• Nenhum resultado encontrado

UNIVERSIDADE FEDERAL DE PELOTAS Programa de Pós-Graduação em Biotecnologia

N/A
N/A
Protected

Academic year: 2021

Share "UNIVERSIDADE FEDERAL DE PELOTAS Programa de Pós-Graduação em Biotecnologia"

Copied!
93
0
0

Texto

(1)

UNIVERSIDADE FEDERAL DE PELOTAS

Programa de Pós-Graduação em Biotecnologia

Tese

GENÔMICA APLICADA À REPRODUÇÃO EQUINA

Priscila Marques Moura de Leon

Pelotas, 2011

(2)

PRISCILA MARQUES MOURA DE LEON

Genômica Aplicada à Reprodução Equina

Tese apresentada ao Programa de Pós-Graduação em Biotecnologia da Universidade Federal de Pelotas, como requisito parcial à obtenção do título de Doutor em Ciências (área do conhecimento: Biotecnologia).

Orientador: Tiago Collares

Co-orientador: João Carlos Deschamps

(3)

Dados de catalogação na fonte:

Maria Beatriz Vaghetti Vieira – CRB 10/1032 Biblioteca de Ciência & Tecnologia - UFPel

L579g Leon, Priscila Marques Moura de

Genômica aplicada à reprodução equina / Priscila Marques Moura de Leon. – 93f. : fig., tab. – Tese (Doutorado). Programa de Pós-Graduação em Biotecnologia. Universidade Federal de Pelotas. Centro de Desenvolvimento Tecnológico, 2011. – Orientador Tiago Collares; co-orientador João Carlos Deschamps.

1.Biotecnologia. 2.Reprodução equina. 3.Expressão gênica. 4.Polimorfismo genético. 5.DNA fetal livre. 6.Apoptose. 7.p53. 8.Sexagem molecular. I.Collares, Tiago. II.Deschamps, João Carlos. III.Título.

(4)

Banca examinadora:

Prof. Dr. Tiago Collares, Universidade Federal de Pelotas

Prof. PhD. João Carlos Deschamps, Universidade Federal de Pelotas Prof. Dra. Fabiana Kömmling Seixas, Universidade Federal de Pelotas Prof. Dra. Marta Gonçalves do Amaral, Universidade Federal de Pelotas

(5)

Aos meus pais, Vera e Ottoni, aos meus irmãos, Alexandre e Ottoni, ao meu marido, Leonardo, e ao meu afilhado, Arthur, com amor dedico este trabalho. “A vos, que tanto me enseñaste, el día que cantaste conmigo una canción” (Cacho Castaña)

(6)

AGRADECIMENTOS

Ao meu orientador, Tiago Collares, pela confiança em meu trabalho, amizade, incansável motivação e apoio dedicado à minha formação.

À Professora Fabiana Kömmling Seixas, pelos ensinamentos, amizade e pelo apoio fundamental em meu doutorado.

Ao meu co-orientador, João Carlos Deschamps, por seus ensinamentos e por fazer parte da minha formação profissional.

Ao colega Vinicius Campos, pelo apoio, amizade e ajuda na execução deste trabalho.

Às colegas, Helena Thurow e Fernanda Nedel, pelo apoio durante o curso de doutorado e desenvolvimento dos experimentos.

Aos colegas, Karine Begnini e Cristian Kaefer, pela colaboração nos experimentos.

Aos alunos de iniciação científica, Caroline Lucas, Cristina Haas e Fernando Pires Hartwig, pelo apoio na execução dos experimentos.

Aos colegas do Laboratório de Embriologia Molecular e Transgênese e do Laboratório de Genômica Funcional.

Aos colegas e professores do Programa de Pós-Graduação em Biotecnologia, em especial ao Prof. Odir Dellagostin e ao Prof. Fabio Leivas Leite.

Aos colegas Médicos Veterinários do Stud TNT, Pablo e Pico, pela ajuda prestada na execução deste trabalho.

A todos os demais que de alguma forma contribuíram com a execução deste trabalho.

(7)

“Quem baila essa chacarera Não pode "froxá o garrão" Hay que firma o puchero Batendo o legüero do coração”

(8)

RESUMO

LEON, Priscila Marques Moura de. Genômica aplicada à reprodução equina. 2011. 93f. Tese (Doutorado) - Programa de Pós-Graduação em Biotecnologia. Universidade Federal de Pelotas, Pelotas.

Em equinos, as intersecções entre a reprodução e a genômica são numerosas, no entanto, pouco se sabe sobre os fatores genéticos que atuam na fertilidade. Com o genoma equino completo, existe a possibilidade de análises moleculares e estudo de genes candidatos a biomarcadores para características reprodutivas específicas. Com base nestas informações, a presente tese teve como objetivo desenvolver estudos de genômica aplicada à reprodução equina. O primeiro artigo analisou a expressão de genes relacionados a apoptose (Bax, Bcl-2, survivin e p53) no complexo cumulus oócito equino através de qRT-PCR, comparando a expressão gênica entre oócitos e células do cumulus com diferentes características morfológicas durante a maturação in vitro. Como resultados, foi observada maior expressão do survivin (P<0.05) e menor expressão de p53 (P<0.01) em oócitos comparado a células do cumulus do grupo considerado morfologicamente saudável. Enquanto que a expressão de Bax foi maior (P<0.02) em células do cumulus do grupo saudável comparado ao grupo com características morfológicas não desejáveis. O segundo artigo analisou um polimorfismo de nucleotídeo único (SNP) no gene p53, relacionando-o a parâmetros reprodutivos de éguas Puro Sangue Inglês. Foi relatado pela primeira vez um SNP Arginina/Prolina na região do exon 4 do gene p53 equino. A prevalência foi de 73,3% para o genótipo heterozigoto, 17,1% do genótipo Arginina/Arginina e 9,6% do Prolina/Prolina. O genótipo Arginina/Prolina foi associado (P=0.02) a ocorrência de aborto, enquanto que o genótipo Prolina/Prolina foi associado (P<0.05) a menor probabilidade de aborto, indicando um papel da p53 na reprodução equina. O terceiro artigo determinou a presença de DNA fetal livre e circulante (ccffDNA) no plasma de éguas prenhas, desenvolvendo um teste molecular de diagnóstico pré-natal na determinação do sexo fetal através da amplificação do gene SRY pelas técnicas de PCR, de re-amplificação por PCR (2º-PCR) e de PCR quantitativo em tempo real (qPCR). Este é o primeiro relato do DNA fetal livre e circulante em equinos. O teste de sexagem molecular resultou em 72% de sensibilidade e 85% de acurácia na técnica de PCR. Com o 2º-PCR e qPCR

(9)

a sensibilidade foi de 90,9% e 95% de acurácia. Este estudo demonstra pela primeira vez a determinação do sexo fetal em éguas utilizando o ccffDNA. Os resultados apresentados colaboram para o entendimento da biologia reprodutiva da espécie equina, e indicam marcadores genéticos em potencial para parâmetros de fertilidade. Esta tese resultou na publicação de três artigos em periódicos internacionais da área de Reprodução e um pedido de Patente de Invenção.

Palavras-chave: Reprodução equina. Expressão Gênica. Polimorfismo Genético. Diagnóstico Molecular. Apoptose. p53. DNA fetal livre.

(10)

ABSTRACT

LEON, Priscila Marques Moura de. Genômica aplicada à reprodução equina. 2011. 93f. Tese (Doutorado) - Programa de Pós-Graduação em Biotecnologia. Universidade Federal de Pelotas, Pelotas.

In equine, the intersections between reproduction and genomics are numerous, however, little known about the genetic factors that acting on fertility. The conclusion of equine genome sequencing project, brings the oportunity to evaluate candidate genes and molecular biomarkers for specific reproductive characteristics. Based on this information, this PhD thesis aimed to develop genomic studies applied to equine reproduction. The first paper analyzed the expression of apoptotic-related genes (Bax, Bcl-2, survivin and p53) in equine cumulus-oocyte complex by qRT-PCR, comparing gene expression between morphologically distinct oocytes and cumulus cells during in vitro maturation. Results showed that survivin mRNA levels were higher (P<0.05) and p53 mRNA levels was lower (P<0.01) in oocytes compared to cumulus cells in morphologically healthy. On the other hand, expression of the Bax was significantly higher in morphologically healthy cumulus cells (P<0.02). The second paper analyzed a single nucleotide polymorphism (SNP) in the p53 gene, looking for associations with reproductive parameters in Thoroughbred mares. This is the first study demonstrating the Arginine/Proline SNP in equine exon 4 p53 gene. The heterozygous Arginine/Proline was found in 73.3% of Thoroughbreds compared to the homozygous Arg/Arg and Pro/Pro that was detected in 17.1% and 9.6% of mares, respectively. The Arginine/Proline genotype was significantly associated with abortion (P=0.02), while Proline/Proline mares had a lower probability of abortion (P<0.05). These results indicate that p53 may play a role in equine reproduction. The third article has determined the presence of circulating cell-free fetal DNA (ccffDNA) in pregnant mare’s plasma, looking to develop a molecular test for the prenatal diagnosis of fetal sex determination using SRY gene amplification by PCR, re-amplification by PCR (2nd-PCR) and real-time quantitative PCR (qPCR). This is the first report of ccffDNA in equine species. The molecular sexing test resulted in sensitivity of 72% and accuracy of 85% on the PCR. Using the 2nd-PCR and qPCR we obtained an increasing in the sexing sensitivity results (90.9%) and an accuracy

(11)

of 95%. This study demonstrates for the first time the fetal sex determination in mares using ccffDNA. This PhD thesis resulted in the publication of three papers in international journals of reproduction and a patent application request. The results presented here collaborate to understand the equine reproductive biology, and indicate potential genetic markers to fertility parameters.

