UNIVERSIDADE ESTADUAL DE CAMPINAS
INSTITUTO DE BIOLOGIA
Ana Flávia Alves Versiane
Phylogenetic Studies in Microlicia D.Don (Melastomataceae, Microlicieae)
Estudos filogenéticos em Microlicia D.Don (Melastomataceae, Microlicieae)
Campinas 2019
Ana Flávia Alves Versiane
Phylogenetic Studies in Microlicia D.Don (Melastomataceae, Microlicieae))
Estudos filogenéticos em Microlicia D.Don (Melastomataceae, Microlicieae
Thesis presented to the Institute of Biology of the University of Campinas in partial fulfillment of the requirements for the degree of Doctor, in the area of Plant Biology
Tese apresentada ao Instituto de Biologia da Universidade Estadual de Campinas como parte dos requisitos exigidos para a obtenção do título de Doutora em Biologia Vegetal
Orientado: Prof. Dr. Renato Goldenberg Coorientadora: Profa. Dra. Rosana Romero
ESTE TRABALHO CORRESPONDE À VERSÃO FINAL DA TESE DEFENDIDA PELA ALUNA ANA FLÁVIA ALVES VERSIANE, E ORIENTADA PELO PROF. DR. RENATO GOLDENBERG.
Campinas 2019
Campinas, 02 de dezembro de 2019
COMISSÃO EXAMINADORA
Prof. Dr. Renato Goldenberg
Dra. Thais Nogales da Costa Vasconcelos Dra. Maria José Reis da Rocha
Dra. Bárbara Simões Santos Leal Prof. Dr. André Olmos Simões
Os membros da Comissão Examinadora acima assinaram a Ata de defesa, que se encontra no processo de vida acadêmica do aluno.
A Ata da defesa com as respectivas assinaturas dos membros encontra-se no SIGA/Sistema de Fluxo de Dissertação/Tese e na Secretaria do Programa de Pós-Graduação em Biologia
AGRADECIMENTOS
Aqui deixo os meus sinceros agradecimentos àqueles que contribuíram direto ou indiretamente para a realização deste trabalho...
Ao Conselho Nacional de Desenvolvimento Científico e Tecnológico - CNPq pela bolsa concedida (Processo: 142384/2018-6). O presente trabalho foi realizado com apoio da Coordenação de Aperfeiçoamento de Pessoal de Nível Superior - Brasil (CAPES) Código de Financiamento 001.
Ao meu orientador Renato Goldenberg pela oportunidade, paciência e ajuda durante todos estes quatro anos. À minha coorientadora Rosana Romero, por mais essa parceria e voto de confiança.
Aos meus colaboradores, Dr. Fabian Michelangeli, Dr. Marcelo Reginato e Dr. Cassiano Welker pela ajuda com a escrita, discussões dos resultados e tomadas de decisões; Ao Fabian também agradeço pelo envio de algumas sequências de Microlicieae e ao Marcelo pela ajuda e sugestões das análises no R.
Aos membros da pré-banca, Maria José Reis da Rocha, Duane Fernandes de Souza Lima e Gustavo Hiroaki Shimizu, pelas valiosas sugestões e correções. Aos membros da banca Maria José Reis da Rocha, Thais Vasconcelos, André Olmos Simão e Bárbara Leal que gentilmente aceitaram o convite de participar da banca, e aos suplentes André Vito Scatigna, Gustavo Hiroaki Shimizu e Lucas de Freitas Bacci.
Ao Programa de Pós-Graduação em Biologia Vegetal da UNICAMP pelo apoio financeiro para a viagem de campo ao Parque Nacional da Serra da Gandarela. Aos professores do Programa de Pós-Graduação em Biologia Vegetal da UNICAMP pelos ensinamentos e incentivos. Ao Herbário UEC, especialmente à curadora Livia Cordi e a Kamila Pinheiro de Lima que sempre estavam à disposição.
À Universidade Federal de Uberlândia, Instituto de Biologia por todo custeio das viagens de campo realizadas em Minas Gerais na Serra do Cipó, Diamantina e Serra do Cabral e em Goiás na Chapada dos Veadeiros, Minaçu e Niquelândia. Ao Herbário Uberlândense: à Dona Bia e Dona Cida pela preparação das exsicatas e à técnica Lilian Flávia pela logística de recebimento e envio de materiais, elaboração de etiquetas e por ajudar com qualquer problema que surgisse.
Aos curadores dos herbários ESA, BHCB, HUFU, MBM, SPF, UEC e UPCB pelo acolhimento nas visitas realizadas. Ao Flávio Carmo quem nos forneceu importantes informações para que a espécies tipo de Trembleya pudesse ser coletada na Serra do Gandarela. Ao Rodrigo Valentim e Gabriel Paranhos que, despretensiosamente, encontraram a espécie tipo de Microlicia em Diamantina.
À Carol Dias e à Rafa Cabral, primeiras pessoas que me ensinaram as técnicas de extração de DNA tendo muita paciência e carinho para isso. Ao Vinicius Brito (Duartina) pela ajuda em meus primeiros passos em Barão Geraldo. Aos meus queridos amigos das repúblicas Sibipiruna (Samuel, Camila, Pietro, Amanda, Lucas, Thuane e Mariana), e Fazendinha (Anninha, Ana Paula e Carol Jansen) obrigada por todo carinho, conversas e amor! Aos meus queridos amigos Luiz Henrique e Leonardo por todo apoio e amizade. À Suzana, Carol Devides, Elisa, Andreza e Juliana Amaral pela companhia, colaboração e ajuda no laboratório de molecular. Ao Marcelinho Monge e ao Gu Shimizu pela amizade, conversas, conselhos e confortos.
Aos amigos de Uberlândia, Carol Sbecker, Cassio, Daniela, Guilherme, Isabela, Jamile, Jean, João e Karla pela amizade e apoio de sempre. Ao Jimi, Laura e Noah que sempre com muito carinho me receberam em sua casa durante minhas idas à Uberlândia. À Duane e à Carol Harrison pelas vezes que estive em Curitiba e que me receberam e me hospedaram tão bem. À Ingrid e ao Zé por todo amor, carinho e cuidado. Aos meus pais, Ana Maria e Pedro, e minha irmã Lara pelo carinho, apoio e amor.
E, por fim, agradeço à Carol, minha companheira de vida e de luta. Por todas vezes que precisei ela estava ao meu lado, sempre segurando a barra até mesmo quando eu não mais aguentava. Obrigada pela dedicação, paciência e amor.
