INSTITUTO DE BIOLOGIA
MIRIAN AYUMI KURAUTI
FUNÇÃO DA INTERLEUCINA-6 (IL-6) SOBRE A
MODULAÇÃO DA INSULIN-DEGRADING ENZYME (IDE)
DURANTE O EXERCÍCIO FÍSICO AGUDO
THE ROLE OF INTERLEUKIN-6 (IL-6) ON THE
MODULATION OF INSULIN-DEGRADING ENZYME (IDE)
DURING THE ACUTE EXERCISE
Campinas 2017
FUNÇÃO DA INTERLEUCINA-6 (IL-6) SOBRE A MODULAÇÃO DA
INSULIN-DEGRADING ENZYME (IDE) DURANTE O EXERCÍCIO
FÍSICO AGUDO
THE ROLE OF INTERLEUKIN-6 (IL-6) ON THE MODULATION OF
INSULIN-DEGRADING ENZYME (IDE) DURING THE ACUTE
EXERCISE
Tese apresentada ao Instituto de Biologia da Universidade Estadual de Campinas como parte dos requisitos exigidos para obtençao do título de Doutora em Biologia Funcional e Molecular na Área de Fisiologia.
Thesis presented to the Institute of Biology of the University of Campinas in partial fulfillment of the requirements for the degree of Doctor in Molecular and Functional Biology in the area of Physiology.
Orientador: Antonio Carlos Boschiero
Campinas 2017
ESTE ARQUIVO DIGITAL CORRESPONDE À VERSÃO FINAL DA TESE DEFENDIDA PELA ALUNA MIRIAN AYUMI KURAUTI E ORIENTADA PELO PROF DR ANTONIO CARLOS BOSCHIERO.
COMISSÃO EXAMINADORA
Prof. Dr. Antonio Carlos Boschiero (Orientador)
Prof. Dr. Andre Schwambach Vieira
Prof. Dr. Eduardo Rochete Ropelle
Profa. Dra. Camila Aparecida Machado de Oliveira
Profa. Dra. Helenir Medri de Souza
Os membros da Comissão Examinadora acima assinaram a Ata de Defesa, que se encontra no processo de vida acadêmica do aluno.
“O desejo profundo da humanidade pelo
conhecimento é justificativa suficiente para nossa busca contínua.”
DEDICATÓRIA
À minha família, em especial à minha avó Rosa e ao meu avô Antônio, a quem eu dedico todos os meus esforços no estudo do Diabetes.
AGRADECIMENTOS
Agradeço,
Ao meu orientador Prof. Dr. Antônio Carlos Boschero por todos os ensinamentos e pela excelente orientação.
Aos principais envolvidos na realização deste trabalho, Dr. José Maria Costa Júnior, Dra. Sandra Mara Ferreira, Dr. Gustavo Jorge dos Santos e Dr. Carlos Henrique Grossi Sponton, pela colaboração nos experimentos realizados.
Aos colaboradores da Faculdade de Educação Física da UNICAMP, Dra. Mara Patrícia Chacon Mikahil, Dra. Cláudia Regina Cavaglieri, Dr. Miguel Conceição e Guilherme Defante Telles.
Aos professores Dr. Cláudio Werneck, Dra. Camila Oliveira e Dra. Fernanda Ortis pelas correções e sugestões para este trabalho no exame de qualificação.
Aos colegas do Laboratório de Pâncreas Endócrino e Laboratório de Lípedes, em especial à Sandra, José Maria, Gustavo, Jean, Gabriela, Camila, Nayara, Jheynifer, Roberta, Thiago e Estela, pela parceria dentro e fora do laboratório.
À todos os técnicos, em especial à Marise, Jheynifer, Mônica e Bill. Ao Instituto de Biologia pelo apoio estrutural.
À Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP) e ao Conselho Nacional de Pesquisa (CNPq), pelo apoio financeiro.
À minha família, especialmente ao meus pais Milton e Helena, por todo o apoio e incentivo. Sem eles nada seria possível.
Ao meu noivo Rodrigo, pela compreensão, apoio e incentivo.
À Unicamp Swimming Society Reloaded (USSR) pelos treinos pesados mas descontraídos no final da tarde. Com certeza, a melhor equipe do mundo.
Gostaria de agradecer também à todos que contribuíram, de alguma forma, para a realização deste trabalho e que não foram citados. Muito obrigada.
RESUMO
A hiperinsulinemia, frequentemente associada a obesidade e diabetes melitus tipo 2, decorre do aumento da secreção de insulina e/ou da redução do clearance desse hormônio. Este último processo ocorre principalmente no fígado, pela ação da insulin-degrading enzyme (IDE), principal enzima responsável pela degradação da insulina. Sabe-se que o exercício físico reduz a insulinemia, pelo menos em parte, devido ao aumento do clearance de insulina associado a um aumento da expressão da IDE, entretanto os mecanismos envolvidos nessa modulação ainda não são conhecidos. Durante o exercício físico, o tecido muscular em contração secreta várias moléculas, denominadas miocinas, sendo uma das principais a interleucina-6 (IL-6). O objetivo deste trabalho foi investigar, inicialmente, a função da IL-6 sobre a modulação da expressão e atividade da IDE e, numa segunda fase, averiguar se, durante o exercício físico, esta citocina seria responsável pelo aumento do clearance de insulina e da expressão da IDE. Primeiramente, foram utilizados camundongos C57BL/6 wild type (WT) e knockout (KO) para o gene da IL-6. Nestes camundongos, avaliamos a homeostase glicêmica, através dos testes de tolerância à glicose (ipGTT) e à insulina (ipITT), e o clearance de insulina. Também avaliamos a secreção de insulina estimulada por glicose em ilhotas isoladas e a expressão (gênica e proteica) e atividade da IDE no fígado e músculo gastrocnêmio. Os camundongos KO apresentaram redução da tolerância à glicose, comparado ao grupo WT, decorrente, provavelmente, da menor secreção de insulina pelas ilhotas desses camundongos, uma vez que não observamos diferenças na sensibilidade à insulina. Além disso, observamos redução do clearance de insulina, a qual foi acompanhada de uma menor expressão e atividade da IDE no fígado e no músculo gastrocnêmio dos camundongos KO. In vitro, incubamos células HEPG2 e C2C12 na presença de diferentes concentrações de IL-6. Após 3 h em 50 ou 100 ng/ml de IL-6, a expressão da IDE foi significativamente maior nas células HEPG2 e C2C12, respectivamente. Em seguida, camundongos selvagens, foram distribuídos em 3 grupos: controle (CTL), exercitado (EXE), e exercitado tratado com 2 mg/kg de tocilizumabe (EXE+TCZ), um anticorpo que se liga ao receptor da IL-6, impedindo sua sinalização. O exercício agudo foi realizado em esteira inclinada com duração de 3 h em intensidade moderada. Nesses grupos, também foram avaliados os mesmos parâmetros citados acima. Camundongos EXE+TCZ tiveram tanto o aumento do clearance de insulina quanto o aumento da expressão e atividade da IDE bloqueados, principalmente no músculo gastrocnêmio. Por fim, coletamos amostras de plasmas de humanos, antes e 3 h depois do exercício agudo (30 min em cicloergômetro a 70% do VO2peak). Após 3 h da sessão de
exercício, observamos aumento das concentrações plasmáticas de IL-6 e IDE, as quais foram positivamente correlacionadas. Apesar de não observarmos aumento significativo da atividade da IDE, também registramos uma correlação positiva entre IL-6 e atividade dessa enzima. Em resumo, nossos resultados apontam para uma função ainda desconhecida da IL-6 sobre o controle glicêmio, atuando sobre o clearance de insulina via modulação da IDE. Além disso, observamos que essa função da IL-6 tem papel fundamental no aumento do clearance de insulina durante o execício físico, através do aumento da expressão e atividade da IDE, principalemte no músculo esquelético, um efeito que parece ocorrer também em humanos, a exemplo dos camundongos.
