   mice   have   anterior   homeotic   transformations   of   the  

(17)

cervical  region  accompanied  by  a  caudal  shift  in  the  expression  domain  of  Hox  genes  [38].   This  shows  the  role  of  Cdx  genes  in  regulating  Hox  genes  expression.  

In  addition  to  its  expression  in  the  primitive  streak,  Cdx2  is  already  expressed  at  E3.5   in   the   trophectoderm.   At   the   blastocyst   stage   Cdx2   has   an   essential   function   in   assuring   segregation   of   the   inner   cell   mass   (ICM)   and   trophectoderm   and   is   necessary   for   the   implantation  into  the  uterus  wall  at  E4.5  [39-­‐42].  At  E7.2  expression  of  Cdx2  is  detected  in   the   embryo   in   the   posterior   primitive   streak,   in   the   allantois   and   the   chorion.   The   gene   remains   expressed   at   later   stages   in   the   posterior   neural   tube   and   presomitic   mesoderm.   The   lethality   of   Cdx2-­‐/-­‐   mutants   at   E3.5   can   be   bypassed   by   tetraploid   rescue,   and   the  

resulting  embryos  eventually  die  at  E10.5  because  of  defects  in  the  allantois  [40].  In  addition,   the  absence  of  the  allantois  leads  to  agenesis  of  the  placental  labyrinth.  Around  E10.5  the   mouse   embryo   becomes   dependent   on   the   correct   formation   of   the   placental   labyrinth,   which   will   allow   exchanges   of   nutrients   and   gases   between   the   mother   and   the   embryo.  

Cdx2  mutants  obtained  by  tetraploid  rescue  are  severely  truncated  in  all  three  germ  layers  

posteriorly  to  the  forelimb  bud,  and  they  form  a  maximum  of  17  somites  [40].  Heterozygous   mutants   for   Cdx2   get   born   but   they   have   a   subtle   shorter   axis   and   occasionally   exhibit   a   short  and  kinky  tail  and  skeletal  analysis  showed  anterior  homeotic  transformations  of  some   of   the   cervical   and   thoracic   vertebrae   [41].   Although   Cdx2   is   not   expressed   in   the   somitic   mesoderm  at  cervical  levels,  Cdx2  mutations  do  alter  egene  expression  and  the  identity  of   vertebrae  at  this  cervical  levels  which  implies  that  the  interactions  of  Cdx  as  Hox  regulators   occur   early   in   the   presomitic   mesoderm   [43].   The   phenotypes   of   Cdx1   and   Cdx2   loss   of   function  mutants  may  result  from  the  fact  that  Cdx  proteins  are  positive  regulators  of  the  

Hox  genes  in  embryonic  tissues  [44].  Although  the  possibility  that  Cdx  genes  play  a  role  on  

their  own  in  the  processes  of  axial  extension  and  patterning  should  also  be  consider.    

Cdx4  located  on  the  Y  chromosome,  is  first  expressed  at  E7.2  in  the  allantoic  bud  and  

in  the  posterior  primitive  streak.  Cdx4  remains  expressed  in  the  neuroectoderm,  presomitic   and   lateral   plate   mesoderm   in   the   posterior   embryo,   and   in   the   hindgut   endoderm   until   around   E10.5   [45,46].   Hemizygous   mutants   for   Cdx4   have   a   very   mild   axial   defect,   an   anterior  transformation  of  vertebra  15,  with  very  low  penetrance  [4].    

The  Cdx  mutant  phenotypes  discussed  so  far  show  that  Cdx  genes  have  a  crucial  role   in   patterning   the   anteroposterior   axis   (together   with   Hox   genes)   and   in   supporting   the   process   of   axial   elongation   of   the   mouse.   Besides   the   failure   of   Cdx2   null   mutants   in   generating  a  functional  allantois,  the  role  of  Cdx  genes  in  extraembryonic  tissues  was  shown   in   the   compound   mutant   Cdx2+/-­‐/Cdx4-­‐/-­‐  (Cdx2/4).   These   embryos   also   have   an   axial  

(18)

General Introduction

 

5  

truncation  at  the  sacral  level  and  only  15%  survive  until  birth.  The  embryonic  lethality  is  due   to  defects  in  placental  development,  in  some  cases  a  failure  of  chorio-­‐allantoic  fusion  ,  and   most  often  deficiencies  in  extension  and  branching  of  the  allantoic  vascular  network  into  the   chorionic  ectoderm  [4].  