RESUMO
Microlicieae é uma das maiores tribos de Melastomataceae, composta por 256 espécies distribuídas entre os gêneros Chaetostoma, Lavoisiera, Microlicia, Poteranthera,
Rhynchanthera, Stenodon e Trembleya, os quais apresentam ocorrência quase endêmica aos
campos rupestres no Brasil. Microlicia é o maior gênero, com 161 espécies, que frequentemente apresenta sobreposições morfológicas com os demais gêneros da tribo. Estudos anteriores para investigar o monofiletismo dos gêneros em Microlicieae foram limitados pela baixa amostragem dos táxons, principalmente em Microlicia. O principal objetivo deste estudo é propor uma nova hipótese filogenética para Microlicieae com ênfase em Microlicia a fim de ampliar o conhecimento sobre a história evolutiva do gênero, contribuindo para sua melhor delimitação morfológica e taxonômica. No capítulo 1, foram utilizadas sequências de DNA plastidial (atpF-atpH e trnS-trnG), nuclear ribossomal (nrITS, nrETS) e nuclear low-copy (waxy) de 124 espécies de todos os gêneros de Microlicieae, das quais 71 são Microlicia. Além disso, caracteres morfológicos tradicionalmente utilizados para delimitação de Microlicia em relação aos demais gêneros da tribo foram minuciosamente avaliados. As árvores filogenéticas foram estimadas usando análises de Verossimilhança e Inferência Bayesiana. Para identificar táxons de posição incerta nas árvores filogenéticas foi utilizado o método RogueNaRok e a abordagem treespace para visualizar incongruências entre as árvores de genes. Microlicia, como atualmente delimitado, é parafilético, e a maioria dos caracteres morfológicos utilizados para a circunscrição de cada gênero na tribo é homoplástica. Portanto, propõe-se a inclusão de Chaetostoma, Lavoisiera, Stenodon e
Trembleya em Microlicia para que esta resulte em um gênero monofilético. Desta forma, após
os dados obtidos neste trabalho, Microlicieae deve apresentar apenas três gêneros, Microlicia,
Poteranthera e Rhynchanthera. No capítulo 2, são propostas as mudanças taxonômicas e
nomenclaturais, com base nos resultados do Capítulo 1. Uma circunscrição ampla e detalhada para Microlicia é apresentada; 67 táxons são transferidos para o gênero, dos quais 48 são novas combinações, e 19 são novos nomes, e cinco nomes são reestabelecidos. Com isso,
Microlicia possui 236 espécies, tornando-se um dos maiores gêneros em Melastomataceae. PALAVRAS-CHAVE: Chaetostoma, Filogenia, Lavoisiera, Poteranthera, Reconstrução
ABSTRACT
Microlicieae is one of the major tribes in Melastomataceae, with 256 species distributed in the genera Chaetostoma, Lavoisiera, Microlicia, Poteranthera, Rhynchanthera, Stenodon, and
Trembleya, which have a near-endemic occurrence in the Brazilian campos rupestres. Microlicia is the largest genus with 161 species that often shows morphological overlap with
the remaining genera in the tribe. Previous studies to investigate the monophyly of the genera in Microlicieae were limited due to the low taxon sampling, mainly in Microlicia. The main goal of this study was to propose a new phylogenetic hypothesis of Microlicieae with emphasis on Microlicia, in order to expand the knowledge about its evolutionary history and contributing to enhancing its morphological and taxonomic delimitation. In Chapter 1, were used plastidial (atpF-atpH e trnS-trnG), nuclear ribosomal (nrITS, nrETS), and nuclear low-copy (waxy) DNA sequences from 124 species from all genera in Microlicieae, of which 71 belong to Microlicia. Furthermore, the morphological characters traditionally used to circumscribe Microlicia and the other genera in the tribe were evaluated. Phylogenetic trees were estimated using Maximum Likelihood and Bayesian Inference analyses. To identify taxa with an uncertain position in the phylogenetic tree we used the RogueNaRok method and a treespace approach to visualize incongruences among the gene trees. Microlicia, as currently delimited, is paraphyletic and most of the characters used to circumscribe each genus in the tribe are homoplastic. Therefore, we propose merging Chaetostoma, Lavoisiera, Stenodon, and Trembleya in Microlicia in order to make it monophyletic. As result, our data show that Microlicieae should consist of three genera, Microlicia, Poteranthera, and Rhynchanthera. In Chapter 2, we proposed taxonomic and nomenclatural changes based on the results from Chapter 1. A broader and detailed circumscription for Microlicia is presented; 67 taxa were transferred to Microlicia, from which 48 are new combinations, 19 are new names, and five names were re-established in Microlicia. Thereby, Microlicia has 236 species and becomes one of the largest genera in Melastomataceae.
KEY WORDS: Chaetostoma, Lavoisiera, Morphological reconstruction, Phylogeny, Poteranthera, Rhynchanthera, Stenodon, Trembleya
Índice de Figuras
CAPÍTULO I. PHYLOGENETIC ANALYSIS OF MICROLICIEAE (MELASTOMATACEAE), WITH EMPHASIS ON THE RE-CIRCUMSCRIPTION OF THE LARGE GENUS MICROLICIA D.DON
Figure 1. Species from the recognized genera in Microlicieae ... 25 Figure 2. Morphological variation in the recognized genera in Microlicieae ... 34
Figure 3. Visualization of the tree space occupied by 18 different data sets: bootstrap tree,
best tree from ML analysis and the maximum clade credibility (MCC) tree from the BI analysis ... 36
Figure 4. Majority consensus tree from Bayesian inference analysis of nuclear and plastidial
concatenated sequences. ... 39
Figure 5. Stochastic mapping of selected characters in the Microlicieae tribe. A, Habit; B,
Leaf venation; C, Flower arrangement ... 42
Figure 6. Stochastic mapping of selected characters in the Microlicieae tribe. A, Petal
number; B, Ovary loci number ... 43
CAPÍTULO II. TAXONOMY AND NOMENCLATURAL NOTES IN MICROLICIEAE
(MELASTOMATACEAE): COMBINATIONS AND NEW NAMES IN MICROLICIA D.DON
Figure 1. Phylogenetic relationships within the Microlicieae tribe, based on majority
consensus tree from Bayesian Inference of nuclear and plastidial concatenate sequences, showing Chaetostoma, Lavoisiera, Stenodon and Trembleya nested within Microlicia ... 92