ABSTRACT
Hyperinsulinemia is often associated with pathological conditions such as obesity and type 2 diabetes mellitus. It depends on increase in insulin secretion and/or decrease in insulin clearance that occurs, mainly, in liver by insulin-degrading enzyme (IDE). It is known that physical exercise reduces insulinemia, at least in part, due to increase in insulin clearance and IDE expression, however, the mechanisms involved in this modulation remains unclear. During exercise, muscle contractions secrete several molecules, named myokines, and the most important, in terms of quantity, is the inteleukin-6 (IL-6). In this study we first investigated the role of IL-6 on the modulation of IDE expression and activity. Secondly, we assessed a possible role of this cytokine on the increase in insulin clearance and IDE expression, during an acute exercise. First, we used C57BL/6 wild type (WT) and IL-6 knockout (KO) mice, and to evaluate the glycemic homeostasis, we performed both glucose and insulin tolerance tests (ipGTT and ipITT, respectively). We also evaluated the insulin clearance, glucose stimulated insulin secretion in isolated pancreatic islets and IDE (gene and protein) expression and activity in the liver and gastrocnemius muscle. The KO mice displayed impairment of glucose tolerance, compared with WT, an effect probably due to a reduced insulin secretion by the islets from these mice. This assumption was based on the fact that we did not observed alteration in insulin sensitivity. In addition, it was observed a reduction of the insulin clearance, probably due to the lower IDE expression and activity, in the liver and gastrocnemius muscle from KO mice, compared with WT. In vitro experiments, using HEPG2 and C2C12 cells, were also performed. The increase in IDE expression was observed after 3-h incubation at 50 or 100 ng/ml IL-6, in the HEPG2 and C2C12 cells, respectively. After, WT mice were distributed into 3 different groups: control (CTL), exercised (EXE), and exercised treated with 2 mg/kg tocilizumab (EXE+TCZ), an IL-6 receptor antibody. The acute exercise was performed on a treadmill during 3-h at moderate intensity. In these groups, we also evaluated the same parameters cited above. Interestingly, the inhibition of IL-6, in the EXE+TCZ mice, abrogated the increase of insulin clearance and IDE expression and activity, mainly in the gastrocnemius muscle. Finally, we also collected plasma samples from humans, before and 3-h after an acute exercise (30 min cycling at 70%
VO2peak). Three hours after the end of the acute exercise, we observed an increase in IL-6 and
IDE plasma concentrations, which were positively correlated. Although the increase in plasma IDE activity was only marginal, a positive correlation between IL-6 and IDE activity was also observed. In summary, our outcomes demonstrated a function, not yet described, of IL-6 on glycemic control that consists of incrase in insulin clearance and IDE expression and activity. This function seems to be essential for the augmentation of insulin clearance during physical exercise, increasing the IDE expression and activity mainly in the skeletal muscle, an effect that likely also occurs in human.
LISTA DE ABREVIATURAS E SIGLAS
5-FAM 5-Carboxyfluorescein
AICAR 5-aminoimidazol-4-carboxamida-1-β-D-ribosídeo Akt ou PKB Protein kinase B
AMP Adenosine monophosphate
AMPK AMP-activated protein kinase ANOVA Analise of variance
ATP Adenosine triphosphate
AUC Area under the curve
cDNA Complementary deoxyribonucleic acid CNTF Ciliary neurotrophic factor
CO2 Dióxido de carbono
CTL Grupo controle
DEPC dietil pirocarbonato DM2 Diabetes Mellitus tipo 2
DMEM Dulbecco's modified eagle's medium EDTA Ethylenediamine tetraacetic acid EPM Erro padrão da média
EXE Grupo exercitado
EXE+TCZ Grupo exercitado tratado com tocilizumabe GAPDH Glyceraldehyde 3-phosphate dehydrogenase GLUT1 Gluose transporter 1
GLUT2 Glucose transporter 2
IDE Insulin-degrading enzyme
IL-6 Interleucina-6
ipGTT Teste de tolerância à glicose intraperitoneal ipITT Teste de tolerância à insulina intraperitoneal
IR Insulin receptor
KATP Canal de potássio dependente de ATP
kDa Quilodalton
KO Knockout
p-Akt Akt fosforilada
PCR Polymerase chain reaction
POST-EXE Grupo 3 h após o término da sessão de exercício agudo PRE-EXE Grupo antes do início da sessão de exercício agudo
U Unidade
VO2 máx Consumo máximo de oxigênio
SUMÁRIO 1 INTRODUÇÃO ... 13 2 OBJETIVOS ... 18 2.1OBJETIVO GERAL ... 18 2.2OBJETIVOS ESPECÍFICOS ... 18 3 MATERIAIS E MÉTODOS ... 19 3.1ANIMAIS ... 19
3.2CONSUMO MÁXIMO DE OXIGÊNIO (VO2 MÁX) ... 19
3.3PROTOCOLO DA SESSÃO DE EXERCÍCIO FÍSICO AGUDO ... 20
3.4TESTE DE TOLERÂNCIA À GLICOSE INTRAPERITONEAL (IPGTT) ... 20
3.5TESTE DE TOLERÂNCIA À INSULINA INTRAPERITONEAL (IPITT) ... 21
3.6CLEARANCE DE INSULINA ... 21
3.7AVALIAÇÃO DA INSULINA E PEPTÍDEO-C PLASMÁTICOS ... 21
3.8COLETA DE TECIDOS ... 22
3.9SECREÇÃO DE INSULINA ESTIMULADA POR GLICOSE ... 22
3.10SINALIZAÇÃO DA INSULINA NO MÚSCULO ESQUELÉTICO ... 22
3.11RT-PCR EM TEMPO REAL ... 23
3.12WESTERN BLOT ... 24
3.13CULTURA DE CÉLULAS HEPG2 E C2C12 ... 24
3.14COLETA DAS AMOSTRAS DE PLASMA HUMANO ... 25
3.15ATIVIDADE DA IDE... 25
3.16AVALIAÇÃO DA IL-6 PLASMÁTICA ... 26
3.17ANÁLISE ESTATÍSTICA ... 26 4 RESULTADOS E DISCUSSÃO ... 27 4.1ARTIGO ... 28 4.1.1 Tabela ... 44 4.1.2 Figuras ... 45 4.1.3 Figuras Suplementares ... 51 CONSIDERAÇÕES FINAIS ... 54 REFERÊNCIAS ... 55 ANEXOS ... 61
1 INTRODUÇÃO
A insulina é um importante hormônio anabólico que desempenha papel fundamental no controle glicêmico. Portanto, é necessária a manutenção de níveis adequados desse hormônio na circulação sanguínea, para um controle efetivo da glicemia. Sabe-se que a insulinemia depende, basicamente, de dois processos fisiológicos: secreção de insulina, pelo pâncreas endócrino, e sua remoção do plasma, processo conhecido como clearance de insulina, que ocorre principalmente no fígado (Polonsky et al., 1988).
A secreção de insulina pelas células β pancreáticas depende, basicamente, dos níveis de nutrientes circulantes, principalmente da glicose. Esta é transportada para dentro das células β através de transportadores de glicose, predominantemente, do tipo 1 (GLUT1, do inglês “glucose tranporter 1”) em humanos e do tipo 2 (GLUT2, do inglês “glucose transporter 2”) em roedores (De Vos et al., 1995). O metabolismo da glicose promove a síntese de ATP, e altas concentrações desse substrato induzem o fechamento de canais de potássio sensíveis ao ATP (KATP), elevando, consequentemente, a concentração de potássio
intracelular (Koster et al., 2005). Este evento provoca a despolarização da membrana plasmática e abertura dos canais de cálcio dependentes de voltagem (Satin e Cook, 1985), aumentando as concentrações desse íon no citoplasma que por fim, desencadeia a translocação e fusão dos grânulos de insulina na membrana plasmática com subsequente liberação de insulina, como ilustrado na Figura 1 (Layden et al., 2010). Além da secreção de insulina ser regulada pelos níveis de nutrientes circulantes, ela também pode ser modulada, direta ou indiretamente, por alguns hormônios. Isso permite que as células β secretem insulina adequadamente, regulando os níveis de nutrientes circulantes de acordo com a necessidade do organismo em diferentes situações fisiológicas, como o jejum, a alimentação, o exercício físico, entre outros (Wright e Malaisse, 1968; Boschero, 1996).
Figura 1. Esquema simplificado da secreção de insulina estimulada pela glicose. 1) Entrada da glicose pelo GLUT2 e síntese de ATP; 2) Fechamento dos canais KATP e despolarização da membrana;
3) Abertura dos canais de cálcio voltagem-dependentes; 4) Fusão do grânulo secretório com a membrana plasmática e secreção de insulina (Layden et al., 2010).