Cdx  null  mutants  and  the  genetic  control  of  axial  extension  

Cdx  triple  null  mutants  were  generated  with  mice  carrying  null  alleles  for  Cdx1,  Cdx4  

and  conditional  alleles  for  Cdx2  [47].  These  mutants  present  the  most  severe  axial  truncation   of  all  the  Cdx  mutants  described:  only  5  somites  are  generated.  The  posterior  growth  zone  of  

Cdx   null   embryos   severely   lost   its   activity   of   generating   nascent   mesoderm   and  

neuroectoderm.  The  complete  absence  of  Cdx  alleles  in  these  mutants  permits  a  more  clear   study  of  the  genetic  pathways  associated  with  Cdx  and  axial  elongation.  The  expression  of  

Wnt3a   is   downregulated   in   these   mutants,   reinforcing   that   the   Wnt   pathway   acts  

downstream  of  Cdx  genes.  Hox  gene  expression  was  also  affected,  Hox  anterior  genes  are   well   induced   but   posterior   Hox   genes   show   no   expression   in   these   mutants.   Cdx   genes   regulate  the  gene  encoding  the  enzyme  that  degrades  RA,  Cyp26a1  directly  and  positively   [2,48].   Cyp26a1   is   absent   from   the   posterior   region   of   Cdx   null   mutants   resulting   in   the   deficiency  of  RA  clearance.  The  persistence  of  RA  in  the  posterior  region  is  further  accounted   for   the   high   level   of   Raldh2   expression   in   this   region   of   the   Cdx   null   mutants.   Due   to   the  

higher  levels  of  RA  in  the  posterior  region  of  Cdx  null  embryos,  Fgf8  expression  is  completely   absent   in   these   mutants.   Interestingly,   re-­‐induction   of   Fgf   signalling   was   able   to   partially  

Figure  1    -­‐  Genetic  interactions  involved  in  the  maintenance  of  the  posterior  growth  zone  in  Wild-­‐type  and   Cdx   null   embryos.   Left:   Schematic   dorsal   view   of   E8.5   wild-­‐type   and   Cdx   null   embryos.   Right:   Schematic  

representation   of   the   signalling   cascades   downstream   of   Cdx   in   the   growth   zone   of   wild-­‐type   and   Cdx   null   embryos.  Not  the  absence  of  Fgf8  in  the  Cdx  null  mutants  that  lead  to  failure  of  RA  clearance  from  the  posterior   region  of  the  embryo.  Orange  represents  the  expression  domain  of  Fgf8  and  in  blue  the  presence  of  RA.  From:   Van  Rooijen  et  al.,  2012  

(19)

rescue   the   Cdx2   mutant   truncation   [47].   The   rescued   embryos   regain   the   expression   of  

Cyp26a1   also   absent   in   Cdx2   null   mutants.   The   generation   of   embryos   totally   deprived   of  

Cdx   activity   allowed   a   better   understanding   of   the   mechanisms   and   genetic   interaction   involved  in  axial  extension.  The  model  in  figure  1  was  proposed.  

(20)

 

7  

Aim  of  this  thesis  

 

 This  work  will  focus  on  the  role  of  Cdx  genes  and  the  interaction  with  other  factors   in   the   regulation   of   the   posterior   growth   zone   in   the   mouse   embryo.   This   thesis   has   two   aims;  the  first  is  to  study  the  interaction  of  Cdx2  and  canonical  Wnt  signalling  (Wnt3a)  and   the  second  is  to  test  the  role  of  Hoxb1  in  the  regulation  of  axis  extension  and  the  interaction   with  Cdx  genes.  The  results  of  these  two  projects  will  be  described  in  two  separate  chapters   in  this  thesis.  