Índice de Tabelas
INTRODUÇÃO
Tabela 1. Histórico da circunscrição genérica em Microlicieae. Um asterisco (*) indica
gêneros que são atualmente considerados sinônimos de Siphanthera e dois asterisco (**) de
Cambessedesia. Números indicam gêneros que hoje me dia pertencem a outras tribos: ¹Tribo
Melastomateae; ²Tribo Marcetieae; ³Tribo Cambessedesieae; 4Tribo Lithobieae (Penneys et
al., dados não publicados); 5Tribo Eriocnemeae (Penneys et al., dados não publicados) ... 14
CAPÍTULO I: PHYLOGENETIC ANALYSIS OF MICROLICIEAE (MELASTOMATACEAE), WITH EMPHASIS ON THE RE-CIRCUMSCRIPTION OF THE LARGE GENUS MICROLICIA D.DON
Table 1. List of molecular markers and primer sequences used in this study ... 28
Table 2. Datasets and summary statistical obtained from phylogenetic analyses. ... 35
Table 3. Summary statistics for the posterior probabilities (PP) values in Bayesian trees ... 37
Table 4. Summary of the morphological characters indicating the most recent common
ancestor (MRCA), the total number of changes (mean over × stochastic maps), the consistency index (CI) and the retention index (RI) in each character and the most common change between the character state, considering only the Microlicieae ... 41
Sumário
Introdução Geral ... 13
Referências ... 16
Capítulo I. Phylogenetic analysis of Microlicieae (Melastomataceae), with emphasis on the re-circumscription of the large genus Microlicia D.Don ... 20
Abstract ... 21
Introduction ... 22
Material and Methods ... 26
Taxon Sampling ... 26
DNA extraction ... 26
PCR amplification, purification, and sequencing ... 27
Sequence alignment and model selection ... 28
Phylogenetic inference ... 29
Treespace... 29
Rogue taxa ... 30
Morphology: ancestral state reconstruction ... 30
Characters and coding... 31
Results ... 35
Molecular markers ... 35
Treespace... 35
Phylogenetic analyses ... 36
Ancestral state reconstruction ... 40
Discussion ... 45
Major lineages in Microlicieae... 46
Rhynchanthera lineage... 46
Poteranthera lineage... 47
Microlicia s.l. lineages ... 47
Unresolved species ... 47
Trembleya s.str. clade... 48
Stenodon and allies... 49
Pinheiroi clade ... 50
Lavoisiera clade ... 50
Viminalis clade ... 52 Ericoides clade... 53 Morphology ... 53 Habit ... 53 Leaf venation ... 54 Flower arrangement ... 54 Petals number... 55
Bristle on the hypanthium apex ... 55
Androecium ... 55
Ovary ... 56
Fruit... 57
Key to genera in Microlicieae ... 58
Conclusions ... 58
Acknowledgments ... 59
References ... 59
Supplementary Material ... 72
Capítulo II. Taxonomy and Nomenclatural notes in Microlicieae (Melastomataceae): combinations and new names in Microlicia D.Don ... 88
Abstract ... 89
Resumo ... 89
Intoduction ... 90
Material and Methods ... 92
Results ... 93
New circumscription of Microlicia ... 93
Combinations or new names in Microlicia ... 94
Re-established names... 102 Acknowledgments ... 103 References ... 103 Considerações Finais ... 107 Referências Gerais ... 109 Anexo 1 ... 123 Anexo 2 ... 128
INTRODUÇÃO GERAL
Melastomataceae s.l. [incl. Memecylaceae (APG, 2016)] constitui um elemento característico de ecossistemas tropicais e está entre as maiores famílias de plantas tropicais do mundo, com cerca de 5000 espécies e 160−170 gêneros (Renner, 1993; Clausing & Renner, 2001). São ervas, trepadeiras lenhosas, arbustos, ou árvores ocorrendo em montanhas, florestas, savanas e/ou vegetação perturbada (Clausing & Renner, 2001). Os níveis de diversidade, endemismo ou abundância de seus membros em diferentes habitats tornam a família um importante grupo ecológico, bem como um excelente modelo para estudos evolutivos (Reginato et al., 2016). Como exemplo, os campos rupestres, onde a família está entre os grupos de plantas vasculares com maior diversidade de espécies (Giulietti & Pirani, 1988; Rapini et al. 2008).
A família está organizada em três subfamílias e 16 tribos [Melastomoideae Naudin: Astronieae Triana, Bertolonieae Triana, Blakeeae Bentham & Hooker, Cambessedesieae Bochorny et al., Dissochaeteae Naudin, Henrietteeae Penneys et al., Marcetieae M.J.R.Rocha
et al., Melastomateae Bartl., Merianeae Triana, Miconieae DC., Microlicieae Naudin,
Rhexieae DC., Sonerileae Triana, Trioleneae Bacci et al.; Kibessioideae Naudin: Kibessieae Krasser; e Olisbeoideae Cogn.] (Renner, 1993; Clausing & Renner, 2001; Fritsch et al., 2004; Penneys et al., 2010; Goldenberg et al., 2012; Rocha et al., 2018; Veranso-Libalah et al., 2017; Bacci et al., 2019; Bochorny et al., 2019).
Microlicieae está entre as maiores tribos da família com 256 espécies. É uma tribo monofilética tanto por caracteres moleculares quanto morfológicos (Renner, 1993; Clausing & Renner 2001; Fritsch et al., 2004; Michelangeli et al., 2013). Seus membros compartilham a presença de sementes reniformes, elipsoides ou oblongas com testa foveolada ou reticulada, anteras com pedoconectivo prolongado na base e frutos capsulares (Cogniaux, 1891; Almeda & Martins, 2001; Fritsch et al., 2004).
A tribo foi proposta por Naudin (1849) há cerca de 170 anos, e desde então vem sofrendo alterações significativas em relação ao número de gêneros que a compõe (Naudin, 1849 [9 gêneros]; Triana, 1871 [17]; Cogniaux, 1891 [13]; Renner, 1993 [11]; Fritsch et al., 2004 [6]; Rocha et al., 2016b [7] (Tabela 1). Atualmente, é composta pelos gêneros
Chaetostoma DC. (12 espécies), Lavoisiera DC. (41), Microlicia D.Don (161), Poteranthera
Bong. (5), Rhynchanthera DC. (15), Stenodon Naudin (2) e Trembleya DC. (20) (Renner, 1990; Fritsch et al., 2004; Rocha et al., 2016b; Martins & Almeda 2017; Silva et al., 2018a; Medonza-Cifuentes et al., 2019; Romero et al., 2019; Flora do Brasil 2020). A maioria dos
gêneros apresentam uma distribuição exclusiva à América do Sul (Fritsch et al., 2004), com exceção de Rhynchanthera que também ocorre no sul do México e América Central (Renner, 1990). Ocorre em áreas de cerrado, veredas, campo limpo e campo sujo, porém apresenta-se quase exclusiva aos campos rupestres, com mais de 90% de suas espécies endêmicas a esta formação vegetacional.