Keywords: Equine Reproduction. Gene Expression. Genetic Polymorphism. Molecular Diagnostics. Apoptosis. p53. ccffDNA.

(12)

LISTA DE ABREVIATURAS E SIGLAS

ACTB - Actin Beta

AMELX - Amelogenin X-Linked AMELY - Amelogenin Y-Linked Bax - BCL2-Associated X Protein BcL-2 - B-Cell CLL/Lymphoma 2

ccffDNA - DNA fetal livre circulante (circulating cell-free fetal DNA) CCO - Complexo Cumulus-oócito

CRISP3 - Cysteine-Rich Secretory Protein 3 eLH - Equine Luteinizing Hormone

FIV - Fertilização In Vitro

GAPDH - Glyceraldehyde 3-Phosphate Dehydrogenase G6PDH - Glucose-6-Phosphate Dehydrogenase

HYPP - Paralisia Periódica Hipercalêmica (Hyperkalemic periodic paralysis) HSP70 - Heat Shock 70kDa Protein

HSPA1A - Heat Shock 70kDa Protein 1A

ICSI - Injeção intracitoplasmática de espermatozóides IL-1 - Interleucina 1

IL-1ß - Interleucina 1 Beta INHBA - Inhibin Beta A

LIF - Fator Inibitório de Leucemia

Mcl-1 - Myeloid Cell Leukemia Sequence 1 MIV - Maturação In Vitro

pb - pares de base

PCR - Reação em Cadeia da Polimerase PIV - Produção In Vitro de Embriões

qRT-PCR - Reação em Cadeia da Polimerase Quantitativa em Tempo Real RPL32 - Ribosomal Protein L32

SCID - Imunodeficiência Combinada Grave (Severe combined immunodeficiency disease)

SNP - Polimorfismos de Nucleotídeo Único SPATA1 - Spermatogenesis Associated 1

(13)

SRY - Sex Determining Region Y UBC - Ubiquitin C

ZFY - Zinc Finger Protein Y-Linked ZFX - Zinc Finger Protein X-Linked

(14)

SUMÁRIO

RESUMO... 7

ABSTRACT ... 9

LISTA DE ABREVIATURAS E SIGLAS ... 11

1. INTRODUÇÃO GERAL ... 14

1.1 Reprodução Equina ... 14

1.2 Genômica na Reprodução Equina ... 15

1.3 Expressão Gênica na Reprodução Equina ... 17

1.4 Polimorfismos Genéticos na Reprodução de Equinos ... 20

1.5 Aplicação de Diagnóstico Molecular em Equinos ... 22

2. ARTIGO I ... 24

EXPRESSION OF APOPTOTIC GENES IN IMMATURE AND IN VITRO MATURED EQUINE OOCYTES AND CUMULUS CELLS ... 25

Summary ... 26

1. Introduction ... 27

2. Materials and methods... 29

3. Results ... 32

4. Discussion ... 33

5. References ... 38

3. ARTIGO II ... 46

ASSOCIATION BETWEEN SINGLE NUCLEOTIDE POLYMORPHISMS IN P53 AND ABORTION IN THOROUGHBRED MARES ... 47

Abstract... 48

Short Communication ... 49

References ... 52

4. ARTIGO III ... 56

EQUINE FETAL SEX DETERMINATION USING CIRCULATING CELL-FREE FETAL DNA (CCFFDNA) ... 57

Abstract... 58

1. Introduction ... 59

2. Materials and Methods... 61

3. Results and Discussion ... 65

5. References ... 68

5. PATENTE DE INVENSÃO ... 56

Anexo de Inventores ... 74

Resumo da Patente de Invenção ... 75

6. CONCLUSÕES ... 73

7. REFERÊNCIAS ... 73

(15)

1. INTRODUÇÃO GERAL

1.1 Reprodução Equina

A criação de equinos tem uma elevada importância comercial, sendo o Brasil um dos países que se destacam neste nicho econômico, principalmente devido a crescente popularidade de esportes equestres. Segundo o Ministério da Agricultura, no ano de 2010 o Brasil possuía o maior rebanho de equinos na América Latina, sendo o terceiro rebanho mundial, com oito milhões de animais. O Complexo do Agronegócio Cavalo movimenta R$ 7,3 bilhões somente com a produção de cavalos, e ainda gera 3,2 milhões de empregos diretos e indiretos.

Diferentemente de outras espécies domésticas de interesse zootécnico, os equinos são valorizados como indivíduo, onde animais de alto padrão genético atingem valores elevados de comércio e reprodução. Éguas e garanhões são selecionados para a reprodução de acordo ao seu desempenho esportivo, morfologia e pedigree, e não de acordo a fertilidade. Portanto, fatores fisiológicos e de capacidade reprodutiva muitas vezes são selecionados negativamente, o que leva a menores índices reprodutivos e possíveis fracassos em levar uma gestação a termo.

O aumento do rebanho equino e a demanda de animais de alta performance precisa ser amparado por programas de melhoramento genético, sendo assim, o uso de biotecnologias aplicadas à reprodução assistida possibilita tal incremento. Apesar do progresso obtido na última década no sistema de produção in vitro de embriões (PIV) equinos, seus gametas e embriões apresentam características espécie-específicas que precisam ser elucidadas.

(16)

Novos conhecimentos sobre a competência de desenvolvimento, a maturação in vitro (MIV) e a criopreservação de oócitos e embriões é crítica para a PIV de equinos. As técnicas de reprodução assistida, como a Injeção intracitoplasmática de espermatozóides (ICSI), têm sido realizadas com sucesso, no entanto, a baixa eficiência tem limitado a sua aplicação comercial para esta espécie (SQUIRES et al., 2003; CHOI et al., 2006; HINRICHS et al., 2007). Este fato é contraditório, uma vez que o cavalo é uma espécie em que o indivíduo é suficientemente valorizado para justificar o uso de biotécnicas que aprimorem sua criação.

O progresso na área de biotécnicas reprodutivas foi inicialmente lento, pois a fertilização in vitro (FIV) convencional não é reproduzível em equinos (HINRICHS, 2010). No entanto, ICSI resultou no nascimento de muitos potros (GALLI et al., 2007; JACOBSON et al., 2010; MORTENSEN et al., 2010). Apesar disso, a qualidade dos oócitos e as condições de cultivo in vitro são altamente variáveis, refletindo em baixos níveis de formação de blastocisto in vitro e baixa reprodutibilidade dos resultados entre laboratórios (DELL'AQUILA et al., 2003; SMITS et al., 2009).

Com a disponibilidade do genoma equino (WADE et al., 2009), abre a possibilidade de análises moleculares e estudo de genes candidatos a biomarcadores para características reprodutivas específicas. Em vista desta abordagem, maiores conhecimentos sobre a biologia reprodutiva e eventos moleculares, envolvidos no desenvolvimento e viabilidade de gametas e embriões, necessitam ser elucidados. Assim como, a realização de estudos na área de genômica e elaboração de técnicas de diagnósticos moleculares que aprimorem a criação e a eficiência reprodutiva de equinos.

1.2 Genômica na Reprodução Equina

A reprodução é um dos principais aspectos da criação de equinos. Fatores de fertilidade em éguas e garanhões são características de suma importância, pois geram uma série de despesas ao criador. Estudos foram realizados buscando correlação entre fatores ambientais, comportamentias e fisiológicos com a fertilidade

(17)

de equinos. No entanto, pouco se sabe sobre os fatores genéticos que atuam na fertilidade (CHOWDHARY et al., 2008). Atualmente, os estudos relacionados à genômica aplicada à reprodução equina têm focado na fertilidade de garanhões (HAMANN et al., 2007; GIESECKE et al., 2010; NOVACK et al., 2010) e pouco se sabe sobre a genômica na fertilidade de éguas.