The  project  described  in  Chapter  I  results  from  previous  observations  that  Wnt3a-­‐/-­‐  

Cdx2+/-­‐   mutant   embryos   were   not   recovered   at   E15.5.   The   aim   of   this   project   was   to  

investigate  the  origin  of  early  lethality  of  the  Wnt3a-­‐/-­‐Cdx2+/-­‐  mutant  embryos.  Neither  Cdx2  

heterozygote   mutants   nor   Wnt3a   null   mutants   are   arrested   in   their   development.   Cdx2   heterozygotes  only  present  some  alterations  in  vertebrate  patterning  and  a  mild  defect  in   the   posterior   embryonic   axis,   missing   a   few   caudal   vertebrae   [41].   Wnt3a   homozygous   mutants   have   a   severe   truncation   of   the   embryonic   axis   [5],     very   similar   to   the   posterior   body   truncations   of   Cdx2   mutants   [49].   Both   Wnt   signaling   and   Cdx/Hox   genes   have   important  roles  during  axis  elongation  and  Wnt  exerts  a  positive  feedback  loop  on  Cdx  that   maintains  Wnt  signalling  to  sustain  progenitor  self-­‐renewing  and  tissue  elongation  [2].  We   wanted  to  test  whether  the  loss  of  Wnt3a  in  Cdx2  heterozygotes  was  causing  early  lethality   of  the  compound  mutant  embryos  by  compromising  placental  development.  

Cdx  genes  are  key  regulators  of  the  process  of  axial  extension  as  they  regulate  the  

niche  of  the  axial  progenitors  in  the  posterior  growth  zone.  Previous  work  showed  that  trunk  

Hox   genes   collaborate   with   Cdx   genes   to   stimulate   posterior   axial   growth   while   posterior   Hox   genes   promote   growth   termination   by   interfering   with   Cdx/trunk   Hox   genes   [2].   The  

second  question  of  this  work  concerns  the  role  of  anterior  Hox  genes  in  the  process  of  axial   elongation   and   how   they   interact   with   Cdx   in   this   regulation;   this   work   is   described   in   Chapter  II.  In  this  project  we  propose  to  test  whether  Hoxb1,  like  Hoxb8  and  Hoxa5  [2],  is   able  to  rescue  the    Cdx2/4  mutant  phenotype.  

(21)
(22)

 

  9  

Chapter  I  -­‐  Involvement  of  the  canonical  Wnt  pathway  

downstream   of   Cdx   genes   in   the   formation   of   the  

placental  labyrinth  

Introduction  

Placental  labyrinth  development  

Mice   have   a   chorioallantoic   placenta,   which   means   that   it   is   formed   from   two   extraembryonic   components,   the   chorion   and   the   allantois.   The   allantois   is   first   visible   at   E7.0/E7.25  [50,51]  as  a  bud  of  extraembryonic  mesoderm  arising  from  the  posterior  part  of   the   primitive   streak   [10,52].   The   outer   cells   of   the   bud   will   differentiate   into   a   layer   of   mesothelium  that  surrounds  an  inner  core  of  extraembryonic  mesoderm  [53]  .  The  next  step   in  the  development  of  the  allantois  is  its  growth  into  the  exocoelomic  cavity  in  the  direction   of   the   chorion   [53].   The   allantois   vascularizes   intrinsically,   rather   than   by   angiogenesis.   It   arises   independently   from   the   vessel   network   of   the   yolk   sac   or   the   fetus   and   is   not   accompanied  by  erythropoiesis  [54].  The  allantoic  vasculature  is  formed  by  vasculogenesis,  a   process   characterized   by   the   differentiation   of   mesodermal   cells   into   endothelial   cell   precursors  or  angioblasts.  The  vascularization  starts  in  the  most  distal  cells  of  the  inner  core   of   the   allantois   which   start   to   flatten   and   then   coalesce   to   form   the   blood   vessels   [54].   Expression  of  Flk1,  a  tyrosine  kinase  receptor  for  vascular  endothelial  growth  factor  (VEGF)   and  a  marker  for  endothelial  cells,  follows  the  morphological  appearance  of  vascularization,   first  in  the  distal  part  of  the  allantois  and  later  at  the  proximal  part  [54].  The  first  signs  of   vascularization  occur  before  the  fusion  of  the  allantois  with  the  chorion.  