Até o momento, o único trabalho filogenético para Microlicieae proposto por Fritsch
et al. (2004), indicou Rhynchanthera como a primeira linhagem a se divergir na tribo; Lavoisiera e Trembleya foram reconhecidos como clados bem suportados, porém os autores
sugeriram um aumento da amostragem de espécies de Trembleya a fim de confirmar seu monofiletismo; os autores apontaram ainda que Chaetostoma, Microlicia e Stenodon apresentavam ramos com baixo suporte; enquanto que Poteranthera não foi amostrado neste trabalho, uma vez que havia sido excluído de Microlicieae por Renner (1993) e Almeda & Martins (2001). Contudo, recentemente Rocha et al. (2016b) restabeleceram Poteranthera à tribo Microlicieae com base em dados moleculares e morfologia da semente e antera.
Tabela 1. Histórico da circunscrição genérica em Microlicieae. Um asterisco (*) indica gêneros que são atualmente considerados sinônimos de Siphanthera e dois asterisco (**) de Cambessedesia. Números indicam gêneros que hoje me dia pertencem a outras tribos: ¹Tribo Melastomateae; ²Tribo Marcetieae; ³Tribo Cambessedesieae; 4Tribo Lithobieae (Penneys et al., dados não
publicados); 5Tribo Eriocnemeae (Penneys et al., dados não publicados).
Naudin (1849) Triana (1871) Cogniaux (1891) Renner (1993) Fritsch et al., (2004) Rocha et al., (2016b)
Centradenia¹ Bucquetia¹ Bucquetia¹ Bucquetia¹ Chaetostoma Chaetostoma
Chaetostoma Cambessedesia³ Cambessedesia³ Cambessedesia³ Lavoisiera Lavoisiera
Lavoisiera Castratella¹ Castratella¹ Castratella¹ Microlicia Microlicia
Meisneria*² Centradenia¹ Centradenia¹ Chaetostoma Rhynchanthera Poteranthera
Microlicia Chaetostoma Chaetostoma Eriocnema4 Stenodon Rhynchanthera
Rhynchanthera Eriocnema5 Eriocnema5 Lavoisiera Trembleya Stenodon
Siphanthera² Lavoisiera Lavoisiera Lithobium4 Trembleya
Stenodon Lithobium4 Lithobium4 Microlicia
Trembleya Meisneria*² Microlicia Rhynchanthera
Microlicia Poteranthera Stenodon
Poteranthera Pyramia**³ Trembleya
Pyramia**³ Rhynchanthera Rhynchanthera Siphanthera² Stenodon Stenodon Svitramia¹ Trembleya Trembleya Tulasnea*²
Segundo a classificação tradicional de Microlicieae, Rhynchanthera distingue-se morfologicamente dos demais gêneros de Microlicieae pelas flores haplostêmones com presença de estaminódios (Renner, 1990). Poteranthera são ervas anuais pequenas com tricomas glandulares na margem das folhas (Kriebel, 2012; Rocha et al., 2016b; Almeda & Pacífico, 2018), podendo apresentar estaminódios ou não. Chaetostoma apresenta uma coroa de tricomas no ápice externo do hipanto (Koschnitzke & Martins, 2006; Silva et al., 2018a).
Stenodon apresenta ramos com casca grossa e decorticantes e estames com apêndice ventral
inconspícuo (Fritsch et al., 2004). Lavoisiera distingue-se dos demais gêneros pelo ovário parcialmente ínfero a ínfero e cápsula com deiscência predominantemente acrópeta (deiscente da base para o ápice), com columela persistente (Fritsch et al., 2004; Martins & Almeda, 2017). Trembleya é caracterizado pelas nervuras reticuladas visíveis na face abaxial das folhas e inflorescências em dicásios reduzidos ou não, com flores sempre associadas a um par de brácteas basais (Martins, 1997).
Ainda de acordo com a classificação tradicional, Microlicia seria o maior gênero da tribo, e a maioria de suas espécies é endêmica do Brasil, as quais apresentam três principais centros de diversidade localizados nos estados da Bahia, Goiás e Minas Gerais (Romero, 2003). Até o momento seis espécies podem ser encontradas fora do território brasileiro na Bolívia [Microlicia arenariifolia DC. e M. weddellii Naudin], Colômbia [M. colombiana HumbertoMend. & R.Romero], Guyana e Venezuela [M. benthamiana Triana and M.
guanayana Wurdack] e Peru [M. sphagnicola Gleason] (Romero, 2003; Mendoza-Cifuentes et al., 2019). O gênero, de acordo com a circunscrição utilizada até o momento, é reconhecido
pelas folhas desprovidas de nervação reticulada, flores pentâmeras, raro hexâmeras ou octâmeras, estames com apêndice ventral bem desenvolvido, ovário trilocular, com ápice glabro, fruto com deiscência basípeta (deiscente do ápice para base) e columela decídua (Almeda & Martins, 2001; Romero, 2003).
Embora Microlicieae seja uma tribo bem delimitada (Fritsch et al., 2004; Michelangeli
et al., 2013; Rocha et al., 2016b), à medida que estudos vem sendo feitos, observa-se que os
caracteres tradicionalmente utilizados na delimitação dos gêneros apresentam alto grau de sobreposições, tornando difícil a distinção genérica (e.g. Almeda & Martins, 2001; Fidanza et al., 2013; Romero et al., 2015, 2017, 2019; Romero & Versiane, 2014, 2016; Pacifico & Fidanza, 2017; Pacifico et al., 2017; Diniz-Neres & Silva, 2017; Martins & Almeda 2017). Mesmo com esses avanços sobre o conhecimento da sistemática de Microlicieae (e.g., Fritsch
amostragem limitada (Fritsch et al., 2004) ou não tiveram a tribo como foco principal de estudo (Michelangeli et al., 2013, Rocha et al., 2016a).
Diante do exposto, o presente estudo apresenta a análise filogenética mais completa para Microlicieae até o momento, com 44% dos seus táxons amostrados e inclui quatro marcadores moleculares diferentes em relação ao último estudo filogenético (i.e., Fritsch et
al., 2004). O principal objetivo deste estudo é propor uma nova hipótese filogenética para
Microlicieae com ênfase em Microlicia a fim de ampliar o conhecimento sobre a história evolutiva do gênero, contribuindo para sua melhor delimitação morfológica e taxonômica. Desta forma, no capítulo 1, é investigada a relação filogenética de Microlicia com os gêneros
Chaetostoma, Lavoisiera, Poteranthera, Rhynchanthera, Stenodon e Trembleya, e os
caracteres morfológicos tradicionalmente utilizados na delimitação de cada gênero em relação à Microlicia são minunciosamente avaliados. No capítulo 2, é apresentada uma nova circunscrição para Microlicia; e são propostas as alterações nomenclaturais com base nos resultados do capítulo 1.