Se, por um lado, os mecanismos de secreção de insulina têm sido extensivamente estudados (Mayhew et al., 1969; Boschero e Malaisse, 1979; Meglasson e Matschinsky, 1986; Prentki et al., 2013) por outro lado, menor atenção tem sido dada ao estudo do clearance desse hormônio. O principal órgão envolvido nesse processo é o fígado (Sato et al., 1991) com cerca de 50% da insulina secretada removida durante a primeira passagem por esse órgão. A remoção desse hormônio também acontece em outros tecidos sensíveis à insulina, como o tecido muscular esquelético e o tecido adiposo (Duckworth e Kitabchi, 1981; Duckworth et al., 1998). Basicamente, o clearance de insulina ocorre através das seguintes etapas: A) ligação da insulina ao seu receptor (IR, do inglês "insulin receptor"); B) internalização do complexo insulina-IR; e C) degradação do hormônio no citoplasma pela IDE (do inglês “insulin-degrading enzyme”), que é a principal enzima responsável por esse processo (Castillo et al., 1994). Além disso, o IR internalizado, quando se dissocia da insulina, pode retornar à membrana plasmática, sendo dessa forma reciclado (Fawcett e Duckworth, 2009), como ilustrado na Figura 2.
Figura 2. Esquema do clearance de insulina. A) Ligação da insulina ao IR, B) Internalização do complexo insulina-IR, C) degradação da insulina pela IDE e D) Reciclagem do IR.
A IDE é uma zinco-metaloproteinase de 110 kDa. Esta enzima é encontrada principalmente no citosol (Duckworth et al., 1998), porém, já foi descrita em diversos compartimentos celulares como endossomos (Authier et al., 2001), peroxissomos (Authier et al., 1995) e mitocondrina (Leissring et al., 2004). Além disso, a IDE também pode ser encontrada na superfície celular (Goldfine et al., 1984), podendo ser secretada, agindo extracelularmente (Shearer et al., 1997; Qiu et al., 1998). Embora a insulina seja o principal substrato da IDE, a qual apresenta alta afinidade a este hormônio (Duckworth et al., 1998), esta enzima também degrada outros peptídeos formadores de amiloide (peptídeos amiloidogênicos), como por exemplo, o glucagon, a amilia (Maianti et al., 2014) e o amiloide β (Farris et al., 2003). Portanto, prejuízos na função da IDE estão relacionados ao desenvolvimento de patologias, tais como, o Diabetes Mellitus tipo 2 (DM2) (Fakhrai-Rad et al., 2000; Karamohamed et al., 2003) e a Doença de Alzheimer (Bertram et al., 2000). A atividade e/ou expressão da IDE podem ser moduladas negativamente, através de diversos fatores, como ácidos graxos (Hamel et al., 2003), corticóides (Harada et al., 1996; Peres Protzek et al., 2016), óxido nítrico (Cordes et al., 2009) e ATP (Camberos et al., 2001). Também são conhecidos reguladores positivos da atividade e/ou expressão da IDE, tais como a própria insulina, a glicose (Pivovarova et al., 2009), a pioglitazona (Wei et al., 2014) e o 5-aminoimidazol-4-carboxamida-1-β-D-ribosídeo (AICAR) (Kurauti, Freitas-Dias, et al., 2016).
Um desequilíbrio entre a secreção e o clearance de insulina pode alterar, significativamente, a insulinemia. Dessa forma, um aumento da secreção de insulina e/ou redução do seu clearance aumentam as concentrações desse hormônio no plasma, podendo gerar um quadro de hiperinsulinemia (Erdmann et al., 2009). Nesse contexto, a obesidade destaca-se por estar frequentemente associada à hiperinsulinemia, devido a distúrbios na secreção (Kreisberg et al., 1967) e no clearance de insulina (Brandimarti et al., 2013), geralmente presentes nessa patologia.
A obesidade está frequentemente associada a outras condições patológicas, como o DM2. Ambas as patologias, obesidade e DM2, são associadas à resistência à insulina (Kahn et al., 2006) e, na maioria dos casos, à hiperinsulinemia (Kelly et al., 2014). Apesar da controvérsia, se a hiperinsulinemia é causa ou consequência da resistência à insulina, muitos estudos colocam a hiperinsulinemia como a iniciadora de todo o processo patológico, reduzindo ou dessensibilizando os receptores de insulina levando, consequentemente, a resistência a este hormônio (Gavin et al., 1974; Kanety et al., 1994). Portanto, reduzir a insulinemia pode ser uma estratégia promissora na prevenção e/ou tratamento de patologias relacionadas com a resistência à insulina.
Nesse contexto, o exercício físico, indicado para pacientes obesos e diabéticos, mostra-se eficaz em reduzir a concentração de insulina plasmática (Musi et al., 2001). Muitos estudos, utilizando modelos de exercício físico crônico e agudo, atribuem esse efeito, principalmente, à redução da secreção de insulina (Aarnio et al., 2001; Almeida et al., 2012). Recentemente, demonstramos que, durante o exercício físico agudo, a redução de insulina plasmática, em camundongos magros, ocorre, pelo menos em parte, devido ao aumento do clearance de insulina o qual está associado ao aumento das concentrações proteicas de IDE no fígado e no músculo esquelético (Kurauti, Freitas-Dias, et al., 2016). Além disso, também observamos o mesmo efeito do exercício físico agudo em camundongos obesos, ou seja, aumento do clearance de insulina, provavelmente, devido ao aumento da expressão e atividade da IDE, principalmente no músculo esquelético, demonstrando a importante função desse músculo na remoção e degradação de insulina durante o exercício físico (Kurauti, Costa-Júnior, et al., 2016). Entretanto, ainda não sabemos como o exercício físico modula a expressão e atividade da IDE.
Durante o exercício físico, o músculo secreta diversas moléculas sinalizadoras, chamadas miocinas (Pedersen e Febbraio, 2012). Dentre essas miocinas, a interleucina-6 (IL-6) é a que apresenta maiores concentrações plasmática após o exercício físico (Pedersen, 2000). A IL-6 é uma citocina pleiotrópica com diversas funções em diferentes tecidos
(Kishimoto, 2010). Inicialmente, essa citocina ficou conhecida por seus efeitos pró-inflamatórios prejudiciais à sensibilidade à insulina (Makino et al., 1998; Bastard et al., 2002). Mais tarde, foi descrito que a IL-6, secretada pelo músculo esquelético durante o exercício físico, induz um efeito anti-inflamatório (Starkie et al., 2003; Carey et al., 2006) capaz de melhorar a sensibilidade à insulina (Wunderlich et al., 2010). É interessante essa dupla função da IL-6, cujos mecanismos ainda não estão totalmente esclarecidos. Algumas evidências indicam que o efeito da IL-6 parece depender da concentração e duração da exposição a essa citocina. Longa duração e baixa concentração de IL-6, observadas na obesidade e DM2, estão relacionadas aos efeitos pró-inflamatórios deletérios, como por exemplo, a resistência à insulina (Klover et al., 2003). Por outro lado, curta duração e alta concentração de IL-6, como no exercício físico agudo, estão relacionadas aos efeitos anti-inflamatórios benéficos, como por exemplo, o aumento da captação de glicose pelo músculo esquelético (Carey et al., 2006).
Apesar de existirem inúmeros trabalhos demonstrando os efeitos da IL-6 não apenas sobre a sensibilidade à insulina, mas também sobre a secreção desse hormônio (Ellingsgaard et al., 2011; Suzuki et al., 2011), a função dessa citocina sobre o clearance e a degradação da insulina ainda não havia sido descrita. Um estudo prévio, realizado em nosso laboratório, demonstrou que uma citocina membro da família da IL-6, o fator neurotrófico ciliar (CNTF, do inglês “ciliary neurotrophic factor”), modula a expressão de IDE no fígado de camundongos diabéticos e em células hepáticas HEPG2 (Rezende et al., 2012). Portanto, pensamos que, assim como o CNTF, a IL-6 também poderia modular a expressão da IDE e que durante o exercício físico, esta seria a molécula mediadora do aumento, da expressão e atividade da IDE, bem como, do clearance de insulina.
2 OBJETIVOS
2.1 OBJETIVO GERAL
Investigar a função da IL-6 sobre a modulação da expressão e atividade da IDE, e, numa segunda fase, investigar se durante o exercício físico agudo esta citocina seria responsável pelo aumento, da expressão e atividade da IDE, e do cleanrance de insulina.