 

Cdx  genes  and  Wnt  signalling  pathway  in  placenta  formation  

The  role  of  Cdx  in  the  development  of  extraembryonic  tissues  was  mentioned  above.  

Cdx2   null   mutations   impair   the   generation   of   embryonic   and   extra-­‐embryonic   mesoderm  

and   Cdx2   null   allantois   does   not   fuse   with   the   chorion   [40].   This   reveals   the   early   Cdx   dependence   of   placental   ontogeny,   reflected   by   the   fact   that   one   active   Cdx2   allele   is   required  for  outgrowth  of  the  early  allantoic  bud.  In  Cdx2+/-­‐  and  Cdx2+/-­‐Cdx4+/-­‐  mutants  the  

allantois   reaches   a   normal   size.   Cdx   mutants   exhibit   subsequent   defects   that   compromise   the  ontogenesis  of  a  proficient  chorio-­‐allantoic  placenta,  with  a  penetrance  that  increases   with  the  decrease  in  Cdx  dosage  [4].  In  the  case  of  Cdx2/4  mutants,  the  majority  of  mutant  

(23)

allantoises  undergoes  chorio-­‐allantoic  fusion  but  exhibit  a  later  defect,  being  impaired  in  the   establishment   of   a   functional   endothelial   network   in   the   labyrinth.   The   allantoic   vessel   branching  fails  to  occur  in  the  placental  labyrinth,  preventing  the  necessary  proximity  of  the   embryonic  and  maternal  blood  [4].  The  role  of  Cdx  genes  in  placentogenesis  is  an  early  one   acting   on   the   progenitors   of   endothelial   cells   in   the   early   allantois   since   Cdx   genes   are   downregulated  in  the  allantois  at  E8.5.  

Wnt   signaling   is   also   involved   in   the   development   and   differentiation   of   the   placental   tissues   in   the   mouse   embryo   [55].   Several   studies   showed   that   Wnt   signaling   is   crucial   for   extraembryonic   development,   particularly   in   chorion-­‐allantois   fusion,   placental   vascularization  and  labyrinth  function.  Embryos  null  for  both  Tcf-­‐1  and  Lef-­‐1  display  severe   defects  in  placenta  formation  due  to  absence  of  chorionic-­‐allantois  fusion  [56].  Fzd5  knock-­‐ out  embryos  do  not  survive  beyond  E10.0  since  their  placentae  were  less  vascularized[57].     Labyrinths   of   Wnt2   null   embryos   exhibit   different   defects   such   as   edema   and   decreased   numbers   of   capillaries   [58].   Deletion   of   Wnt7b   results   in   embryonic   death   around   midgestation  due  to  placental  abnormalities  [59].    

 

 

Objective  

Previous  experiments  in  the  lab  showed  that  Wnt3a-­‐/-­‐  Cdx2+/-­‐  mutant  embryos  suffer  

early  lethality  during  development.  The  objective  of  this  project  is  to  investigate  the  cause  of   this  lethality,  by  analysing  mutant  embryos  at  earlier  stages.  Our  hypothesis  is  that,  similarly   to   Cdx   mutants,   the   early   lethality   resulted   from   impairment   of   the   allantoic   and/or  

placental  labyrinth  development.

 

 

 

 

 

 

(24)

 

  11  

Methods  

 

Mice  

All  mice  were  in  the  C57Bl6j/CBA  background.  Cdx2+/-­‐  mice  were  obtained  from  F.  

Beck  (Beck  et  al.,  1995)  and  Wnt3a  mice  from  S.Takada  (Takada  et  al.,  1994).  To  generate   the   mutants   Wnt3a-­‐/-­‐   Cdx2+/-­‐,   Wnt3a+/-­‐   females   were   crossed   with   Wnt3a+/-­‐Cdx2+/-­‐   males.  

Matings  were  timed  to  get  embryos  from  the  desired  stage.  The  day  of  the  vaginal  plug  was   designated  as  E0.5  at  noon.  