O Projeto do Genoma Equino (The Horse Genome Project) foi iniciado em 1995, onde os cromossomos seriam identificados, e em cada um deles seriam determinados marcadores genéticos, para que pontos de referência podessem ser estabelecidos, assim permitindo a comparação entre os genomas equino e humano. Neste projeto foram sequenciados 20.322 genes codificadores de proteínas, que correspondem a apenas 2% do DNA dos cromossomos. Além disso, o projeto mostrou que o equino serviria de modelo biológico para humanos em pelo menos 90 heredietariedades, incluindo infertilidade, doenças inflamatórias e desordens musculares (WADE et al., 2009).

O genoma nuclear do cavalo é compactado em 32 pares de cromossomos (2n = 64), dos quais 31 pares são autossomos e dois são cromossomos sexuais (XX nas fêmeas e XY nos machos) (CHOWDHARY et al., 2008). Estima-se que desde a fecundação até a maturação sexual, mais de 1.000 genes controlem o desenvolvimento dos órgãos sexuais masculinos e femininos, e ainda 1.000 genes adicionais controlam seu funcionamento na vida adulta. Portanto, mutações em alguns destes genes poderiam causar anormalidades no desenvolvimento sexual e alterações relacionadas à fertilidade (CHOWDHARY et al., 2008).

As intersecções entre a reprodução e genômica são numerosas. Ao selecionar reprodutores, além do objetivo de produzir prole com carcterísticas desejáveis, outros fatores genéticos podem contribuir para problemas reprodutivos (CHOWDHARY et al. 2008). A aplicação de técnicas de reprodução assistida poderá minimizar ou amplificar a propagação de alelos deletérios dentro de uma população, influenciando de forma positiva ou negativa a variabilidade genética (BROSNAHAN et al., 2010). Anormalidades cromossômicas podem afetar fertilidade (LEAR et al., 2008), e há evidências de que um alto grau de endogamia pode ter um efeito deletério na qualidade do sêmen (VAN ELDIK et al., 2006). Estudos moleculares

(18)

com os genes CRISP3, SPATA1 e INHBA têm sido realizados em associação com problemas de fertilidade em garanhões (GIESECKE et al., 2010).

O desenvolvimento de mapas genéticos de alta resolução é uma ferramenta valiosa para o isolamento de genes e marcadores associados com características economicamente importantes, como a reprodução (CHOWDHARY et al., 2008). A compreensão mais sofisticada de traços complexos e do impacto do genoma na aptidão individual, poderá auxiliar na seleção e melhoramento genético dos animais. Além, de permitir que pesquisadores desenvolvam testes específicos de diagnóstico e elaborem medidas preventivas de manejo e tratamento (BROSNAHAN et al., 2010).

1.3 Expressão Gênica na Reprodução Equina

A reação em cadeia da polimerase quantitativa em tempo real (qRT-PCR) é uma excelente ferramenta para investigações em mudanças no padrão de expressão gênica em gametas e no desenvolvimento embrionário inicial, uma vez que esta técnica pode ser executada com quantidade reduzidas de mRNA. O estudo da expressão gênica aplicado à embriologia é emergente. Genes envolvidos em processos biológicos, tais como apoptose, estresse oxidativo e criotolerância, precisam ser estudados, a fim de comparar a expressão gênica in vivo, in vitro e sob diferentes condições de cultivo (WRENZYCKI et al, 2005; BADR et al., 2007; RIZOS et al, 2008). O entendimento dos padrões de expressão gênica pode ser precioso para a identificação de causas de perda embrionária precoce, e no apoio ao desenvolvimento de tecnologias de reprodução assistida (PARIS et al., 2011). Tais estudos facilitam a identificação marcadores moleculares de viabilidade e competência celular.

Em oócitos equinos existe uma carência em estudos de expressão gênica. A atividade da proteína G6PDH foi estuda por Mohammadi-Sangcheshmeh et al. (2011), fornecendo evidências de que a atividade da G6PDH em oócitos imaturos de equinos possa ser um indicador da competência de desenvolvimento in vitro.

(19)

Anteriormente, Martoriati et al. (2002), analisaram a expressão da família de genes IL-1 em oócitos e células do cumulus de equinos, demonstrando um efeito inibitório da IL-1ß sobre o eLH indutor da retomada da meiose, sem reduzir a expansão das células do cumulus, indicando que o sistema IL-1 pode ter um papel crucial na fisiologia ovariana da égua.

Após a retomada da meiose e rompimento da vesícula germinativa, oócitos se tornam transcricionalmente inativos, e para a síntese proteica devem contar com as reservas de RNA acumuladas durante a fase de crescimento. Esta inatividade transcricional e dependência do armazenamento de RNA materno persistem até após a fertilização. Enquanto que, células do cumulus são transcricionalmente ativas (PAYTON et al., 2010). Em estudo com complexo cumulus-oócito (CCO) bovino, foi observado que as células do cumulus ao redor dos oócitos apresentam uma quantidade significativamente maior de RNA total em relação aos respectivos oócitos. Além disso, o RNA de oócitos possui maior abundância de fragmentos pequenos de RNA (200-1500 nucleotídeos) (PAYTON et al., 2006). Estas características foram comparadas entre seis espécies de mamíferos (bovinos, ovinos, suínos, caninos, felinos e murinos), sendo observada similaridade quanto a expressão destes CCOs (PAYTON et al., 2010).

No equino, o genoma embrionário se torna transcricionalmente ativo em aproximadamente 72 h após a fertilização, ou seja, no estágio de 4-8 células (PARIS et al., 2011). Apesar disso, os estudos envolvendo expressão gênica de embriões equinos são escassos. Provavelmente, um obstáculo para a execução destes estudos é o baixo número de embriões obtidos em coletas in vivo, pois os protocolos de superovulação são muitas vezes ineficientes. Smits et al. (2009), estudaram genes de referência para qRT-PCR em blastocistos equinos, concluindo que os genes ACTB, UBC, RPL32 e GAPDH são recomendados como normalizadores no estudo da expressão gênica. Mortensen et al. (2010), estudaram a expressão gênica de HSP70 em blastocistos equinos após a exposição dos oócitos a altas temperaturas in vitro e in vivo; obtendo que embriões produzidos in vitro apresentaram maiores níveis de mRNA de HSPA1A, sugerindo que esta alteração no padrão de expressão gênica seja em resposta à agressão ambiental sofrida in vitro.

(20)

A apoptose é um dos principais fatores que afetam o potencial de desenvolvimento embrionário (PARK et al, 2006; DHALI et al, 2007; ANGUITA et al, 2009). A apoptose, ou morte celular programada, que é um processo ativo e irreversível da auto-destruição celular sob controle fisiológico (PAROLIN & REASON, 2001). Os mecanismos de apoptose podem ser ativados por estímulos externos, através da ligação aos receptores específicos na superfície da célula, ou por estímulos internos de stress intracelular, tais como danos ao DNA, alterações do ciclo celular e em vias metabólicas, sendo as duas vias controladas por várias famílias de genes (CHANG et al., 2002). O estudo da apoptose em embriões bovinos produzidos in vitro demonstrou que os genes Bax, caspase-3 e Mcl-1 podem ser usados como potenciais marcadores da qualidade embrionária (MELKA et al. 2010).

Estudos sobre a expressão gênica de células cumulus (MCKENZIE et al., 2004) e apoptose (CORN et al., 2005) mostraram que o padrão de expressão das células cumulus pode refletir o potencial de desenvolvimento de embriões humanos durante o cultivo in vitro. A incidência de apoptose em folículos ovarianos de éguas foi demonstrada por Dell”Aquila et al. (2003), indicando relação com a expansão das células do cumulus e aumento da competência meiótica. No entanto, nenhuma associação com maturação citoplasmática foi observada (DELL'AQUILA et al., 2003). O impacto da apoptose em COC e seu impacto no potencial de desenvolvimento oocitário permanece obscuro. Assim como, há relatos contraditórios de várias espécies que não conseguiram esclarecer a ocorrência de apoptose no COC (YUAN et al., 2005). Em oócitos bovinos imaturos foi relatada uma ação benéfica da apoptose inicial no desenvolvimento embrionário após a fertilização, considerando os genes Bax e BcL-2 bons marcadores do processo inicial de apoptose (LI et al., 2009).