2.2 OBJETIVOS ESPECÍFICOS
Caracterizar a expressão e atividade da IDE, bem como o clearance de insulina em camundongos deficientes em IL-6;
Determinar se a modulação da expressão da IDE nos camundongos deficientes em IL-6 é um efeito direto dessa citocina;
Avaliar a expressão da IDE em células HEPG2 e C2C12 incubadas com IL-6; Investigar se o aumento da expressão e atividade da IDE, bem como do
clearance de insulina, durante o exercício físico agudo, é mediado pela IL-6 em camundongos;
Determinar a concentração de IL-6, expressão proteica e atividade da IDE em amostras de plasma de humanos, antes e após uma sessão de exercício físico e verificar se existe uma correlação entre esses parâmetros.
3 MATERIAIS E MÉTODOS
3.1 ANIMAIS
Camundongos C57BL/6 selvagens (wild type, WT) e deficientes para o gene da IL-6 (knockout, KO) com 4 meses de idade, procedentes do Centro de Criação de Camundongos Especiais da FMRP-USP (Faculdade de Medicina de Ribeirão Preto da Universidade de São Paulo), foram mantidos em período de claro/escuro (12h/12h) e temperatura (222ºC) controlados de acordo com os Princípios Éticos na Experimentação Animal da Sociedade Brasileira de Ciências em Animais de Laboratórios. Inicialmente, para avaliar se a IL-6 modula a expressão e atividade da IDE, foram utilizados os camundongos WT e KO. Em seguida, tratamos camundongos KO durante 3 dias com 200 ng/kg de IL-6 (KO+IL6), para investigar se a modulação da expressão da IDE nesses camundongos KO seria um efeito direto dessa citocina. Por fim, também estudamos a função da citocina na modulação da IDE durante o exercício físico agudo. Para isso, camundongos C57BL/6 selvagens, foram distribuídos em três diferentes grupos experimentais: grupo controle sedentário (CTL), grupo exercitado (EXE) e um grupo exercitado que recebeu a administração intraperitoneal de 2 mg/kg (Ueda et al., 2013) de tocilizumabe (um anticorpo que se liga ao receptor da IL-6, impedindo sua sinalização), 1 h antes da sessão de exercício físico agudo (EXE+TCZ). Todos os experimentos foram aprovados pela Comissão de Ética no Uso de Animais da Universidade Estadual de Campinas (UNICAMP) (protocolo nº 3087-1).
3.2 CONSUMO MÁXIMO DE OXIGÊNIO (VO2 MÁX)
Após uma semana de familiarização ao ergômetro, o consumo máximo de oxigênio dos camundongos foi avaliado. Para isso, foi utilizada uma esteira metabólica selada (Pan Lab/Harvad instruments, Barcelona, ES) com 25° de inclinação, acoplada ao sistema de respirometria Oxylet system (Pan Lab/Harvad instruments). Os valores do consumo de oxigênio foram coletados utilizando-se o software Metabolism® (Pan Lab/Harvad instruments), também acoplado ao sistema. Os animais caminharam por 5 min (tempo médio
necessário para a estabilização da concentração de oxigênio e calibração automática do equipamento) a 10 cm/s e o teste iniciou com uma velocidade de 15 cm/s sendo acrescentado mais 5 cm/s a cada min. O teste foi interrompido quando os animais passaram a se apoiar na base inferior da esteira, demonstrando exaustão física. Consideramos o valor de VO2 máx
quando a curva de consumo de oxigênio atingiu um platô, a despeito do aumento da velocidade da esteira, conforme protocolo descrito (Rezende et al., 2006).
3.3 PROTOCOLO DA SESSÃO DE EXERCÍCIO FÍSICO AGUDO
Dez dias após a realização da análise do VO2 máx, os camundongos dos
grupos EXE e EXE+TCZ foram submetido a uma única sessão de exercício físico com duração de 3 h e intensidade de 60 - 70 % do VO2 máx, em esteira rolante Gesan®, com
inclinação de 25°. Todas as mensurações feitas nesses camundongos foram executadas imediatamente após a sessão de exercício físico (Figura 2).
Figura 3. Protocolo experimental. Protocolo para o teste de tolerância à glicose (A), teste de tolerância à insulina (B) e coleta de órgãos para posteriores análises (C). Todos os experimentos foram realizados imediatamente após a sessão de exercício físico.
3.4 TESTE DE TOLERÂNCIA À GLICOSE INTRAPERITONEAL (IPGTT)
Para verificar a tolerância à glicose dos camundongos, foi realizado o ipGTT. Antes do procedimento experimental, os animais foram submetidos a um jejum com duração total de 10 h, ou seja, 7 h de jejum em repouso somado a 3 h de jejum em exercício (Figura 3A). A glicemia foi avaliada antes (tempo 0) e 15, 30, 60 e 120 min após
administração intraperitoneal de 1 g/kg de glicose. Amostras de sangue (tempo 0, 15 e 30 min) foram coletadas da cauda dos camundongos, colocadas em microtubos contendo o anticoagulante heparina e centrifugadas (1100g durante 15 min a 4ºC) para obtenção do plasma. Essas amostras de plasma foram mantidas em freezer (-80 ºC) para posterior dosagem de insulina e peptídeo-c.
3.5 TESTE DE TOLERÂNCIA À INSULINA INTRAPERITONEAL (IPITT)
Para verificar a tolerância à insulina, foi realizado o ipITT. Antes do procedimento experimental, os camundongos foram privados de alimento durante 3 h, tempo que corresponde à duração da sessão de exercício físico agudo (Figura 3B). A glicemia foi avaliada antes (tempo 0) e 5, 10, 15, 20, 25, 30 e 60 min após administração intraperitoneal de 0.75 U/kg de insulina.
3.6 CLEARANCE DE INSULINA
Para avaliação do clearance de insulina, durante o ipITT, amostras de plasma foram coletados antes (tempo 0) e 5, 15, 30 e 60 min após administração intraperitoneal de 0.75 U/kg de insulina. As concentrações de insulina foram, então, determinadas, e a área sob a curva (AUC, do inglês “area under the curve”) da insulinemia foi calculada.
3.7 AVALIAÇÃO DA INSULINA E PEPTÍDEO-C PLASMÁTICOS
As concentrações plasmáticas de peptídeo-c foram avaliadas utilizando o Kit comercial Rat/Mouse C-Peptide 2 ELISA (Cat. EZRMCP2-21K, EMD Millipore, Billerica, MA, EUA) de acordo com as recomendações do fabricante. A insulina plasmática foi medida através da técnica de radioimunoensaio (Berson e Yalow, 1968).
3.8 COLETA DE TECIDOS
Os camundongos foram mortos por saturação de CO2 seguida por
decapitação e amostras de fígado e músculo esquelético gastrocnêmio foram coletadas, congeladas e mantidas em freezer (-80 ºC) para posteriores análises. Também retiramos os pâncreas desses camundongos para isolamento das ilhotas pancreáticas utilizando colagenase específica, como descrito anteriormente (Boschero et al., 1995).
3.9 SECREÇÃO DE INSULINA ESTIMULADA POR GLICOSE
As ilhotas pancreáticas isoladas foram pré-incubadas em solução de Krebs contendo 5,6 mM de glicose por 1 h a 37°C. Após, as ilhotas foram incubadas com solução de Krebs contendo diferentes concentrações de glicose (2.8, 5.6, 11.2 ou 22.4 mM) por 1 h a 37°C. Amostras do sobrenadante foram coletadas para posterior dosagem de insulina utilizando a técnica de radioimunoensaio (Berson e Yalow, 1968). Ao final, todas as ilhotas foram homogeneizadas em solução álcool/ácido para posterior dosagem do conteúdo total de insulina.
3.10 SINALIZAÇÃO DA INSULINA NO MÚSCULO ESQUELÉTICO
Para avaliar a sinalização da insulina no músculo esquelético, foi administrado 100 μl (10 U) de insulina humana regular (Humulin®R, Eli Lilly, Sao Paulo, Brazil), via intraperitoneal, nos camundongos dos grupos WT e KO. Parte dos camundongos do grupo WT, ao invés de insulina, receberam 100 μl de salina, como previamente descrito (Ribeiro et al., 2012). Após 10 min da administração de insulina ou salina, os animais foram mortos e tiveram o músculo gastrocnêmio coletados como descrito acima. Para análise da expressão de Akt fosforilada (p-Akt), proteína da via de sinalização da insulina, foi utilizada a técnica de Western blot, descrita adiante.