Isolation  embryos  and  processing  

Embryos  were  isolated  in  PBS0,  for  E8.5  the  allantois  was  kept  intact  and  for  E10.5   the   placenta   was   also   isolated.   Embryos   and   placentas   (E8.5,   E10.5)   were   fixed   in   paraformaldehyde  (PFA)  (4%)  at  4°C  overnight.  Tissue  was  washed  twice  (10  minutes  (min))   in  PBS0  with  Tween  (1%)  (PBT),  dehydrated  in  methanol  (10  min)  steps  of  25%,  50%,  75%   and  twice  100%)  and  stored  at  -­‐20°C.  

 

Genotyping  

For   genotyping   of   embryos   genomic   DNA   was   isolated   from   the   yolk   sac   and   amnion.  Tissue  was  lysed  overnight  by  a  lysis  solution  (100  mM  Tris  HCl  pH  8.5,  5  mM  EDTA,   0.2%  SDS,  200  mM  NaCl,  100  μg/mL  proteinase  K)  at  55°C,  precipitated  with  isopropanol  and   finally  dissolved  in  TE  buffer.  

Primer   sequences   for   genotyping   Cdx2   are   ATATTGCTGAAGAGCTTGGCGGC   (forward)   and   TAAAAGTCAACTGTGTTCGGATCC   (reverse).   Primer   sequences   for   Wnt3a   are   ACTACAACCCTCCTCACCTG   (forward)   and   TGGCTACCCGTGATATTGCT   (reverse).   The   PCR   reaction  conditions  are  94°C  for  5  min,  94°C  for  30  seconds  (sec),  61°C  for  1  min,  72°C  for  1   min  for  35  cycles,  72°C  for  5min  and  12°C  until  the  end  of  reaction.  In  10  μl  mixture  with  0.5   μM   of   each   primer,   0.2   mM   of   each   dNTP,1.5   mM   MgCl2   and   1x   PCR   buffer   (Promega   5x   Flexi  Green  GoTaq  Buffer)  

 

Histological  analysis  

Dehydrated  placentas  (in  100%  methanol  at  -­‐20°C)  were  put  in  paraffin  (30  min  at   60°C)  and  paraffin  was  refreshed  twice  (2  times  30  min  at  60°C).  Placentas  were  embedded  

(25)

in   paraffin   and   sections   were   cut   (6   μm)   using   a   microtome.   Sections   were   afterwards   stained  with  hematoxylin  and  eosin.  

 

In  situ  hybridization  

i. Probe  generation  

DNA  transformation  into  competent  cells  

1  μl  of  plasmid  with  Cdx4  cDNA  insert  was  added  into  25  μl  of  DH5α  competent  cells   and  incubated  for  10  min  on  ice.  Cells  were  heat  shocked  for  45  sec  at  42°C  and  after  that   placed   on   ice   for   2   min.   1ml   of   prewarmed   Lysogeny   Broth   (LB)   medium   was   added   and   incubated   at   37°C   for   one   hour.   100μl   of   the   transformation   mixture   was   spread   on   a   LB   agar  plate  (with  ampicillin).  The  plates  were  left  overnight  incubating  at  37°C.  Two  separate   colonies  were  picked  and  grown  over  night  in  100  ml  LB  medium  with  200  μl  ampicillin.  

DNA  isolation  form  DH5α  

Overnight   bacterial   cultures   were   pelleted   by   centrifuging   10   min   at   3200   rpm.   Plasmids   were   isolated   with   the   Invitrogen   PureLinkTM   Quick   Plasmid   Midiprep   Kit,   following   the   manufacturer’s   protocol.   After   the   isolation   the   concentration   of   DNA   was   determined  with  NanoDrop.  

Linearization  and  purification  

10   μg   of   DNA   was   linearised   using   restriction   enzymes   for   1   hour.   Linearised   DNA   plasmid   was   purified   by   a   phenol/chloroform   extraction   followed   by   precipitation   with   NaAC.  