REFERÊNCIAS BIBLIOGRÁFICAS
Almeda F, Martins AB. 2001. New combinations and new names in some Brazilian
Microlicieae (Melastomataceae), with notes on the delimitation of Lavoisiera, Microlicia and Trembleya. Novon 11: 1–7.
Almeda F, Pacífico R. 2018. Neotropical Poteranthera (Melastomataceae: Microlicieae)
Revisited. Systematic Botany 43(2): 552−556. DOI 10.1600/036364418X697274
APG - The Angiosperm Phylogeny Group 2016. An update of the Angiosperm Phylogeny
Group classification for the orders and families of flowering plants: APG IV. Botanical
Journal of the Linnean Society 181: 1–20.
Bacci LF, Michelangeli FA, Goldenberg R. 2019. Revisiting the classification of
Melastomataceae: implications for habit and fruit evolution. Botanical Journal of the
Linnean Society 190: 1–24. doi.org/10.1093/botlinnean/boz006
Bochorny T, Michelangeli FA, Almeda F, Goldenberg R. 2019. Phylogenetics,
morphology and circumscription of Cambessedesieae: a new Neotropical tribe of Melastomataceae. Botanical Journal of the Linnean Society 190(3): 281–302. doi.org/10.1093/botlinnean/boz018
Clausing G, Renner SS. 2001. Molecular phylogenetics of Melastomataceae and
Memecylaceae: implications for character evolution. American Journal of Botany 88(3): 486–498.
Cogniaux, CA. 1891. Melastomataceae. In De Candolle ALPP, De Candolle, ACP (eds.).
Monographiae Phanerogamarum. Paris: G. Masson 7: 1–1256.
Diniz-Neres DO, Silva MJ. 2017. A remarkable new species of Microlicia
(Melastomataceae) including an identification key to species of the genus from the Chapada dos Veadeiros National Park, Goiás, Brazil. Systematic Botany 42(3): 554–561. DOI 10.1600/036364417X696014
Fidanza K, Martins AB, Almeda F. 2013. Four new species of Trembleya
(Melastomataceae: Microlicieae) from Serra do Cabral, Minas Gerais, Brazil. Brittonia. DOI 10.1007/s12228-012-9281-x.
Flora do Brasil 2020 em construção. Jardim Botânico do Rio de Janeiro.Disponível em:
<http://floradobrasil.jbrj.gov.br/reflora/floradobrasil/FB9979>. Acesso em: 15 Jan 2020.
Fritsch PW, Almeda F, Renner SS, Martins AB, Cruz BC. 2004. Phylogeny and
circumscription of the near-endemic Brazilian tribe Microlicieae (Melastomataceae).
American Journal of Botany 91(7): 1105–1114.
Giulietti AM & Pirani JR. 1988. Patterns of geographic distribution of some plant species
from the Espinhaço Range, Minas Gerais and Bahia, Brazil. In: Vanzolini, P.E., & Heyer, W.R. (eds) Proceedings of a workshop on Neotropical distribution patterns. Academia Brasileira de Ciências, Rio de Janeiro, 39–69
Goldenberg R, Fraga CN, Fontana AP, Nicolas AN, Michelangeli FA. 2012. Taxonomy
and phylogeny of Merianthera (Melastomataceae). Taxon 61(5): 1040−1056.
Koschnitzke C, Martins AB. 2006. Revisão taxonômica de Chaetostoma DC.
(Melastomataceae, Microlicieae). Arquivos do Museu Nacional 64(2): 95–119.
Kriebel R. 2012. A synopsis of the genus Poteranthera (Melastomeae: Melastomataceae)
with the description of a new, apparently pollinator deceiving species. Brittonia 62: 6–14.
Martins E. 1997. Revisão taxonômica do gênero Trembleya DC. (Melastomataceae). Tese
não publicada. Universidade Estadual de Campinas.
Martins AB, Almeda F. 2017. A monograph of the Brazilian endemic genus Lavoisiera
(Melastomataceae: Microlicieae). Phytotaxa 135(1): 1–194.
Mendoza-Cifuentes H, Ariza W, Granados DE, Romero R. 2019. A new species of Microlicia (Melastomataceae): first record of the genus for Colombia. PhytoKeys 122: 87–
Michelangeli FA, Guimarães PJF, Penneys DS, Almeda F, Kriebel R. 2013. Phylogenetic
relationships and distribution of New World Melastomeae (Melastomataceae). Botanical
Journal of the Linnean Society 171: 38–60.
Naudin C. 1849. Additions à la flore du Brésil méridional. Description de genres nouveaux,
et rectification de quelques anciens genres appartenant à la famille des Mélastomacées.
Annales des Sciences Naturelles, Botanique, série 3 12: 126–159.
Pacifico RB, Fidanza K. 2017. Microlicia sciophylla (Melastomataceae: Microlicieae), a
new micro-endemic species from the rocky fields of Minas Gerais, Brazil. Kew Bulletin
72: 5. DOI 10.1007/S12225-017-9688-3
Pacifico RB, Fidanza K, Almeda F. 2017. Two new species of Microlicia
(Melastomataceae) from the Rupestrian Grasslands of Serra do Cipó, Minas Gerais, Brazil.
Phytotaxa 316(1): 39–50. doi.org/10.11646/phytotaxa.316.1.3
Pacifico R, Almeda F, Do Carmo AP, Fidanza K. 2019. A new species of Trembleya
(Melastomataceae: Microlicieae) with notes on leaf anatomy and generic circumscription
Phytotaxa 391(5): 289–300. doi.org/10.11646/phytotaxa.391.5.2
Penneys DS, Michelangeli FA, Judd WS, Almeda F. 2010. Henrietteeae
(Melastomataceae): A new Neotropical berry-fruited tribe. Systematic Botany 35(4): 783– 800. DOI 10.1600/036364410X539862
Rapini A, Ribeiro PL, Lambert S. & Pirani JR. 2008. A flora dos campos rupestres da
Cadeia do Espinhaço. Megadiversidade 4: 15–23.
Reginato M, Neubig KM, Majure LC, Michelangeli FA. 2016. The first complete plastid
genomes of Melastomataceae are highly structurally conserved. PeerJ 4: e2715. DOI 10.7717/peerj.2715
Renner SS. 1990. A revision of Rhynchanthera (Melastomataceae). Nordic Journal of Botany 9: 601–630.
Renner SS. 1993. Phylogeny and classification of the Melastomataceae and Memecylaceae. Nordic Journal of Botany 13: 519–540.