3.11 RT-PCR EM TEMPO REAL
Fragmentos de fígado e músculo foram homogeinizados em 1 ml de reagente TRIzol® (Cat. 15596026, Invitrogen™, Thermo Fisher Scientific Inc, Waltham, MA, EUA) e o mRNA total foi extraído de acordo com as instruções do fabricante. O mRNA total obtido foi dissolvido em água previamente tratada com dietil pirocarbonato (DEPC) e a quantificação do mesmo foi realizada através de leituras de absorbâncias em comprimentos de ondas de 260 e 280 nm no espectrofotômetro NanoVue Plus (GE Healthcare Life Sciences, Pittsburgh, PA, EUA). Após estes procedimentos, 1 μg do RNA extraído foi usado para preparar o cDNA utilizando o kit comercial High-Capacity cDNA Reverse Transcription (Cat. 4368814, Applied Biosystems™, Thermo Fisher Scientific Inc, Waltham, MA, EUA). A PCR em tempo real foi realizada no aparelho 7500 Fast Real-time PCR System (Applied Biosystems™) usando o reagente Fast SYBR® Green Master Mix (Cat. 4385612, Applied Biosystems™) e os primers sense e antisense descritos na Tabela 1. Os dados da expressão gênica foram analisados utilizando o programa 7500 version 2.0.5 (Applied Biosystems™).
Tabela 1. Sequência dos primes utilizados na PCR em tempo real
Gene Sequência (5’ -> 3’) ide Fw CTGTGCCCCTTGTTTGATGC Rv GTTCCCCGTAGCCTTTTCCA il6 Fw CACGGCCTTCCCTACTTCAC Rv GGTCTGTTGGGAGTGGTATC gapdh Fw GGTCTGTTGGGAGTGGTATC Rv GCCCCACGGCCATCACGCCA Fw, foward sequence (sense); Rv, reverse sequence (antisense)
3.12 WESTERN BLOT
Fragmentos de tecidos (fígado e músculo gastrocnêmio) foram homogeneizados em tampão contendo 10 mM de EDTA, 100 mM de Tris base, 100 mM de pirofosfato de sódio, 100 mM de fluoreto de sódio, 10 mM de ortovonadato de sódio, 2 mM de fluoreto de Fenilmetilsulfonil, 1% (vol/vol) de Triton X-100 e 1 μg/ml de aprotinina. Após, os extratos foram centrifugados (12000 g durante 20 min a 4°C) para remoção do material insolúvel. As proteínas contidas nos extratos foram dosadas através do método de Bradford (Bradford, 1976), tendo como base uma curva padrão de albumina. As amostras foram tratadas com tampão Laemmli e aquecidas a 100 ºC por 5 min. Alíquotas com concentrações proteicas semelhantes foram aplicadas em gel de poliacrilamida (Tris acrilamida 10%), no aparato de eletroforese (Mini-PROTEAN®, Bio-Rad, Hercules, CA, EUA), em paralelo com marcadores de pesos moleculares conhecidos. Após corrida eletroforética, as proteínas foram transferidas para membrana de nitrocelulose. Esta foi incubada por 1 h em solução bloqueadora para diminuir a ligação inespecífica das proteínas. As membranas foram então incubadas com anticorpos primários específicos para as diferentes proteínas (anti-p-AKT ser473, Santa Cruz Biotechnology sc-7985; anti-IDE, Abcam ab32216; anti-GAPDH, Sigma G9545) de um dia para o outro. Após este procedimento, as membranas foram incubadas com anticorpo secundário adequado, por 2 h. Finalmente, as membranas foram reveladas por quimiluminescência utilizando o reagente SuperSignal West Fento (Pierce Biotechnology Inc., Rockford, IL, EUA). A intensidade das bandas foram medidas e quantificadas utilizando o programa ImageJ (National Institutes of Health, Maryland, EUA), sendo os valores das bandas normalizados pelos valores do controle interno GAPDH.
3.13 CULTURA DE CÉLULAS HEPG2 E C2C12
Células de linhagem muscular esquelética, C2C12, foram mantidas em meio DMEM (11 mM de glicose e 2% de soro equino) por 5 dias para diferenciação de miócitos a miotubos. Após este período, as células foram tratadas com diferentes concentrações de IL-6 (0, 10, 50 e 100 ng/ml) durante 3 h. Células de linhagem hepáticas, HepG2, foram mantidas em cultura por 3 dias em meio DMEM (10 mM de glicose, 1% de penicilina e 5% de soro
fetal bovino). Após este período, assim como as células C2C12, as células HepG2 foram tratadas com diferentes concentrações de IL-6 descritas acima. Após este tratamento, ambas, C2C12 e HepG2, foram coletadas em solução de Tripsina/EDTA, lavadas com PBS e homogeneizadas usando um tampão anti-protease/anti-fosfatase para subsequente analise da expressão proteica de IDE, através da técnica de Western blot descrita acima.
3.14 COLETA DAS AMOSTRAS DE PLASMA HUMANO
As amostras de plasma humano foram obtidas a partir de um estudo anterior, realizado na Faculdade de Educação Física da UNICAMP (Conceição et al., 2016). Os voluntários desse estudo foram indivíduos do sexo masculino, jovens (idade de 22.4 ± 3 anos) e saudáveis (peso corpóreo de 73.5 ± 9.7 kg e altura de 1.79 ± 0.05 m). Todos os procedimentos experimentais foram explicados aos voluntários, os quais forneceram o termo de consentimento por escrito antes do início do estudo. Todos os procedimentos realizados foram aprovados pelo Comitê de ética local (protocolo nº 848.145) e conduzidos de acordo com a última versão da Declaração de Helsinki. O protocolo de exercício físico agudo aplicado a estes indivíduos foi realizado em ciclo ergômetro durante 30 min a uma intensidade de 70% do VO2 pico. As amostras de sangue foram coletadas antes (grupo
PRE-EXE) e 3 h após a sessão de exercício físico agudo (grupo POST-PRE-EXE). O plasma foi obtido através de centrifugação e estocado em freezer (-80 ºC) para posterior avaliação da concentração de IL-6 e expressão proteica e atividade da IDE.
3.15 ATIVIDADE DA IDE
A atividade da IDE foi avaliada utilizando o kit comercial SensoLyte® 520 IDE Activity (Cat. AS-72231, AnaSpec, Fremont, CA). Amostras de células (HepG2 e C2C12), tecidos (fígado e músculo) e plasma foram homogeneizadas em tampão proveniente do kit comercial e, em seguida, centrifugadas a 10000 g, 4ºC por 15 min para remoção do material insolúvel. O ensaio de atividade da IDE foi realizado de acordo com as recomendações do fabricante. Ao final, a atividade total da enzima foi calculada, como descrito anteriormente (Kurauti, Costa-Júnior, et al., 2016), utilizando a seguinte equação:
IDE A1 A0 T D
Onde: A1 é a concentração do produto da reação (5-FAM) em 60 min e A0 em 0 min, T é o tempo total do ensaio; V é o volume das amostras, e D é a diluição das amostras. Tanto a concentração do 5-FAM, como a atividade total da IDE foram normalizadas pelo conteúdo total de proteínas das amostras, as quais foram medidas utilizando o método de Bradford (Bradford, 1976).
3.16 AVALIAÇÃO DA IL-6 PLASMÁTICA
As concentrações plasmática de IL-6 dos camundongos e humanos foram determinadas utilizando os kits comerciais Mouse IL-6 ELISA Ready-SET-Go (Cat. 88-7064-22, eBioscience, CA, EUA) e Human IL-6 Quantikine® ELISA (Cat. D6050, R&D Systems, Minneapolis, MN, EUA), respectivamente, seguindo as orientações dos fabricantes.
3.17 ANÁLISE ESTATÍSTICA
A distribuição normal (teste de Shapiro-Wilk) e a homogeneidade das variâncias (teste F e teste de Bartlett) foram analisadas e testes estatísticos apropriados (teste t de Student ou ANOVA One-Way seguida pelo teste post-hoc de Tukey) foram empregados para análise dos resultados. Os dados foram expressos como média erro padrão da média (EPM) e o nível de significância adotado foi de 5% (p<0,05). O coeficiente de correlação de Pearson foi determinado para avaliar a correlação entre a concentração de IL-6 e a expressão ou atividade da IDE no plasma dos voluntários. Todas as análises foram realizadas utilizando o programa GraphPad Prism versão 5.00 para Windows (GraphPad Software, San Diego, California, EUA, www.graphpad.com).
4 RESULTADOS E DISCUSSÃO
Os resultados e a discussão do trabalho serão apresentados no artigo anexado a seguir.