Synthesis  of  digoxygenin-­‐labeled  (DIG-­‐labeled)  RNA  probe  

In   a   total   volume   of   20   μl,   the   following   reagents   were   mixed:   5x   Transcription   Buffer,   0.1   M   DTT,   DIG   RNA-­‐labelling   mixture,   placental   RNAse   inhibitor   and   RNA   polymerase  (T7)  together  with  1.5  μg  of  linearised  plasmid  DNA.  The  mixture  was  incubated   for  2  hours  at  37°C.  The  next  step  was  to  dilute  with  5x  transcription  buffer  followed  by  the   digestion   with   2   μl   DNAse   (RNAse   free)   for   45   min   at   37°C.   Next,   destilled   H20,   brewer’s   yeast   tRNA,   LiCl   and   100%   ethanol   (-­‐20°C)   was   added   to   the   mixture   and   incubated   overnight   at   -­‐20°C.   The   mixture   was   spinned   down   (15   min)   at   4°C,   washed   with   70%   ethanol  and  centrifuged  again.  Finally,  the  probes  were  dried  under  vacuum,  redissolved  in   TE/formamide  (1:1)  and  stored  at  -­‐80°C.  

 

(26)

Chapter I – Methods

 

 

13  

For  whole  mount  in  situ  hybridization  the  embryos  were  rehydrated  (75%,  50%,  25%   methanol,  2  times  PBT;  all  steps  for  10min)  and  permealized  with  10  μg/ml  proteinase  K  for   15  min.  Proteinase  K  was  blocked  by  glycine  (2  mg/ml  in  PBT)  for  5  min  and  was  followed  by   two   times   wash   (5   min)   with   PBT.   Embryos   are   refixed   in   0.2%   glutaraldehyde   in   4%   PFA,   followed   by   two   washes   (5   min)   with   PBT.   The   embryos   were   washed   with   300   μl   prehybridization  mix  (5  min)  and  subsequently  incubated  for  at  least  1  hour  at  70°C  in  400  μl   prehybridization  mix.  Hybridization  takes  place  over  night  at  70°C  with  prehybridization  mix   with  the  probes.  After  hybridization  embryos  are  washed  with  800  μl  prehybridization  mix   (10  min  at  70°C)  and  400  μl  2x  SSC  (70°C)  was  added  three  times  (10  min).  After  2  times  30   min  wash  with  CHAPS  (0.1%)/SSC  (2x),  the  tissue  was  incubated  at  37  °C  for  at  least  one  hour   with   100   μg/ml   RNAse-­‐A   in   CHAPS   (0.1%)/SSC   (2x).   Afterwards   the   samples   were   washed   twice  with  Maleic  acid  buffe  (MAB)  for  10  min  at  room  temperature  and  twice  for  30  min  at   70°C.  Subsequently  a  10  min  wash  with  PBT  and  two  washes  (10  min)  with  TBST  with  2mM   levamisole.   Embryos   were   preblocked   by   10%   heat   inactivated   sheep   serum   (endogenous   alkaline  phosphatase  activity  is  inactivated  beforehand  by  70°C  incubation  for  30  min)  for  2   hours.   Beforehand   a   anti-­‐DIG   alkaline   phosphatase   mixture   was   prepared   with   15   mg   embryo   powder   in   2,5   ml   TBST,   250   μl   10%   inactivated   sheep   serum   and   5   μl   of   anti-­‐DIG   conjugated   with   AP;   incubated   at   4°C   for   4   hours   while   shaking.   Blocking   serum   was   removed   and   anti-­‐DIG   mixture   was   added,   tissues   were   incubated   at   4°C   overnight   with   gently  shaking.  Post  antibody  washes  were  done  with  TBST  with  2mM  levamisole  (3  times  5   min  followed  by  5  times  60  min  wash).  Before  immunological  detection  with  1  ml  BM  Purple   (with  1mM  levamisole)  starts,  the  samples  must  be  washed  3  times  with  NTMT  (with  2  mM   levamisole).  To  stop  the  reaction  the  embryos  were  washed  twice  (10  min)  with  NTMT  (with   2  mM  levamisole)  and  10  min  with  PBT  including  10  mM  EDTA.  Embryos  were  postfixed  with   0.2%   glutaraldehyde   in   4%   PFA   and   finally   samples   were   washed   (30   min)   and   stored   in   PBT/EDTA.  Embryos  were  placed  in  filtered  PBT/EDTA  for  image  acquisition.  This  protocol  is  