(21)

1.4 Polimorfismos Genéticos na Reprodução de Equinos

Modernas técnicas de Biologia Molecular vêm sendo utilizadas em estudos envolvendo a determinação da relação entre a ocorrência de variações no DNA com características fenotípicas, contribuindo para abordagens preventivas na medicina humana e animal. Em animais, o interesse consiste no aprimoramento e seleção genética criteriosos, especialmente na criação de equinos, onde cada animal é valorizado individualmente. O uso de ferramentas de biologia molecular auxilia a elucidação e eliminação de desordens genéticas, incrementando o padrão racial dos animais e os lucros do criador.

Nos últimos anos têm aumentado os estudos relatando polimorfismos de nucleotídeo único (SNP). Consequentemente, estudos de associação têm sido realizados para estabelecer relações entre SNP e doenças (CHOWDHARY et al., 2008). No sequenciamento do genoma equino foi encontrada uma taxa de polimorfismo estimada em 1 a cada 1.000 pares de base (pb) (WADE et al., 2009). E um total de 1.162.753 SNPs foram identificados entre seis raças de cavalos (Andaluz, Árabe, Akhal Teke, Puro Sangue Inglês, Standardbred Americano e Quarto de Milha) (WADE et al., 2009). Na raça Puro Sangue Inglês especificamente, foi encontrado uma taxa de polimorfismo menor, 1 SNP a cada 3.000 pb, os autores atribuem esta taxa à fechada e conservadora seleção genética (WADE et al., 2009). No Broad Institute – Horse Single Nucleotide Polimorphisms são registrados em sua base de dados 948.609 SNPs, que abrangem os cromossomos 1-31 e X.

Estudos relacionando SNP e fertilidade de garanhões foram realizados. Hamann et al. (2007), demonstraram que um polimorfismo no gene CRISP3 (G>A) tem um efeito significativo sobre a fertilidade de garanhões, pois garanhões heterozigotos apresentam uma fertilidade reduzida em relação aos homozigotos. O gene CRISP3 codifica para uma das principais proteínas do plasma seminal e se expressa principalmente na ampola do canal deferente. A proteína associada a espermatogênese SPATA 1 também foi estudada em relação a polimorfismos, um SNP intrônico (BIEC2-968854) foi associado a taxa de prenhes, ou seja, garanhões heterezigotos apresentaram uma taxa melhor de prenhes em relação aos

(22)

homozigotos para este SNP (GIESECKE et al., 2009). Giesecke et al. (2010) analisaram cinco SNPs intrônicos em garanhões que possuem efeito no sítio de ligação do fator de transcrição do gene INHBA, modificando o nível de expressão da inibina beta A, que participa da regulação do eixo hormonal hipotálamo-hipófise.

O TP53 é um dos genes mais estudados em oncologia humana, pois em vários tipos de tumores malignos têm sido encontradas mutações (OLIVIER et al., 2009). O gene TP53 é fundamental no processo de supressão tumoral, por estar envolvido na progressão do ciclo celular e apoptose, assim como na manutenção do DNA e da integridade genômica. Dentre as mutações comumente estudadas, encontra-se em destaque o SNP do códon 72/exon 4. Este polimorfismo resume-se a uma variação de um G para um C, resultando na síntese dos aminoácidos Arginina (CGC) ou Prolina (CCC). Estas duas variantes polimórficas tem demonstrado possuir além das diferenças estruturais, propriedades bioquímicas e biológicas diferentes (WANG et al., 1999; SZYMANOWSKA et al., 2006; LI et al., 2009). Este SNP no códon 72 da p53 foi relacionado com problemas de fertilidade e pré-natais em humanos (KANG et al., 2009). Alguns estudos encontraram uma relação entre os genótipos da p53 e a ocorrência de anormalidades reprodutivas (KAY et al., 2006; Chang, 2002) e endometriose (OMORI et al., 2004; AMMENDOLA et al., 2008). Além disso, a TP53 é um mediador potencial da gestação, com atividades relacionadas ao estrogênio e a progesterona (SIVARAMAN et al., 2001); e através da regulação da transcrição do fator inibitório de leucemia (LIF), citocina crucial na implantação embrionária (HU, 2009).

Estudos realizados em humanos são frequentemente extrapolados para animais, baseado no conhecimento e resultados obtidos no âmbito genômico sobre a influência dos SNP em problemas reprodutivos de mulheres, o gene da p53 torna-se um importante alvo de pesquisa na reprodução equina.

(23)

1.5 Aplicação de Diagnóstico Molecular em Equinos

O uso de ferramentas de biologia molecular auxilia na elucidação e na eliminação de desordens genéticas, incrementando o padrão racial dos animais e os lucros do criador. Além disso, o diagnóstico rápido de doenças infecciosas de equinos, na última década é baseado em técnicas moleculares de detecção dos agentes infecciosos (PUSTERLA et al., 2006). A Reação em cadeia da polimerase (PCR) é um diagnóstico molecular conhecido e implementado com sucesso atualmente.

Com o Projeto do Genoma Equino, foram criados testes moleculares para genes envolvidos na determinação da cor da pelagem (WADE et al., 2009). Tema este que é de grande interesse de criadores de equinos, por determinar o valor econômico dos animais de acordo a probabilidade de gerar prole com um determinado padrão de pelagem. Outros testes moleculares já disponíveis detectam doenças hereditárias, foram desenvolvidos testes para seis doenças genéticas graves, como a Paralisia periódica hipercalêmica (HYPP) que afeta cavalos Quarto de Milha e a imunodeficiência combinada grave (SCID) que afeta cavalos da raça Árabe (WADE et al., 2009).

Em humanos, o DNA fetal livre e circulante (ccffDNA) no plasma materno oferece uma fonte alternativa de material genético fetal para o diagnóstico não-invasivo pré-natal (FINNING & CHITTY, 2008). Durante a gestação de mulheres, em média de 10% do DNA livre no plasma materno é de origem fetal (LUN et al., 2008). As circulações materna e fetal são separadas pela membrana placentária, no entanto, os mecanismos possíveis do ccffDNA incluem a lise das células fetais resultantes de danos físicos, imunológicos e apoptose, transpondo a barreira placentária (LO et al., 1997). A determinação do sexo fetal a partir de análises moleculares do ccffDNA em mulheres tem sido realizada em laboratórios. O ccffDNA permite a determinação do sexo fetal a partir da amplificação e detecção de genes específicos do cromossomo Y (FINNING & CHITTY, 2008; AKOLEKAR et al., 2010).

A predeterminação do sexo fetal em espécies domésticas tem substanciais aplicações comercial e científica (PEIPPO et al., 1995). A sexagem fetal em equinos

(24)

é útil a criadores, pois permite a implementação de estratégias comerciais, em termos de decisão de venda e valor dos animais (BUCCA, 2005). A sexagem molecular em equinos foi descrita utilizando os genes SRY e AMELX/AMELY (HASEGAW et al., 2000), e usando um ZFX/ZFY (PEIPPO et al., 1995) em embriões pré-implantação.

O diagnóstico pré-natal não-invasivo em equinos a partir do sangue materno seria uma ferramenta de diagnóstico molecular, podendo ser aplicada a testes de doenças hereditárias e para identificação de biomarcadores, além da determinação do sexo fetal pré-natal.

Com base nas informações apresentadas, a presente tese teve o objetivo de desenvolver estudos de genômica aplicada à reprodução equina: I) no estudo da expressão de genes envolvidos no processo de apoptose; II) na análise de polimorfismos genéticos do gene p53; III) na elaboração de teste molecular de diagnóstico utilizando o DNA fetal livre em equinos. Os dados gerados nesta tese estão apresentados na forma de artigos científicos.

O primeiro artigo teve como objetivo analisar a expressão de genes relacionados ao processo de apoptose no complexo cumulus oócito equino. Os genes Bax, Bcl-2, survivin e p53 foram avaliados através de qRT-PCR durante a maturação in vitro de complexos cumulus oócito equinos, comparando expressão gênica entre oócitos e células do cumulus com diferentes características morfológicas. Este artigo foi publicado no periódico Zygote.

O segundo artigo teve como objetivo analisar um polimorfismo de nucleotídeo único no gene p53 equino, relacionando-o a parâmetros reprodutivos de éguas Puro Sangue Inglês. Este artigo foi submetido ao periódico The Veterinary Journal e encontra-se em revisão após correções propostas.

O terceiro artigo buscou determinar a presença de DNA fetal livre e circulante no plasma de éguas, desenvolvendo um teste molecular de diagnóstico pré-natal de sexagem fetal em equinos por amplificação do gene SRY. Este artigo foi publicado pelo periódico Theriogenology. Foi aberto um processo de pedido de Patente de Invenção sobre o processo de diagnóstico molecular de determinação do sexo fetal em equinos.