Rocha MJR, Batista JAN, Guimarães PJF, Michelangeli FA. 2016a. Phylogenetic
relationships in the Marcetia alliance (Melastomeae, Melastomataceae) and implications for generic circumscription. Botanical Journal of the Linnean Society 181: 585–609.
Rocha MJR, Batista JAN, Guimarães PJF, Michelangeli FA. 2016b. Phylogenetic
placement and a new circumscription of Poteranthera (Microlicieae; Melastomataceae).
Rocha MJR, Guimarães PJF, Michelangeli FA, Batista JAN. 2018. Taxonomy of
Marcetieae: A new Neotropical tribe of Melastomataceae. International Journal of Plant
Sciences 179(1): 50−74. DOI: 10.1086/694932
Romero R. 2003. Revisão taxonômica de Microlicia sect. Chaetostomoides
(Melastomataceae). Revista Brasileira de Botânica 26(4): 429–435.
Romero R, Caetano APS, Santos KF, De-Paula OC, Versiane AFA. 2019. Two new
species of Microlicia D.Don (Melastomataceae) from campos rupestres in eastern Brazil.
Nordic Journal of Botany 37(10): 1–11. https://doi.org/10.1111/njb.02350
Romero R, Silva KR, Simão DG. 2015. Microlicia cogniauxiana and Microlicia naudiniana
(Melastomataceae), two new species from the Espinhaço Range, Brazil. Systematic Botany
40(4). DOI 10.1600/036364415X690058.
Romero R, Versiane AFA. 2014. A new species of Microlicia and a checklist of
Melastomataceae from the mountains of Capitólio municipality, Minas Gerais, Brazil.
Phytotaxa 170(2): 118–124.
Romero R, Versiane AFA. 2016. Microlicia candolleana (Melastomataceae): a new endemic
species to the Espinhaço range, Minas Gerais, Brazil. Phytotaxa 261(3): 275–281. http://dx.doi.org/10.11646/phytotaxa.261.3.7.
Romero R, Versiane AFA, Fontelas JC, Diniz-Neres DO, de Paula, CO. 2017. A new
species of Microlicia (Melastomataceae) with bright golden cuticle from Chapada dos Veadeiros, Goiás (Central Brazil). Systematic Botany 42(3): 562–568. DOI 10.1600/036364417X696069
Silva DN, Diniz DO, Koschnitzke C, Guimarães PJF, Silva MJ, Maia, VH. 2018a.
Chaetostoma hexapetalum (Microlicieae, Melastomataceae): A new species from the
Chapada dos Veadeiros, Goiás, Brazil. Systematic Botany 43(4): 986–992.
Triana J. 1871. Les Melastomacées. Transactions of the Linnean Society of London 28: 1–
CAPÍTULO I
Phylogenetic analysis of Microlicieae (Melastomataceae),
with emphasis on the re-circumscription of the large genus
Microlicia D.Don
1Ana Flávia Alves Versiane, Rosana Romero, Marcelo Reginato, Cassiano Aimberê Dornelles Welker, Fabián Armando Michelangeli and Renato Goldenberg
Microlicieae is a monophyletic tribe compound by seven genera: Chaetostoma,
Lavoisiera, Poteranthera, Rhynchanthera, Stenodon, and Trembleya. Microlicia is a
diverse genus comprising 161 species with predominant distribution in the campos
rupestres from Brazil. Its delimitation is not well-established mainly in regarding the
generic boundaries with Lavoisiera and Trembleya. This study presents a phylogenetic hypothesis for Microlicieae focusing on Microlicia, with the specific goals of investigating the monophyly of Microlicia; providing an appropriate classification of
Microlicia and related genera; and investigating morphological characters to
circumscribe clades and/or genera in the tribe. Plastidial (atpF-atpH and trnS-trnG), nuclear ribosomal (nrITS, nrETS) and nuclear low copy (waxy) DNA sequences were used. The phylogenetic trees were estimated using Bayesian Inference and Maximum Likelihood analyses. The history of 12 morphological characters was estimated based on ancestral state reconstruction analyses. According to the results, Microlicia is paraphyletic with Chaetostoma, Lavoisiera, Stenodon, and Trembleya nested within it and most characters traditionally used to diagnose the genera in Microlicieae are homoplastic. Thus, here is proposed that all four previously segregated genera (Chaetostoma, Lavoisiera, Stenodon, and Trembleya) should be included in a broadly circumscribed Microlicia to achieve its monophyly. Therefore, Microlicieae has now consisted of Rhynchanthera, Poteranthera, and Microlicia genera.
ADDITIONAL KEYWORDS: ancestral reconstruction – campos rupestres –
Chaetostoma – Lavoisiera – paraphyletic – phylogenetic – Poteranthera – Stenodon –
INTRODUCTION
0Melastomataceae are among the largest tropical plant families worldwide with about 170 genera and 5000 species (Renner 1993; Clausing & Renner, 2001; Veranso-Libalah
et al., 2017). Phylogenetic analyses in the family have been recovering the tribes
Melastomateae Bartl., Marcetieae M.J.R. Rocha, P.J.F. Guim. & Michelang., Microlicieae Naudin, and Rhexiae DC. in a clade with species that share anthers with pedoconnectives and capsular fruits (Clausing & Renner, 2001; Michelangeli et al., 2004; Michelangeli et al., 2013; Rocha et al., 2016a; Veranso-Libalah et al., 2017; Guimarães et al., 2019).
Microlicieae is a monophyletic tribe based on both morphological and molecular evidence (Clausing & Renner, 2001; Fritsch et al., 2004; Michelangeli et al., 2013; Rocha et al., 2016a), forming a group with recent diversification and a nearly-endemic distribution in Brazil (Fritsch et al., 2004; Simon et al., 2009). The tribe is characterized by stamens with a prolonged pedoconnective, anthers with rostrate apex, capsular fruits, and reniform to ellipsoid seeds with foveolate or lacunate-reticulated testa (Naudin, 1849; Triana, 1871; Cogniaux, 1891; Almeda & Martins, 2001; Fritsch et al., 2004; Rocha et al., 2016a; Martins & Almeda, 2017). Currently, is compound by seven genera: Chaetostoma DC. (12 accepted species), Lavoisiera DC. (41), Microlicia D.Don (161), Poteranthera Bong. (five), Rhynchanthera DC. (15), Stenodon Naudin (two), and
Trembleya DC. (20) (Fig. 1; Renner, 1990; Rocha et al., 2016b; Martins & Almeda
2017; Silva et al., 2018a; Flora do Brasil 2020)
In a previous phylogenetic study for Microlicieae, Fritsch et al. (2004) indicated
Rhynchanthera as the first-diverging lineage and recognized Lavoisiera and Trembleya
as well-supported clades. However, this study suggested increasing taxon sampling in
Trembleya to confirm its monophyly. Stenodon showed low supported branches. Also,
were required to adequately assess the monophyly and phylogenetic relationships of both Chaetostoma and Microlicia. Poteranthera was not sampled by Fritsch et al. (2004) since it was previously excluded from Microlicieae by Renner (1993) and Almeda & Martins (2001). Nevertheless, Rocha et al. (2016b) recently reestablished
Poteranthera in the tribe based on molecular data and morphological features of seeds
and anthers.