(27)

Results  

In   order   to   study   the   relationship   between   Cdx   genes   and   Wnt   signalling   in   more   detail,  Wnt3a-­‐/-­‐  Cdx2+/-­‐,  embryos  were  generated  previously  to  this  work  by  crossing  Wnta3+/-­‐  

females   with   Wnt3a+/-­‐   Cdx2+/-­‐   males.   At   E15.5   these   genotypes   were   not   recovered   which  

indicated   early   lethality   during   development.   To   investigate   whether   placentation   was   defective   in   these   mice,   embryos   were   isolated   at   earlier   stages   of   development   and   the   phenotype  was  analysed.  

 Wnt3a

-­‐/-­‐

 Cdx2

+/-­‐  

embryos  have  defects  in  placental  labyrinth  similar  to  

Cdx2/4  mutants  

Embryos   were   isolated   at   two   different   embryonic   stages.   E8.5   embryos   were   generated  to  observe  whether  the  allantois  was  attached  or  not  to  the  chorion.  At  E10.5  the   umbilical  cord  and  placenta  have  normally  already  developed  and  it  is  possible  to  analyse   their  morphology.  

At   E8.5   Wnt3a-­‐/-­‐   and   Wnt3a-­‐/-­‐Cdx2+/-­‐   show   a   narrower   posterior   region   in   the  

embryo   compared   to   wild   type.   Only   a   few   Wnt3a-­‐/-­‐Cdx2+/-­‐   embryos   had   not   undergone  

chorio-­‐allantoic  fusion.  

At  E10.5  no  defects  in  the  morphology  of  the  umbilical  cord  or  aberrant  blood  was   observed.  Placentas  were  isolated  and  sectioned  to  analyse  the  phenotype  of  the  labyrinth.   Figure   1.1   shows   sections   of   these   placentas,   from   both   wild-­‐type   and   Wnt3a-­‐/-­‐Cdx2+/-­‐  

embryos.  Fig1.1A  and  1.1C  show  that  the  labyrinthine  area,  containing  the  embryonic  and   maternal   blood,   has   the   same   width   in   the   wild-­‐type   and   in   the   Wnt3a-­‐/-­‐Cdx2+/-­‐   mutants.  

However   the   embryonic   vessels   are   wider   in   the   mutants,   and   do   not   penetrate   the   chorionic  plate  efficiently  (Fig.1.1D).  The  embryonic  blood  seems  to  be  held  in  the  base  of   the   placenta   and   the   branching   of   the   vessels   is   underdeveloped   when   compared   to   the   wild-­‐type  (Fig.1.1B  and  D).  As  a  result,  the  embryonic  vessels  and  the  maternal  blood  are  not   in   direct   contact,   impairing   the   interchange   of   nutrients,   which   is   a   likely   cause   of   the   embryonic   lethality.   The   defects   in   the   placental   labyrinth   resemble   that   in   the   Cdx2/4   mutants,  although  it  is  less  severe.  

Cdx4  is  downregulated  in  Wnt3a

-­‐/-­‐

Cdx2

+/-­‐  

mutants  

To   investigate   whether   this   phenotype   is   reproducing   the   Cdx2/4   phenotype   we   analysed  whether  Cdx4  was  downregulated  in  these  embryos.  In  mutants  isolated  at  E8.5  in  

Imagem

Figure   1      -­‐   Genetic   interactions   involved   in   the   maintenance   of   the   posterior   growth   zone   in   Wild-­‐type   and    Cdx    null    embryos
Figure    1.2    –    Cdx4    is    downregulated    in    Wnt3a -­‐/-­‐ Cdx2 +/-­‐    E8.5    embryos
Figure    2        -­‐    Interaction    of    Wnt,    RA,    Cdx/trunk    Hox    genes    and    HoxPG13    in    the    regulation    of    axis    growth
Table   2.1   shows   the   number   of   observed   and   expected   newborns   per   genotype   for    lines    E,    G    and    F
+7

Referências

Documentos relacionados