4.1 ARTIGO
Interleukin-6 increases the expression and activity of insulin-degrading enzyme
Mirian A. Kurauti1*, José M. Costa-Júnior1, Sandra M. Ferreira1, Gustavo J. Santos1,2, Carlos H. G. Sponton1, Everardo M. Carneiro1, Guilherme D. Telles3, Mara P. T. Chacon-Mikahil3, Cláudia R. Cavaglieri3, Luiz F. Rezende1,4, Antonio C. Boschero1
1
Obesity and Comorbidities Research Center (OCRC), Institute of Biology, University of Campinas (UNICAMP), Campinas, SP, Brazil
2
Department of Physiological Sciences, Center of Biological Sciences, Federal University of Santa Catarina (UFSC), Florianopolis, SC, Brazil
3
Exercise Physiology Laboratory (FISEX), Faculty of Physical Education, University of Campinas (UNICAMP), Campinas, SP, Brazil
4
Laboratory of Health Sciences, Department of Physiopathology, State University of Montes Claros (UNIMONTES), Montes Claros, MG, Brazil
*Corresponding author: Obesity and Comorbidities Research Center (OCRC), Institute of
Biology, University of Campinas (UNICAMP). Rua Carl Von Linnaeus, Bloco Z, zip code 13083864, Campinas, SP, Brazil. Phone number: +55 19 35210015. E-mail: [email protected]
Abstract
Impairment of the insulin-degrading enzyme (IDE) is associated with obesity and type 2 diabetes mellitus (T2DM). Here, we used 4-mo-old male C57BL/6 interleukin-6 (IL-6) knockout mice (KO) to investigate the role of this cytokine on IDE expression and activity. IL-6 KO mice displayed lower insulin clearance in the liver and skeletal muscle, compared with wild type (WT), due to reduced IDE expression and activity. We also observed that after 3-h incubation, IL-6, 50 and 100 ng ml-1, increased the expression of IDE in HEPG2 and C2C12 cells, respectively. In addition, during acute exercise, the inhibition of IL-6 prevented an increase in insulin clearance and IDE expression and activity, mainly in the skeletal muscle. Finally, IL-6 and IDE concentrations were significantly increased in plasma from humans, after an acute exercise, compared to pre-exercise values. Although the increase in plasma IDE activity was only marginal, a positive correlation between IL-6 and IDE activity, and between IL-6 and IDE protein expression, was observed. Our outcomes indicate a novel function of IL-6 on the insulin metabolism expanding the possibilities for new potential therapeutic strategies, focused on insulin degradation, for the treatment and/or prevention of diseases related to hyperinsulinemia, such as obesity and T2DM.
Introduction
Interleukin-6 (IL-6) is a pleiotropic cytokine with several functions in different tissues
1
. Initially, IL-6 was described as an important factor of the immune system 2. However, it has been shown that this cytokine also plays an important role in metabolic regulation 3, especially on glucose homeostasis 4.
Insulin is one of the most important hormones in glucose homeostasis, and its action depends on its secretion, the sensitivity of target tissues, and clearance. There are several studies regarding the effects of IL-6 on insulin sensitivity 5,6 and secretion 7,8; however, studies concerning its function on insulin clearance are scarce.
Insulin clearance occurs mainly in the liver, primarily by the action of insulin-degrading enzyme (IDE) 9. This enzyme, a 110 kDa zinc-metalloprotease, was initially identified as an insulin degrading enzyme 10. Subsequently, it was found that IDE also degrades other amyloidogenic peptides, such as amyloid β 11
. Impairment of IDE are closely related to the development of diseases, such as type 2 diabetes mellitus (T2DM) 12,13 and Alzheimer’s disease (AD) 14
. Also, it is proposed that IDE malfunction could be the link between these two pathologies 15.
Selective modulators of IDE activity could work as potential drugs for treatment of T2DM and AD 16. While IDE activators have been proposed as AD therapies 17, it is uncertain if activation of this enzyme would be the better therapeutic approach for T2DM. To the contrary, treatment with IDE inhibitors seems to potentiate insulin signaling 18 and a fast and short pre-meal IDE inhibition could be useful for T2DM therapy 19. However, despite increasing insulin signaling, acute IDE inhibition impaired glucose tolerance in mice, casting a shadow on the usefulness of the IDE inhibition for the treatment of T2DM 20. Interestingly, IDE knockout (KO) mice display chronic hyperinsulinemia 21 that, over time, induces a reduction of insulin receptor expression, leading to insulin resistance 22. Also, downregulation of IDE, associated with hyperinsulinemia, is observed in obese and diabetic patients 23,24, and rodents 13,25. Therefore, we believe that finding molecules which are able to increase IDE function could be important for the development of new therapeutic strategies against diseases related to hyperinsulinemia, such as obesity and T2DM.
Some interventions 25-27 and molecules 28,29 can modulate the expression and activity of IDE. In this way, physical exercise increases IDE expression in the liver and skeletal muscle of rodents 30, and this could explain the augmentation of insulin clearance observed in these rodents and humans 31. It is also known that the ciliary neurotrophic factor (CNTF), a
member of the IL-6 family of cytokines, can also modulate insulin clearance and IDE expression in the liver of Swiss mice and in HEPG2 cells 32. Thus, we hypothesized that IL-6 likewise could have an effect on insulin degradation.
Here, we demonstrate that IL-6 deficient mice displayed reduced insulin clearance, probably due to lower IDE action in the liver and skeletal muscle. In addition, IL-6 incubation increased the expression of IDE in HEPG2 and C2C12 cells. We also found that, during acute endurance exercise, IL-6 mediated the increase of IDE expression and activity, mainly in the skeletal muscle, increasing insulin clearance, a phenomenon that may also occur in humans.
Results
IL-6 KO mice displayed altered metabolic parameters
KO mice showed a significant reduction of IL-6 content in plasma, liver, and skeletal muscle, confirming the deficiency of this cytokine in these mice (Suppl Figure 1). KO mice also displayed a reduction in the body and skeletal muscle weight, despite an augmented adiposity, compared with wild type (WT) mice. In addition, a decreased insulinemia and increased glycemia was observed in the KO group (Table 1).
IL-6 KO mice had impaired glucose, but not insulin, tolerance
IL-6 plays an important role on glucose metabolism 4,33. Here, we observed an impaired glucose tolerance in KO mice (Figure 1A and B), without a change in insulin tolerance (Figure 1C and D), compared with WT mice. In addition, the Akt phosphorylation in the liver and skeletal muscle (Figure 1E and F) was similar between KO and WT groups.
IL-6 KO mice displayed decrease of insulin secretion and clearance
During the ipGTT, KO mice displayed decreased plasma C-peptide concentration (Figure 1G and H), indicating impairment of insulin secretion. This observation was confirmed by a significant reduction in glucose-stimulated insulin secretion in isolated pancreatic islets from KO mice (Figure 1M). Interestingly, the insulinemia was not reduced at the same extent than plasma C-peptide, during the ipGTT (Figure 1I and J). Thus, the C-peptide/insulin ratio was reduced in the KO mice (Figure 1K and L), indicating that insulin clearance was also decreased. A higher concentration of insulin was registered at 60 min of the ipITT, in the KO mice (Figure 1O), indicating a reduction of insulin clearance in these mice, although no
significantly difference was observed in the area under curve (AUC) of plasma insulin between groups (Figure 1P).
IL-6 KO mice had reduced IDE expression and activity in the liver and skeletal muscle
IDE is the main enzyme responsible for insulin degradation 9. Corroborating the reduced insulin clearance in the KO mice, IDE gene expression (Figure 2A and B), protein content (Figure 2C and D), and activity (Figure 2E-H) were decreased in the liver and skeletal muscle, compared with WT mice.
IL-6 increased IDE expression in HEPG2 and C2C12 cells
In the following set of experiments, HEPG2 and C2C12 cells were incubated, for 3-h, at different concentrations of IL-6. The IDE protein content was significantly increased in HEPG2 and C2C12 cells, at 50 and 100 ng ml-1 IL-6, respectively (Figure 3A and B).
IL-6 inhibition impaired the increase on insulin clearance in mice, after an acute endurance exercise
Since a substantial amount of IL-6 is released in the plasma during skeletal muscle contractions (Supple Figure 2), we investigated the role of this cytokine on insulin clearance, after acute exercise. During ipITT, we observed that inhibition of IL-6 increased insulin tolerance in EXE+TCZ (exercised mice treated with tocilizumab, a pharmacological IL-6 receptor neutralizing antibody), and this increase was bigger than in the exercised (EXE) mice, as judged by the AUC of blood glucose (Figure 4A and B). Interestingly, the higher insulin tolerance was accompanied by higher levels of plasma insulin during the ipITT, indicating a lower insulin clearance in the EXE+TCZ mice, compared with EXE mice (Figure 4C and D).