(25)

2. ARTIGO I

Expression of apoptotic genes in immature and in vitro matured equine oocytes and cumulus cells

(artigo publicado no periódico Zygote: page 1 of 7, 2011;

doi:10.1017/S0967199411000554; Date submitted: 05.05.11. Date accepted: 08.07.11)

(26)

Expression of apoptotic genes in immature and in vitro matured equine oocytes and cumulus cells

RUNNING HEADLINE: Gene expression in equine COC

P.M.M. Leon1,2, V.F. Campos1,2, C. Kaefer1,2, K.R. Begnini1,2, A.J.A. McBride3, O.A. Dellagostin3, F.K Seixas2, J.C. Deschamps1, T. Collares1,2,*

Laboratório de Embriologia Molecular e Transgênese, Biotecnologia/Centro de Desenvolvimento Tecnológico, Universidade Federal de Pelotas, Pelotas-RS, Brazil.

1

Laboratório de Embriologia Molecular e Transgênese, Biotecnologia/Centro de Desenvolvimento Tecnológico, Universidade Federal de Pelotas, Pelotas, RS, Brazil.

2Laboratório de Genômica Funcional, Biotecnologia/Centro de Desenvolvimento

Tecnológico, Universidade Federal de Pelotas, Pelotas, RS, Brazil.

3Laboratório de Biologia Molecular, Núcleo de Biotecnologia, Centro de

Desenvolvimento Tecnológico, Universidade Federal de Pelotas, Pelotas, RS, Brazil.

* All correspondence to: Dr. Tiago Collares, Núcleo de Biotecnologia, Centro de Desenvolvimento Tecnológico, Campus Universitário s/n°, Caixa Postal 354, CEP 96010-900, Pelotas, RS, Brazil, Phone: +55 53 3275 7588; Email: collares.t@gmail.com

(27)

Summary

The gene expression of Bax, Bcl-2, survivin and p53, following in vitro maturation of equine oocytes, was compared in morphologically distinct oocytes and cumulus cells. Cumulus-oocyte complexes (COC) were harvested and divided into two groups: G1 - morphologically healthy cells and G2 - less viable cells or cells with some degree of atresia. Total RNA was isolated from both immature and in vitro matured COC and real-time reverse transcription PCR (qRT-PCR) was used to quantify gene expression. Our results showed there was significantly higher expression of survivin (P < 0.05) and lower expression of p53 (P < 0.01) in oocytes compared to cumulus cells in G1. No significant difference in gene expression was observed following in vitro maturation or in COC derived from G1 and G2. However, expression of the Bax gene was significantly higher in cumulus cells from G1 (P < 0.02).

Keywords: apoptosis, gene expression, in vitro maturation, qRT-PCR.

(28)

Introduction

New knowledge about developmental competence, in vitro maturation (IVM) and cryopreservation of oocytes and embryos is critical for the in vitro production of embryos (IVP). The techniques of assisted reproduction, In vitro fertilization (IVF) and intracytoplasmic sperm injection (ICSI) have been successfully performed with equine gametes, however, low efficiency has limited their commercial application in this species (Choi et al., 2006; Hinrichs et al., 2007; Squires et al., 2003). Progress in this area was initially slow as standard IVF is not reproducible in horses (Hinrichs, 2010). However, ICSI resulted in the birth of several foals, and has been used for the clinical production of foals (Galli et al., 2007; Jacobson et al., 2010; Mortensen et al., 2010). Nevertheless, oocyte quality and culture conditions were found to be highly variable, with low levels of blastocyst formation in vitro and poor reproducibility between laboratories (Dell'aquila et al., 2003; Smits et al., 2009).

The study of gene expression is emerging in applied embryology, those genes involved in biological processes such as apoptosis, oxidative stress and cryotolerance need to be studied in order to compare gene expression in vivo, in vitro and under different culture conditions (Badr et al., 2007; Rizos et al., 2008; Wrenzycki et al., 2005). Oocyte quality can be assessed immediately following recovery by using several non-invasive, visual assessment parameters such as the morphology of the cumulus-oocyte complexes (COC). Oocytes with a compact cumulus composed of several layers of cells and a homogeneous cytoplasm are considered healthy, these oocytes can then be selected for in vitro maturation and IVF (Li et al., 2009). However, it has been reported that equine oocytes with a

(29)

compact cumulus exhibited a lower meiotic competence and lower fertilization rate after ICSI (Ambruosi et al., 2009). Analysis of the expression of genes that are involved in early embryonic development is an important tool for the development of assisted reproduction biotechnology.

One of the main factors affecting the potential for embryonic development is apoptosis (Anguita et al., 2009; Dhali et al., 2007; Park et al., 2006), or programmed cell death, which is an active and irreversible process of self-destruction of cells under physiological control (Parolin and Reason, 2001). The mechanisms of apoptosis may be activated by external stimuli, by binding to specific receptors on the cell surface, or by internal stimuli to intracellular stress, such as DNA damage, cell cycle alterations and in metabolic pathways and is controlled by several different gene families (Chang et al., 2002). Previous studies on cumulus cell gene expression (McKenzie et al., 2004) and apoptosis (Corn et al., 2005) showed that cumulus cells can reflect the developmental potential of human embryos during IVF cycles. Previously, was demonstrated the apoptosis incidence in mare ovarian follicles, its relationship with cumulus expansion and increased meiotic competence, however, no association with cytoplasmic maturation was observed (Dell'aquila et al., 2003). The impact of apoptosis in the COC and its impact on oocyte development potential remains unclear, as contradictory reports from various species have failed to clarify the occurrence of apoptosis in the COC (Yuan et al., 2005).

Thus, the aim of the current study was to evaluate the expression of the apoptosis related genes Bax, Bcl-2, survivin and p53 during in vitro maturation of equine oocytes and to compare gene expression between oocytes and cumulus cells isolated from COC with different morphological characteristics.

(30)

Materials and methods

Cumulus-oocyte complexes (COC) source

The biological material used in this experiment was obtained from a horse abattoir located in the city of Pelotas, RS, Brazil. The ovaries were randomly collected on the slaughter line, without identifying age, stage of the estrous cycle, clinical condition and nutritional status of mares. The time between slaughter and the collection was approximately one hour, and the ovaries were transported in thermo bottles in 0.9% NaCl sterile solution at 32 - 35°C to the Laboratory of Molecular Embryology, UFPel. The COC were aspirated from follicles ranging from 10 to 20 mm in diameter (follicles preceding follicle deviation). The contents were placed into a 50 mL conical tube and allowed to settle for 15 min. The sediment was evaluated using stereomicroscope (Olympus, USA) and suitable COC were selected. Degenerated or MII stage oocytes were discarded.

Morphological characterization of the equine COC

The COC were evaluated morphologically using an inverted optical microscope (Olympus, USA) for the number of layers and degree of compaction of the cumulus cells, cytoplasm homogeneity and integrity and were divided into two groups: G1 - considered morphologically healthy (oocytes with compact cumulus and more than three cell layers, intact cytoplasm, evenly granular and homogenous coloration), and G2 - considered morphologically less viable or with some degree of atresia (oocytes that presented less than three layers of cumulus cells and/or

(31)

expanded cumulus, with cumulus granular appearance, heterogeneous or dense and/or shrunken cytoplasm).

In vitro maturation (IVM)

In vitro maturation of the oocytes was carried out in follicular fluid as previously described (Caillaud et al., 2008). Briefly, equine follicular fluid was collected from follicles smaller than 30 mm, centrifuged at 14.000 rpm for 10 min, filtered through 22 µm filter and heat-inactivated at 56°C for 30 min. For in vitro maturation the COC were incubated for 36 h at 38.7ºC and 5% CO2. At the end of the incubation period the COC were denuded mechanically by repeated pipetting in a solution of 80 IU/ml of type-I hyaluronidase (Sigma-Aldrich, USA). Groups of 60 oocytes and the corresponding cumulus cells were cryopreserved in 50 µL of TRIzol Reagent (Invitrogen, USA) for RNA extraction and subsequent assessment of rates of gene expression by real-time reverse transcription PCR (qRT-PCR). As controls of the IVM process, the COC were classified into G1 and G2, denuded and total RNA was extracted immediately after collection. Nine hundred and sixty COC were divided among the experimental groups, four replicates were performed on pools of 60 COC. To determine the stage of nuclear maturation of the oocytes upon collection and after IVM, 10% were assessed by staining. The maturation rate was determined by Hoechst 33342 staining (Sigma-Aldrich, USA using a dye solution containing at 10 µg/ml and denuded oocytes were incubated for 10 min at 38.7°C. Slides were evaluated using an epifluorescent microscope (Olympus, USA), with filter wavelength of BP330-385 nm. Immature oocytes were those oocytes presenting a germinal vesicle (GV) with a single condensed mass associated with the nucleolus; germinal

(32)

vesicle breakdown (GVBD) with an irregular envelope surrounding disperse condensed chromatin. Metaphase I (MI) oocytes were those presenting the first metaphase plate. In oocytes at metaphase II (MII) the metaphase plate was located peripherally in the ooplasm and polar body in the perivitelline space. Oocytes with abnormal chromatin configurations or no chromatin visible were considered to be degenerating.