Microlicia is the largest genus in the Microlicieae and has predominant
distribution in the campos rupestres and cerrado from Brazil with over 140 species occurring in this area (Flora do Brasil 2020). Until now, six species can be found outside the Brazilian territory in Bolivia [Microlicia arenariifolia DC. and M. weddellii Naudin], Colombia [M. colombiana HumbertoMend. & R.Romero], Guyana and Venezuela [M. benthamiana Triana and M. guanayana Wurdack], and Peru [M.
sphagnicola Gleason] (Romero, 2003; Mendoza-Cifuentes et al., 2019).
Due to its high diversity, Microlicia presents non-exclusive and/or polymorphic characters that usually are not informative for its circumscription which remains controversial (see Almeda & Martins, 2001). Nowadays, Microlicia can be recognized by its isolated flowers, usually pentamerous, rarely hexamerous or octamerous, bristles absent on the hypanthium apex, isomorphic to dimorphic stamens, tetrasporangiate or polysporangiate anthers, three locular ovary with a glabrous apex, and fruits with basipetal dehiscence and deciduous columella (Almeda & Martins, 2001; Romero 2003; Versiane et al., this paper). However, most of these characters used to identify the species in Microlicia are also used to place species in the other genera within Microlicieae, mainly in Lavoisiera and Trembleya.
As morphological studies advance with these genera (e.g. Romero, 2000, 2003, 2005, 2010, 2013a; Romero & Woodgyer, 2010, 2014, 2018; Fidanza et al., 2013; Romero et al., 2014, 2015, 2017, 2019a, 2019b; Romero & Versiane, 2014, 2016;
Pacifico & Fidanza, 2015, 2017; Pacifico et al., 2017, 2019; Diniz-Neres & Silva, 2017; Diniz & Silva, 2018), is possible to realize that some characters traditionally used to segregate Microlicia, Lavoisiera, and Trembleya are not reliable. The characters include absent or presence of secondaries and tertiaries nerves on the leaves, flowers solitary or disposed in inflorescence, number of petals, number of loci in the ovary, capsule with basipetal or acropetal dehiscence, and deciduous or persistent columella (see Almeda & Martins, 2001; Fritsch et al., 2004; Fidanza et al., 2013; Martins & Almeda, 2017).
The morphological delimitation among Microlicia and the remaining genera,
Rhynchanthera, Chaetostoma, Stenodon, and Poteranthera, has not been subject to the
same issues as the genera above. Rhynchanthera can be easily distinguished by haplostemonous flowers with staminodes (Renner, 1990); Chaetostoma can be recognized by the crown of bristles on the hypanthium apex (Koschnitzke & Martins, 2006; Silva et al., 2018a); Stenodon has thick, woody and decorticating branches, and also stamens with an inconspicuous ventral appendage (Fritsch et al., 2004); finally,
Poteranthera are small, annual herbs and has glandular hairs on the leaf margin
(Kriebel, 2012; Rocha et al., 2016b; Almeda & Pacifico, 2018).
In view of clarifying the relationship and the morphological delimitation of
Microlicia within Microlicieae, this study aimed to provide a phylogenetic hypothesis
for the tribe focusing on Microlicia. Here were included both an increase in the number of taxa and molecular markers regarding Fritsch et al. (2004). Moreover, morphological characters traditionally used in genera delimitation were evaluated to improve the classification of Microlicieae. The specific goals were (1) to investigate the monophyly of Microlicia; (2) to provide the most appropriate classification of Microlicia and related genera; and (3) to investigate morphological characters that may circumscribe clades and/or genera in the tribe
Figure 1. Species from the recognized genera in Microlicieae: A, Chaetostoma armatum (Spreng.) Cogn.; B,
Lavoisiera cordata Cogn.; C, Lavoisiera imbricata (Thunb.) DC.*; D, Microlicia amplexicaulis Cogn.; E, Microlicia ericoides D.Don*; F, Microlicia longipedicellata (Cogn.) Almeda & A.B. Martins ; G, Poteranthera pusilla Bong.*; H, Rhynchanthera grandiflora (Aubl.) DC.*; I, Stenodon suberosus Naudin*; J, Trembleya rosmarinoides DC.*; K, Trembleya pradosiana Netto; L, Trembleya chamissoana Naudin ex Cogn. *Type species of the genus (B−F, I−L: Versiane; A, H: Goldenberg; G: Fernandes)
MATERIAL AND METHODS
TAXON SAMPLING
A total of 130 taxa in 10 genera were sampled to produce a phylogenetic hypothesis for Microlicieae focusing on Microlicia. Of these, 113 accepted species from the seven genera in Microlicieae, representing about 44% of 256 species in this group; eleven are new unpublished species of Lavoisiera, Microlicia, and Trembleya. The number of species sampled per genus were: Chaetostoma (5/41% of the species), Lavoisiera (17/40%), Microlicia (71/45%), Rhynchanthera (4/36%), Poteranthera (1/20%),
Stenodon (1/50%), Trembleya (14/70%). Sampling included the type species of all
genera in Microlicieae. Most samples were collected in the field and determined by the authors. Whenever possible, the morphological variation and geographical distribution for each genus were sampled. Only five samples were obtained from herbarium specimens (Chaetostoma stenocladon (Naudin) Kosch. & A.B. Martins, Microlicia
flava R. Romero, M. hatschbachii Wurdack, M. minima Markgr., and M. parvula
(Markgr.) Kosch. & A.B. Martins). Vouchers were deposited at HUFU, NY, UEC and UPCB (acronyms according to Thiers, 2020). As outgroup, six accessions representing three genera from lineages that are phylogenetically related to Microlicieae were chosen: Rhexia L., (2 spp.) (Rhexieae), Marcetia DC., (2 spp.) and Siphanthera Pohl ex DC., (2 spp) (Marcetieae). The trees were rooted in Marcetieae following the results of Rocha et al. (2016a). The specimens sampled for this study are listed in Supplementary Material (Table S1).