IL-6 inhibition impaired IDE expression and activity in the skeletal muscle of mice, after an acute endurance exercise
We also evaluated the IDE expression and activity in exercised mice, treated with an IL-6 inhibitor. Corroborating the insulin clearance data, a single bout of exercise increased IDE gene expression in the liver and skeletal muscle (Figure 5A and 5B), but IDE protein expression increased only in the skeletal muscle of EXE mice, compared with CTL mice (Figure 5C and 5D). No alteration was found in IDE activity, after acute exercise (Figure
5E-5H). Interestingly, IL-6 inhibition prevents an increase in the expression of the IDE gene in liver and skeletal muscle (Figure 5A and 5B), and IDE protein expression only in the skeletal muscle (Figure 5C and 5D). We also observed reduced IDE activity in the skeletal muscle of EXE+TCZ mice, compared with EXE mice (Figure 5F and H).
IL-6 was positively correlated with IDE protein expression and activity in the plasma of humans subjects, after an acute endurance exercise
Finally, we measured IL-6 concentration, IDE protein expression and activity in the plasma of human subjects, before and after acute exercise. Plasma IL-6 and IDE concentrations were significantly increased post-exercise, compared with pre-exercise group (Figure 6A and B), and a positive correlation between these two plasmatic parameters was confirmed (Figure 6E). Although the increase of IDE activity, in the post-exercise group, was not statistically significant compared with pre-exercise (Figure 6C and D), this plasmatic parameter was also positively correlated with IL-6 concentration (Figure 6F).
Discussion
Impaired IDE expression and/or activity are closely related to diseases associated with hyperinsulinemia, such as obesity and T2DM 12. Therefore, increasing the function of IDE could be a strategy for the treatment of these pathologies. Here, we found that exposure to IL-6 increased IDE protein expression in HEPG2 and C2C12 cells. We also observed that L-IL-6 KO mice displayed reduced insulin clearance, probably due to lower IDE function in the liver and skeletal muscle. Finally, we demonstrated that during acute exercise, IL-6 release seems to be necessary to increase IDE expression and activity, mainly in the skeletal muscle of mice, an effect that likely occurs also in humans.
IL-6 is an interesting cytokine with a dual effect on glucose homeostasis. Initially, it was thought that this cytokine has deleterious effects on glucose homeostasis by impairing the insulin signaling, leading to insulin resistance 6. Later, it was found that the loss of IL-6, not only failed to protect against these deleterious effects, but also induced glucose intolerance leading to development of mature-onset obesity 34. These data show that IL-6 is important for the maintenance of normal carbohydrate and lipid metabolism. Indeed, here, 4-mo-old IL-6 KO mice developed glucose intolerance (Figure 1A and B) and increased fat pad weight (Table 1), although impairment in insulin signaling and overweight were not observed. These last alterations were registered in older (9-mo-old) IL-6 deficient mice 34. Although young
IL-6 KO mice do not have impaired insulin sensitivity (Figure 1C and D), they display reduced glucose-stimulated insulin secretion (Figure 1M), which could explain the glucose intolerance during ipGTT. These data suggest that the impairment of insulin secretion and/or clearance precede the onset of insulin resistance in IL-6 KO mice.
The role of IL-6 on insulin secretion has been extensively studied, and there is substantial evidence that this cytokine increases insulin secretion 7,8, and this increase seems to depend on the activation of the phospholipase C (PLC) - inositol triphosphate (IP3)
dependent pathway 8. However, further investigation demonstrated that IL-6 enhances insulin release also by increasing the glucagon-like peptide 1 (GLP-1) secretion from L cells and pancreatic α cells 7
.
While several studies have investigated the function of IL-6 on insulin secretion, its participation on insulin clearance was neglected. Here, we provide evidence that IL-6 must be essential to enhance insulin clearance probably by increasing IDE expression and activity in the liver and skeletal muscle. These are opposite effects from those reported for CNTF, a member of the IL-6 family of cytokines 32. Although these two cytokines act through activation of glycoprotein 130 (gp 130), there are some peculiarities in their receptors 35 that could explain these different effects on insulin clearance and IDE expression.
It is known that increase of adiposity is associated with decrease of IDE expression and insulin clearance, as observed in obesity 25,36. Here, we show that IL-6 KO mice had an increased fat pad weight which could explain the reduced IDE expression and activity in these mice. However, to prove that this IDE modulation is an effect of IL-6 loss, we treated this KO mice with 200 ng IL-6 during 3 days before the experiments. Interestingly, IL-6 treatment restored IDE gene expression of KO mice, without any alteration in the fat pad weight (see Supple figure 3). These data, associated with the results from in vitro experiments, confirm the important role of IL-6 on IDE modulation.
During physical exercise, muscle contractions release and increase the concentration of IL-6 in the bloodstream, and this myokine 37 modulates glucose homeostasis. Previous data suggest that the primary function of IL-6 during exercise is to maintain glucose turnover 4. At the same time that IL-6 favors insulin to stimulate glucose uptake by the skeletal muscle 38, it increases glucose production in the liver 39 to sustain the high demand for glucose by the former tissue. Although controversial 40, it has been reported that, during exercise, this myokine could improve insulin sensitivity 41. However IL-6 has been found to increase insulin secretion after exercise 7 whereas a reduction in plasma insulin was observed 42. Here we proposed that IL-6 could also increase insulin clearance and IDE expression, induced by
exercise, as reported 30. Interestingly, we confirmed our hypothesis showing that inhibition of IL-6 signaling during acute endurance exercise blocks the augmentation of insulin clearance and IDE expression, mainly in the skeletal muscle. This phenomenon seems to be important to avoid a hazardous decrease of glycemia during exercise, making it more effective and safe. Physical exercise is one of the first clinical approaches to prevent and treat metabolic diseases, such as obesity and T2DM. However, adherence to physical activity by obese and diabetic patients is very low 43. Thus, finding alternatives for physical exercise would be useful for the prevention and treatment of these diseases. In this scenario, IL-6 has been suggested as a promising candidate 44. Here, we found that, as in mice, IL-6 seemed to have the same effects on insulin clearance in humans after acute endurance exercise, since the concentration of this myokine positively correlated with IDE expression in the plasma of these subjects. Although considering IL-6 as a promising alternative to physical exercise, treatment with this cytokine may be not recommended due to its dual effects on glucose metabolism. Thus, find the mechanism activated by IL-6 during exercise, could help us to develope a safer exercise mimetic.
IL-6 may act on its target cells by canonical and non-canonical pathways. The canonical pathway is well-established and comprises the activation of the signal transducer and activator of transcription 3 (STAT3), which, in the nucleus, enhances the transcription of several genes 45,46. The non-canonical pathway refers to the activation of the 5'-adenosine monophosphate-activated protein kinase (AMPK). Even though the non-canonical pathway remains poorly understood, it was reported that IL-6 directly activates AMPK through increasing cyclic adenosine monophosphate (cAMP) and AMP/ATP ratio in skeletal muscle of rats 47. Since IL-6 KO mice show reduced activation of AMPK 48, we speculate that this non-canonical pathway could be the mechanism whereby IL-6 increases IDE expression. Moreover, we previously demonstrated that the treatment with 5-aminoimidazole-4-carboxamide ribonucleotide (AICAR) increased IDE expression in C2C12 cells 30, corroborating our hypothesis. However, this data does not exclude the possible role of STAT3 on IDE expression. Therefore, further investigations are necessary to clarify this matter.
In summary, here we described a novel function of IL-6 on glucose homeostasis, which consists of increase insulin clearance, probably due to augmentation of IDE expression and activity in the liver and skeletal muscle. In addition, we demonstrated that, after acute endurance exercise, IL-6 mediated the increase of IDE, mainly in the skeletal muscle of mice, an effect that seems to occur also in humans. Our findings expand the possibilities for new potential therapeutic strategies, focused on insulin degradation, that could be used in the
treatment and/or prevention of diseases related to hyperinsulinemia, such as obesity and T2DM.