Total RNA isolation, reverse transcription and real-time PCR (qRT-PCR)

Total RNA was extracted from the COC stored in TRIzol as described by the manufacturer. The extracted RNA was quantified using the Qubit Fluorometer (Invitrogen, USA), with the Quant-iT RNA BR Assay Kit following the manufacturer’s instructions and standardized to a concentration of 4 ng/mL (equivalent to 60 oocytes). cDNA was produced using the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, USA) following the manufacturer’s instructions. The cDNA was then used as template for the qRT-PCR, Stratagene Mx3005P Real-Time PCR System (Agilent Technologies, UK), reaction using the Platinum Sybr Green Kit (Invitrogen, USA). The primer pairs for the qRT-PCR were designed using Vector NTI 11 software (Invitrogen, USA) using the sequences for each of the target genes, Table 1. The glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene (Smits et al., 2009) was used for normalization of the target gene expression data.

Data processing and statistical analysis

Data processing and statistical analysis were performed using the software REST 2009. The rate of gene expression was calculated relative to the expression of

(33)

the GAPDH gene, based on the method of Pfaffl and colleagues (Pfaffl et al., 2002). The various groups were analysed using integrated randomization and bootstrapping methods to compare expression ratios, P values ≤ 0.05 were considered significant.

Results

Differentiation and COC in vitro maturation (IVM)

Some 1160 COC were recovered from 528 ovaries. Immediately after collection, 76% (76/100) of oocytes were at the germinal vesicle stage, 17% (17/100) were at the germinal vesicle breakdown stage and 7% (7/100) were at the degenerated stage. The COC were divided into two groups: G1 - considered morphologically healthy and G2 - considered morphologically less viable or with some degree of atresia, see Fig. 1. The average rate of IVM was 51%, with a rate of 54% (27/50) for the G1 group and 48% (24/50) for the G2 group.

Relative expression of the Bax, Bcl-2, survivin and p53 genes

Overall our results showed that survivin gene expression was significantly downregulated while p53 expression was significantly upregulated in cumulus cells in comparison to COC. Furthermore, p53 expression was higher in both immature and in vitro matured cumulus cells.

The survivin gene showed higher expression in in vitro matured oocytes from morphological group G1 than in cumulus cells from these oocytes (p <0.02). The p53 gene shows a lower expression in G1 in vitro matured oocytes compared to G1 in vitro matured cumulus cells (p=0.007). However, the same relation was not observed

(34)

between mature oocytes and cumulus cells mature G2. Figure 2 shows the data on survivin gene expression and the data on p53 gene expression in oocyte and cumulus cells of G1 and G2 groups. When the expression was compared between oocytes and cumulus cells according to morphology and maturation, differences for genes Bcl-2 and Bax (p> 0.05) were not detected.

In this study, no difference was detected in the expression of apoptotic genes analyzed in immature oocytes and after in vitro maturation (p>0.05). In oocytes from different morphological groups, G1 and G2, there was no difference in Bcl-2, Bax, survivin and p53 gene expression in immature and in vitro maturated oocytes. Among the groups of oocytes according to morphological classification, G1 and G2, there was no difference in Bcl-2, Bax, survivin and p53 gene expression (p>0.05).

Changes in gene expression of Bcl-2, survivin and p53 (p>0.05) were not observed among cumulus cells. Between the morphological classification groups G1 and G2 it was observed difference in the expression of cumulus cells for the pro-apoptotic Bax gene. The expression of Bax was higher in cells of the morphological group G1 than G2 (p=0.02) (fig. 2).

Discussion

This study evaluated the expression of Bax, Bcl-2, survivin and p53 genes during in vitro maturation of equine oocytes, to compare expression between different morphological parameters of oocytes and cumulus cells from these complexes. Gene expression studies in equine species are relatively scarce (Smits et al., 2009), this was the first report of gene expression in equine cumulus-oocyte complex, allowing to elucidate the pattern of expression of apoptotic genes.

(35)

We observed different expression of anti-apoptotic gene survivin and pro-apoptotic gene p53 between oocytes and cumulus cells. Equine morphologically viable oocytes expressed a higher rate of survivin and lower rate of p53 than cumulus cells. Gene expression in cumulus cells, including genes involved in the apoptotic process, provides evidence that embryo viability is reflected in differential gene expression in the cumulus cells (van Montfoort et al., 2008). The bidirectional communication between the oocyte and companion somatic cells is essential for development of an egg competent to undergo fertilization and embryogenesis (Matzuk et al., 2002). An increase in apoptotic cumulus cells has been related to a decrease of mature oocytes and to a decreased ability to be fertilized in stimulated IVF cycles (Host et al., 2000). Our results indicating the survivin and p53 proteins synthesized, act on survival and early development of equine embryos.

Upon resumption of meiosis germinal vesicle breakdown, oocytes become transcriptionally quiescent and must rely on pools of RNA accumulated during the growth phase for protein synthesis (Wassarman and Letourneau, 1976). In a study of oocytes and cumulus cells of bovine, ovine, porcine, canine, feline and murine, it was demonstrated that oocyte RNA features were repeatable whether maturation occurred in vitro or in vivo, and were similar between the phases of nuclear maturation of the germinal vesicle and metaphase II oocytes (Payton et al., 2010). The differences in features of total RNA from oocytes versus cumulus was reported, oocytes are contained within growing antral follicles which are in large part transcriptionally inactive while cumulus cells are transcriptionally active. Furthermore, oocytes contain maternal pools of RNA, protein and energy stores that accumulated

(36)

during the growth phase, a period during which features of oocyte RNA are more like somatic cells (Payton et al., 2010).

Survivin expression was appointed as a possible marker for good quality in vitro developmental capacity of bovine follicular oocytes (Jeon et al., 2008). The expression of survivin was related to the quality of COCS, their developmental competence and the quality of in vitro produced blastocysts in bovine (Jeon et al., 2008). The Survivin protein is known as a bifunctional protein that suppresses apoptosis and regulates cell division. The survivin acts as inhibitor of apoptosis by linking directly to the caspases, it has been shown to inhibit directly the caspase 3 activity, preventing the formation of apoptosome (Altieri, 2010; Kawamura et al., 2003).

The tumor suppressor gene p53 is an important mediator in response to cellular stress (Dhali et al., 2007). The transcriptional activity of p53 is required for cell death in some systems, its nuclear translocation is required for transcription of the gene Bax (Sabbatini et al., 1995). However, the p53 gene expression appear to have no correlation with morphological quality of bovine embryos (Melka et al., 2009). Was reported a significantly higher expression of p53 from oocyte to four-cell stage as compared with that of the later pre-implantation stages, suggesting p53-independent apoptosis in bovine embryos (Melka et al., 2009). Equine oocytes are characterized by a large amount of lipid droplets in their cytoplasm, in association with the mitochondria and smooth endoplasmic reticulum (Ambruosi et al., 2009; Tremoleda et al., 2003), suggesting the oocytes and embryos of this species are more sensitive to oxidative stress and apoptosis (Ambruosi et al., 2009). In vitro maturation of oocytes is an essential step for in vitro production of embryos, however

(37)

the conditions under which the oocytes are subjected may result in changes in gene expression in these cells, as a response to injuries suffered.

Expression of the Bax gene has been identified in oocytes, granulosa cells and luteal cells of various species and levels of Bax expression appear to be positively correlated with apoptosis in each of these lineages. Bax and p53 upregulation has been associated with apoptosis in granulosa cells (Zwain and Amato, 2001). Among the morphological classification groups G1 and G2 it was observed difference in the expression of cumulus cells for the gene pro-apoptotic Bax, the expression of Bax is higher in cells of the morphological group G1, and the Bcl-2 has not changed. However, in the study by Filali et al (2009) the Bcl-2 mRNA expression was found to be significantly higher in cumulus cells associated with mature oocytes than those associated with immature oocytes, whereas BAX mRNA concentrations did not vary in cumulus cells from either source.