Methods Animals
The 4-mo-old males C57BL/6 wild type (WT) and IL-6 knockout (KO) mice were maintained on a 12-h light/12-h dark cycle with controlled temperature and humidity during the entire experiment. All mice were allowed to feed (standard chow diet) and drink tap water ad libitum. After the experiments using WT and KO mice, other males C57BL/6 WT mice were distributed into three different groups: control (CTL), exercised (EXE) and exercised mice treated with 2 mg kg-1 tocilizumab (a pharmacological IL-6 receptor neutralizing antibody) 1-h before t1-he exercise protocol (EXE+TCZ).
Maximum oxygen consumption (VO2 max) and acute endurance exercise protocol in
mice
Before the acute exercise protocol, we measured the VO2 max in all mice from the CTL, EXE
and EXE+TCZ groups, as described before 30. After 10 days, mice from EXE and EXE+TCZ groups were submitted to a single bout of exercise on a treadmill inclined at 25° for 3-h at 60-70% of VO2 max. All measurements made in these mice were performed immediately after
the acute exercise.
Intraperitoneal glucose and insulin tolerance tests (ipGTT and ipITT)
The ipGTT and ipITT was performed as previously described 27. The blood glucose concentration was measured by tail bleed using glucose strips on Accu-Chek Performa II glucometer (Roche, Sao Paulo, Brazil). During the ipGTT, blood samples were collected from the tail before (0 min) and 15 and 30 min after glucose administration. The plasma samples was obtained by centrifugation (1100g for 15 min at 4ºC) and was stored at -80ºC for posterior insulin and C-peptide quantification.
In vivo insulin clearance test
During the ipITT, blood samples were collected before (0 min) and 15, 30 and 60 min after insulin administration to determine the plasma insulin concentrations 25.
Plasma C-peptide and insulin concentration
Plasma C-peptide was measured by Rat/Mouse C-Peptide 2 ELISA Kit (Cat. EZRMCP2-21K, EMD Millipore), following the manufacturer's instructions, and plasma insulin concentration was determined by radioimmunoassay (RIA), as described 49.
Tissue samples
The mice were killed in a CO2-saturated chamber followed by beheading. Liver and
gastrocnemius skeletal muscle samples from the mice were collected, snap-frozen in liquid nitrogen, and stored at -80°C for subsequent experiments (RT-PCR Real time, Western blot and IDE activity).The pancreatic islets isolation was performed as previously described 50.
Glucose-stimulated insulin secretion in pancreatic islets
The islets were pre-incubated for 1-h in Krebs-Henseleit buffer solution (KHBS) containing 0.5 g l-1 bovine serum albumin (BSA) and 5.6 mmol l-1 glucose (95% O2, 5% CO2, pH 7.4,
37ºC). Subsequently, we incubate five islets per well for an additional hour in the KHBS containing 2.8, 5.6, 11.2 or 22.4 mmol l-1 glucose. The supernatant was collected to evaluate the insulin secretion, and the islets were homogenized in an alcohol/acid solution to measure the total insulin content by RIA.
Real time RT- PCR
Tissues samples of liver and skeletal muscle was homogenized in 1 ml TRIzol® Reagent (Cat. 15596026, Invitrogen™, Thermo Fisher Scientific Inc, Waltham, MA, USA), and the total mRNA was extracted following the manufacturer's instructions. To prepare the cDNA, we used 1 μg of total mRNA and High-Capacity cDNA Reverse Transcription Kit (Cat. 4368814, Applied Biosystems™, Thermo Fisher Scientific Inc, Waltham, MA, USA). Real time PCR was performed on 7500 Fast Real-time PCR System (Applied Biosystems™) using Fast SYBR® Green Master Mix (Cat. 4385612, Applied Biosystems™). Mice IL-6 and IDE gene expression was measured and GAPDH was used as housekeeping gene (IL-6 forward 5'- CACGGCCTTCCCTACTTCAC-3' and reverse 5'- GGTCTGTTGGGAGTGGTATC-3'; IDE forward 5'- CTGTGCCCCTTGTTTGATGC-3' and reverse 5'- GTTCCCCGTAGCCTTTTCCA-3'; GAPDH forward 5'- CCTGCACCACCAACTGCTTA-3' and reverse 5'- GCCCCACGGCCATCACGCCA-3'). Real-time PCR data were analyzed using the 7500 Software version 2.0.5 (Applied Biosystems™).
Western Blot
For protein extraction, tissue samples of liver and skeletal muscle, were homogenized in a lysis buffer containing 10 mmol l-1
EDTA, 100 mmol l-1 Tris base, 100 mmol l-1 sodium pyrophosphate, 100 mmol l-1 sodium fluoride, 10 mmol l-1 sodium orthovanadate, 2 mmol l-1 Phenylmethylsulfonyl fluoride, 1% Triton X-100 and 1 μg ml-1 aprotinin. Protein concentration of the samples was determined using Bradford reagent (Cat. 500-0006N, BioAgency Biotecnologia, São Paulo, Brazil). After, 30 μg protein samples were homogenized and boiled (5 min at 100ºC) in a Laemmli buffer, applied on 10% SDS-PAGE (sodium dodecyl sulfate polyacrylamide gel electrophoresis), and transferred to nitrocellulose membranes.These membranes were blocked in a Tris-buffered saline (10 mmol l-1 Tris base, 150 mmol l-1 NaCl and 0.25% (vol./vol.) of Tween 20) containing 5% (wt./vol.) BSA for 1-h at room temperature. After, the membranes were incubated overnight at 4°C with primary antibodies (anti-phospho-Aktser473, Santa Cruz Biotechnology cat. sc-7985; anti-IDE, Abcam cat. ab32216; anti-GAPDH, Sigma cat. G9545). Bands detection was performed by chemiluminescence (SuperSignal West Fento, Pierce Biotechnology Inc., Rockford, IL, USA) after incubation with an appropriated horseradish peroxidase-conjugated secondary antibody, and the bands were visualized using theAmersham Imager 600 (GE Healthcare Life Sciences, Pittsburgh, PA, USA). Band intensities were analyzed using ImageJ software (National Institutes of Health, Maryland, USA).
HEPG2 and C2C12 cells culture
HEPG2 (a human liver carcinoma cell line) and C2C12 (a mouse myoblast cell line) cells were culture as described before 30. For the differentiation of C2C12 cells, we used DMEM high glucose containing 2% (vol./vol.) horse serum, and we culture it in this medium for 5 days. HEPG2 and differentiated C2C12 cells were incubated at 0, 10, 50 or 100 ng ml-1 IL-6 (Cat. PMC0061, Gibco™, Thermo Fisher Scientific Inc, Waltham, MA, USA) for 3-h. The cells were collected in trypsin/EDTA solution, washed with phosphate-buffered saline (PBS), and then homogenized in a urea anti-protease/anti-phosphatase buffer, for subsequent analysis of IDEprotein expression.
Plasma samples of human subjects
Plasma samples of human subjects were obtained from a previous study, and for all detailed information about this subjects (untrained healthy male) and experimental procedures, see
reference 51.The exercise protocol comprise a standardized warm-up period following by 30-min of cycling, at 70% of VO2peak. Blood samples were collected before (PRE-EXE) and 3-h
after (POST-EXE) the exercise session for posterior analysis of IL-6 concentration, IDE protein expression and activity.
IDE activity assay
IDE activity, from tissues and plasma samples, was measured by SensoLyte® 520 IDE Activity Assay Kit (Cat. AS-72231, AnaSpec, Fremont, CA, USA), following the manufacturer's recommendations. The total IDE activity was calculated as previously described 27, using this equation:
IDE activity A1 A0 T D
A1 is the concentration of 5-FAM at 60 min and A0 at 0 min; T is the total time of the assay (60 min); V is the volume of samples, and D is the dilution. The 5-carboxyfluorescein (5-FAM, the product of the enzyme reaction) concentration and the total IDE activity were normalized per μg of total protein, which was determined using Bradford reagent.
Quantification of plasma IL-6 concentration
Plasma IL-6 concentrations were measured using Mouse IL-6 ELISA Kit (Cat. EZMIL6, Merck Millipore, Darmstadt, Germany) and Human IL-6 Quantikine® ELISA Kit (Cat. D6050, R&D Systems, Minneapolis, MN, USA), according to the manufacturer's instructions.
Statistics
For the statistical analysis of two groups we used the Student’s t-test and for three or more groups, we performed the one-way ANOVA using the unpaired Tukey's post-hoc test. The data are presented as the mean ± standard error mean (SEM) and all data were considered significantly different if p ≤ 0.05. The Pearson product moment correlation coefficient (r) was determined to examine the relationship between IL-6 concentration and IDE protein expression or activity in the plasma of human subjects.