In this study, no difference was detected in the expression of apoptotic genes analyzed in immature oocytes and after in vitro maturation period, and oocytes from different morphological groups, G1 and G2. There was no difference in gene expression Bcl-2, Bax, survivin and p53 in immature oocytes and in vitro maturated. Similar results were published comparing the expression levels of anti-apoptotic gene Bcl-2 in different morphological groups of bovine oocytes in vivo matured, founding no difference in the quantification of transcripts to this gene (Pretheeban et al., 2009). The potential development of embryos in vitro produced depends mainly on the quality of oocytes from which they originate, with the selection of oocytes based primarily on morphological features. While, Yang & Rajamahendran (2002) reported higher levels of expression of the anti-apoptotic gene Bcl-2 in oocytes considered

(38)

morphologically healthy, Li et al. (2009) observed initial characteristics of apoptosis in immature COC, which was confirmed by transcriptase-on quantification of Bax and Bcl-2 showing that the dynamic change in the transcriptional profile of Bax corresponded with the occurrence of apoptosis and early development of oocytes, while the pattern of Bcl-2 transcription showed a contrasting pattern.

In conclusion was observed in equine morphologically viable oocytes expressed a greater rate of survivin and lower rate of p53 than cumulus cells. No difference was detected in the expression of apoptotic genes analyzed in oocytes immature and after in vitro maturation period and in oocytes from morphological groups, but in cumulus cells higher expression of the gene pro-apoptotic Bax in G1 than G2 was observed. However, other genes involved in cell survival and viability need to be studied, as a higher number of oocytes corresponding to different stages of meiotic maturation are targets for our subsequent studies. We believe that our data can contribute to identification of gene regulation during maturation increases the knowledge about the biology of the oocyte and signals the progress in understanding the molecular events involved in communication and in vitro maturation of cumulus-oocyte complex, indicating possible markers of viability and competence.

Acknowledgements

This work was supported by grants from CNPq and FAPERGS, Brazil. P.M.M.L, V.F.C., C.K. and K.B. were supported by scholarships from CAPES, Brazil and J.C.D. and O.A.D. received a research fellowship from CNPq.

(39)

References

Altieri, D.C., (2010). Survivin and IAP proteins in cell-death mechanisms. Biochem. J. 430, 199-205.

Ambruosi, B., Lacalandra, G.M., Iorga, A.I., De, S.T., Mugnier, S., Matarrese, R., Goudet, G. & Dell'aquila, M.E., (2009). Cytoplasmic lipid droplets and mitochondrial distribution in equine oocytes: Implications on oocyte maturation, fertilization and developmental competence after ICSI. Theriogenology 71, 1093-1104.

Anguita, B., Paramio, M.T., Morato, R., Romaguera, R., Jimenez-Macedo, A.R., Mogas, T. & Izquierdo, D., (2009). Effect of the apoptosis rate observed in oocytes and cumulus cells on embryo development in prepubertal goats. Anim Reprod. Sci. 116, 95-106.

Badr, H., Bongioni, G., Abdoon, A.S., Kandil, O. & Puglisi, R., (2007). Gene

expression in the in vitro-produced preimplantation bovine embryos. Zygote. 15, 355-367.

Caillaud, M., Dell'aquila, M.E., De, S.T., Nicassio, M., Lacalandra, G.M., Goudet, G. & Gerard, N., (2008). In vitro equine oocyte maturation in pure follicular fluid plus interleukin-1 and fertilization following ICSI. Anim Reprod. Sci. 106, 431-439.

Chang, S.H., Cvetanovic, M., Harvey, K.J., Komoriya, A., Packard, B.Z. & Ucker, D.S., (2002). The effector phase of physiological cell death relies exclusively on the posttranslational activation of resident components. Exp. Cell Res. 277, 15-30.

Choi, Y.H., Love, L.B., Varner, D.D. & Hinrichs, K., (2006). Blastocyst development in equine oocytes with low meiotic competence after suppression of meiosis with roscovitine prior to in vitro maturation. Zygote. 14, 1-8.

(40)

Corn, C.M., Hauser-Kronberger, C., Moser, M., Tews, G. & Ebner, T., (2005). Predictive value of cumulus cell apoptosis with regard to blastocyst development of corresponding gametes. Fertil. Steril. 84, 627-633.

Dell'aquila, M.E., Albrizio, M., Maritato, F., Minoia, P. & Hinrichs, K., (2003). Meiotic competence of equine oocytes and pronucleus formation after

intracytoplasmic sperm injection (ICSI) as related to granulosa cell apoptosis. Biol. Reprod. 68, 2065-2072.

Dhali, A., Anchamparuthy, V.M., Butler, S.P., Pearson, R.E., Mullarky, I.K. & Gwazdauskas, F.C., (2007). Gene expression and development of mouse zygotes following droplet vitrification. Theriogenology 68, 1292-1298.

Filali, M., Frydman, N., Belot, M.P., Hesters, L., Gaudin, F., Tachdjian, G., Emilie, D., Frydman, R. & Machelon, V., (2009). Oocyte in-vitro maturation: BCL2 mRNA content in cumulus cells reflects oocyte competency. Reprod. Biomed. Online. 19, 4309.

Galli, C., Colleoni, S., Duchi, R., Lagutina, I. & Lazzari, G., (2007). Developmental competence of equine oocytes and embryos obtained by in vitro procedures ranging from in vitro maturation and ICSI to embryo culture, cryopreservation and somatic cell nuclear transfer. Anim Reprod. Sci. 98, 39-55.

Hinrichs, K., (2010). In vitro production of equine embryos: state of the art. Reprod. Domest. Anim 45, 3-8.

Hinrichs, K., Choi, Y.H., Walckenaer, B.E., Varner, D.D. & Hartman, D.L., (2007). In vitro-produced equine embryos: production of foals after transfer, assessment by differential staining and effect of medium calcium concentrations during culture. Theriogenology 68, 521-529.

Host, E., Mikkelsen, A.L., Lindenberg, S. & Smidt-Jensen, S., (2000). Apoptosis in human cumulus cells in relation to maturation stage and cleavage of the corresponding oocyte. Acta Obstet. Gynecol. Scand. 79, 936-940.

(41)

Jacobson, C.C., Choi, Y.H., Hayden, S.S. & Hinrichs, K., (2010). Recovery of mare oocytes on a fixed biweekly schedule, and resulting blastocyst formation after intracytoplasmic sperm injection. Theriogenology 73, 1116-1126.

Jeon, K., Kim, E.Y., Tae, J.C., Lee, C.H., Lee, K.S., Kim, Y.O., Jeong, D.K., Cho, S.K., Kim, J.H., Lee, H.Y., Riu, K.Z., Cho, S.G. & Park, S.P., (2008). Survivin protein expression in bovine follicular oocytes and their in vitro developmental competence. Anim Reprod. Sci. 108, 319-333.

Kawamura, K., Sato, N., Fukuda, J., Kodama, H., Kumagai, J., Tanikawa, H., Nakamura, A., Honda, Y., Sato, T. & Tanaka, T., (2003). Ghrelin inhibits the development of mouse preimplantation embryos in vitro. Endocrinology 144, 2623-2633.

Li, H.J., Liu, D.J., Cang, M., Wang, L.M., Jin, M.Z., Ma, Y.Z. & Shorgan, B., (2009). Early apoptosis is associated with improved developmental potential in bovine oocytes. Anim Reprod. Sci. 114, 89-98.

Matzuk, M.M., Burns, K.H., Viveiros, M.M. & Eppig, J.J., (2002). Intercellular communication in the mammalian ovary: oocytes carry the conversation. Science 296, 2178-2180.

McKenzie, L.J., Pangas, S.A., Carson, S.A., Kovanci, E., Cisneros, P., Buster, J.E., Amato, P. & Matzuk, M.M., (2004). Human cumulus granulosa cell gene expression: a predictor of fertilization and embryo selection in women undergoing IVF. Hum. Reprod. 19, 2869-2874.

Melka, M., Rings, F., Holker, M., Tholen, E., Havlicek, V., Besenfelder, U.,

Schellander, K. & Tesfaye, D., (2009). Expression of Apoptosis Regulatory Genes and Incidence of Apoptosis in Different Morphological Quality Groups of In Vitro-produced Bovine Pre-implantation Embryos. Reprod. Domest. Anim. 45, 915-921.

Mortensen, C.J., Choi, Y.H., Ing, N.H., Kraemer, D.C., Vogelsang, M.M. & Hinrichs, K., (2010). Heat shock protein 70 gene expression in equine blastocysts after

(42)

exposure of oocytes to high temperatures in vitro or in vivo after exercise of donor mares. Theriogenology 74, 374-383.

Park, S.Y., Kim, E.Y., Cui, X.S., Tae, J.C., Lee, W.D., Kim, N.H., Park, S.P. & Lim, J.H., (2006). Increase in DNA fragmentation and apoptosis-related gene expression in frozen-thawed bovine blastocysts. Zygote. 14, 125-131. Parolin, M.B., Reason, I.J., (2001). [Apoptosis as a mechanism of tissue injury in

hepatobiliary diseases]. Arq Gastroenterol. 38, 138-144.

Payton, R.R., Rispoli, L.A. & Edwards, J.L., (2010). General Features of Certain RNA Populations from Gametes and Cumulus Cells. J. Reprod. Dev.56, 583-592. Pfaffl, M.W., Horgan, G.W. & Dempfle, L., (2002). Relative expression software tool

(REST) for group-wise comparison and statistical analysis of relative expression results in real-time PCR. Nucleic Acids Res. 30, e36.

Pretheeban, T., Gordon, M., Singh, R., Perera, R. & Rajamahendran, R., (2009). Differential mRNA expression in in vivo produced pre-implantation embryos of dairy heifers and mature cows. Mol. Reprod. Dev. 76, 1165-1172.

Rizos, D., Clemente, M., Bermejo-Alvarez, P., de La, F.J., Lonergan, P. & Gutierrez-Adan, A., (2008). Consequences of in vitro culture conditions on embryo development and quality. Reprod. Domest. Anim. 43, 44-50.

Sabbatini, P., Lin, J., Levine, A.J. & White, E., (1995). Essential role for

p53-mediated transcription in E1A-induced apoptosis. Genes Dev. 9, 2184-2192. Smits, K., Goossens, K., Van, S.A., Govaere, J., Hoogewijs, M., Vanhaesebrouck, E.,

Galli, C., Colleoni, S., Vandesompele, J. & Peelman, L., (2009). Selection of reference genes for quantitative real-time PCR in equine in vivo and fresh and frozen-thawed in vitro blastocysts. BMC. Res. Notes 2, 246.

Squires, E.L., Carnevale, E.M., McCue, P.M. & Bruemmer, J.E., (2003). Embryo technologies in the horse. Theriogenology 59, 151-170.

(43)

Tremoleda, J.L., Stout, T.A., Lagutina, I., Lazzari, G., Bevers, M.M., Colenbrander, B. & Galli, C., (2003). Effects of in vitro production on horse embryo morphology, cytoskeletal characteristics, and blastocyst capsule formation. Biol. Reprod. 69, 1895-1906.

van Montfoort, A.P., Geraedts, J.P., Dumoulin, J.C., Stassen, A.P., Evers, J.L. & Ayoubi, T.A., (2008). Differential gene expression in cumulus cells as a prognostic indicator of embryo viability: a microarray analysis. Mol. Hum. Reprod. 14, 157-168.

Wassarman, P.M., Letourneau, G.E., (1976). RNA synthesis in fully-grown mouse oocytes. Nature 261, 73-74.

Wrenzycki, C., Herrmann, D., Lucas-Hahn, A., Korsawe, K., Lemme, E. & Niemann, H., (2005). Messenger RNA expression patterns in bovine embryos derived from in vitro procedures and their implications for development. Reprod. Fertil. Dev. 17, 23-35.

Yang, M.Y., Rajamahendran, R., (2002). Expression of Bcl-2 and Bax proteins in relation to quality of bovine oocytes and embryos produced in vitro. Anim Reprod. Sci. 70, 159-169.

Yuan, Y.Q., Van, S.A., Leroy, J.L., Dewulf, J., Van, Z.A., de, K.A. & Peelman, L.J., (2005). Apoptosis in cumulus cells, but not in oocytes, may influence bovine embryonic developmental competence. Theriogenology 63, 2147-2163. Zwain, I.H., Amato, P., (2001). cAMP-induced apoptosis in granulosa cells is

associated with up-regulation of P53 and bax and down-regulation of clusterin. Endocr. Res. 27, 233-249.

(44)

Gene Acession Number Sequence TM Fragment size Efficiency (%) Coorelation (R2) Bcl-2 Eq XM_001499714.1 F 5’ GAGACCCCCAGTGCCATCAA 3’ 57ºC 146 bp 99.9% 0.97 R 5’ GGGATGTCAGGTCGCTGAAT 3’ BaxEq XM_001489207.1 F 5’ TTTGCTTCAGGGTTTCATCC 3’ 60ºC 162 bp 100% 0.94 R 5’ ATCCTCTGCAGCTCCATGTT 3’ p53 Eq XM_001918153.1 F 5’ AAAGGATGCCCATGCTACAGAGGA 3’ 63ºC 82 bp 90.5% 0.98 R 5’ AGTAGACTGGCCCTTCTTGGTCTT 3’ SurvivinEq XM_001915400.1 F 5’ TTCATCCACTGTCCCACTGA 3’ 57ºC 98 bp 70.5% 0.98 R 5’ GTTCCTCTATGGGGTCGTCA 3’

GAPDH NM_001163856.1 F 5’ GCC GTA ACT TCT GTG CTG TG 3’ 61ºC 150 bp 84.0% 0.98

(45)

Figure 1. A) Oocytes classified as healthy morphological group, G1; B) Oocyte classified as morphological group with some signs of degeneration, G2.

(46)

Figure 2. Normalized CT values of the mRNA levels of the four apoptotic genes, Bcl-2, Bax, Survivin and p53. A. Immature oocytes and cumulus cells from groups G1 and G2 and B. In vitro matured oocytes and cumulus cells from groups G1 and G2. Significant differences where P < 0.05 are indicated by a *, P < 0.01 by ** and P < 0.001 by ***. iOoc: immature oocytes; iCum: immature cumulus cells; mOoc: matured oocytes; mCum: matured cumulus cells.

(47)

3. ARTIGO II

Association between single nucleotide polymorphism in p53 and abortion in Thoroughbred mares

(artigo aceito para publicação no periódico The Veterinary Journal)

(48)

Thoroughbred mares

Priscila Marques Moura de Leona,b, Vinicus Farias Camposa, Helena Strelow Thurowb, Fernando Pires Hartwiga, Lisiane Priscila Selauc, Odir Antonio Dellagostind,

João Carlos Deschampsa, Fabiana Kömmling Seixasb, Tiago Collaresa,*

a Laboratório de Embriologia Molecular e Transgênese, Biotecnologia/Centro de

Desenvolvimento Tecnológico, Universidade Federal de Pelotas, Pelotas, RS, Brazil

b

Laboratório de Genômica Funcional, Biotecnologia/Centro de Desenvolvimento Tecnológico, Universidade Federal de Pelotas, Pelotas, RS, Brazil

c

Instituto de Matemática, Universidade Federal do Rio Grande do Sul, Porto Alegre, RS, Brazil

d

Laboratório de Biologia Molecular, Núcleo de Biotecnologia, Centro de

Desenvolvimento Tecnológico, Universidade Federal de Pelotas, Pelotas, RS, Brazil

* Corresponding author. Tel.: +55 53 32757588. Email address: collares.t@gmail.com (T. Collares).

(49)

Single-nucleotide polymorphisms (SNPs) in the p53 gene have been studied extensively in humans but not in horses. The aim of this study was to determine the prevalence of the Arg/Pro SNP in p53 in horses and correlate the genotypes with the corresponding reproductive performance in Thoroughbred mares. Blood samples were collected from 105 horses and SNPs were detected by PCR-RFLP and confirmed by sequencing. The heterozygous Arg/Pro was found in 73.3% of Thoroughbreds compared to the homozygous Arg/Arg and Pro/Pro that was detected in 17.1% and 9.6% of mares, respectively. The Arg/Pro genotype was significantly associated with abortion (P = 0.02), while Pro/Pro mares had a lower probability of abortion (P <0.05). p53 may play a role in equine reproduction.

Referências

Documentos relacionados

a arte infantil é, assim, uma autêntica atividade criadora porque, independentemente da multiplicidade de gostos, tendências e evoluções que caracterizam cada

Anzitutto ho potuto cogliere quanto sia stato ben organizzato e cura- to nei dettagli, sia dal punto di vista esteriore (la scelta del luogo, ossia l’anfiteatro III della Facoltà

Foi realizada a recolha de saliva para medição do fluxo salivar estimulado (FSE) e não estimulado (FSNE) antes (inicial) e após (final) a toma da infusão de gengibre. Para

-ATPase activity in the synaptic plasma membrane from cere- bral cortex of adult rats submitted to chronic administration of imipramine and fluoxe- tine.. We also studied the in vitro

The Gm GAPDH was the least stable gene, with the highest mean values of expression stability (M), and the most stable genes, with the lowest M values, were the Gm β‑actin and

Here, we used real-time PCR array analysis to profile a large number of genes and microRNAs involved in AT2R induced apoptosis in prostate cancer cell lines.. In this report,

The best way to achieve this goal is to apply a solvent-free, pH-neutral, hydrophobic adhesive resin layer in a separate step, as confirmed by inferior in vitro and in vivo

margarita não apresentaram diferenças significativas com a adição de células viáveis e não-viáveis no meio de cultivo, porém o número de pontas de hifas, células auxiliares e