DNA EXTRACTION
Total genomic DNA from silica gel dried leaves was extracted using the CTAB method following Doyle & Doyle (1987) with adjustments. Specimens with a high concentration of secondary compounds had 1.5 ml of sorbitol and 30 μL of sarkosyl
additioned to the protocol to improve the DNA extraction. DNA from herbarium specimens (2–6 mg) was extracted using NucleoSpin 96 Plant II extraction Kit (Macherey-Nagel) following the manufacturer’s instructions, however, the protocol was slightly modified by adding 2 μL of proteinase K and incubating on thermoblock for a period of three hours.
PCR AMPLIFICATION, PURIFICATION, AND SEQUENCING
Were amplified and sequenced two nuclear ribosomal loci, the internal transcribed spacer (nrITS) and external transcribed spacer (nrETS), one low-copy nuclear locus, the Granule-bound starch synthase 1 (waxy) and two plastid non-coding loci, the intergenic spacers regions atpF-atpH and trnS-trnG, which are frequently used in phylogenetic studies in Melastomataceae (Michelangeli et al., 2004, 2013; Reginato & Michelangeli 2016a, 2016b; Rocha et al., 2016a; Bacci et al., 2018; Bochorny et al., 2019). Due to its large size (over 900 bp), the nrITS region was amplified in two fragments that overlap (nrITS1+5.8S and nrITS2). Sequence data from Marcetieae, Rhexieae (both except for the marker waxy), and for Chaetostoma cupressinum (D.Don) Koschnitzke & A.B.
Martins, Lavoisiera crassifolia Mart. & Schrank ex DC., L. macrocarpa Naudin, L.
subulate Triana, Microlicia amblysepala Ule, Poteranthera pusilla, Rhynchanthera bracteata Triana, R. grandiflora, and R. serrulata (L.C.Rich.) DC. were obtained from
GenBank (https://www.ncbi.nlm.nih.gov/genbank/). PCR-primers used in this study are detailed in Table 1. The amplification of all DNA regions was performed in 25 μL reactions containing 1.5 μL of genomic DNA, 2.5 μL of each primer and betaine, 12.5 μL of Green Master® Taq DNA polymerase, 2 μL of DMSO 5% or 10% and bovine serum albumin (BSA) [] 10 mg/mL. The PCR profile reactions were similar for all marlers, with small adjustments in the annealing temperature and extension time, as follows: initial denaturation at 94°C for 2 min; 40 cycles of denaturation at 94°C for 30s
(except for waxy, 94°C for 45s); annealing at 52°C for 30s (nrITS), 55°C for 37s (nrETS), 54°C for 45s (waxy), 57°C for 60s (atpH-atpF), 55°C for 45s (trnS−trnG); extension at 72°C for 40s (except for waxy which was 72°C for 75s); and a final extension at 72°C for 7 min for all markers. PCR products were purified with Polyethylene glycol (PEG 20%) by precipitation of the primers and dNTPs following the protocol suggested by Dunn & Blattner (1987). Cycle sequencing reactions were carried out with the same amplification primers using the sequencing service at Macrogen, Inc. All sequences generated in this study were deposited in GenBank (https://www.ncbi.nlm.nih.gov/genbank/) (see Supplementary Material, Table S1).
Table 1. List of molecular markers and primers sequences used in this study.
Region Primer Sequence (5'−3') Reference
nrITS1+5.8S NY183 NY887 CCTTATCATTTAGAGGAAGGAG ATTGATGGTTCGCGGGATTCTGC Michelangeli et al. (2004) nrITS2 NY017 NY207 GCATCGATGAAGAACGCAGC CAGTGCCTCCTGCGACA Michelangeli et al. (2004) nrETS NY320 NY1428 AGACAAGCATATGACTACTGGCAGG ACGTGTCGCGTCTAGCAGGCT Kriebel et al. (2015) waxy NYF1 NYR GRGGTCTTGGGGACGTGCTC AGCAGTGTGCCARTCGTTGG
Reginato & Michelangeli (2016a)
atpF-atpH NY822 NY823 ACTCGCACACACTCCCTTTCC GCTTTTATGGAAGCTTTAACAAT Reginato et al. (2010) trnS-trnG NY904 NY905 GAACGAATCACACTTTTACCAC GCCGCTTTAGTCCACTCAGC Shaw et al. (2005)
SEQUENCE ALIGNMENT AND MODEL SELECTION
The sequence fragments generated for each sample from bidirectional reads were assembled and edited using Geneious v.9.1.2 (Biomatters Ltd.). DNA sequence alignment was performed using the MAFFT v.7 algorithm with the strategy E-INS-i (Katoh, 2013). The best evolutionary DNA model for each marker was determined under the Bayesian Information Criteria (BIC) using PartitionFinder v.2.1.1 (Lanfear et
al., 2012) as implemented on the CIPRES Science Gateway platform
K80) with or without four discrete rate categories approximating a gamma distribution (+G) and/or invariant sites (+I).
PHYLOGENETIC INFERENCE
Phylogenetic analyses were performed individually for each marker, and the congruence among the topologies was visibly evaluated. Once no significant conflicts among the topologies were found, the same analyses were done with the concatenated alignments. The phylogenetic trees for each marker and the concatenated data set were estimated using maximum likelihood (ML) and Bayesian inference (BI).
Maximum likelihood analyses were performed with RAxML using default parameters (Stamatakis, 2006) and run through the CIPRES Science Gateway (http://www.phylo.org/; Miller et al., 2010). Bootstrap support values (hereafter indicated as BS) were estimated based on 1,000 replicates. The BS within 50–70% were considered as weak, 71–85% as moderate, and >85% as strong (Kress et al., 2002).
Bayesian analyses were performed using MrBayes v.3.1.2 run through the CIPRES Science Gateway (http://www.phylo.org/; Miller et al., 2010). The analyses were run for 100,000,000 generations with four Markov chain Monte Carlo (MCMC), of two independent runs, sampling one tree every 2,000 generations. The convergence of the MCMC runs, effective sampling size (ESS) values and likelihood scores were assessed in TRACER v.1.6 (Rambaut & Drummond, 2013). The first 25% of samples from each run were discarded as “burn-in”. Groups with posterior probabilities (PP) < 0.90 were considered as weakly supported, PP within 0.91–0.95 as moderately supported, and PP 0.95 > as strongly supported.
Ideally, a single phylogenetic tree could be used to visualize the evolutionary history of a set of sequences (Jombart et al., 2017). However, several biological and statistical factors may result in phylogenetic incongruence between gene trees (Jeffroy et al., 2006; Gautier & Daubin, 2008; Kumar et al., 2012), and the existence of incongruence impedes the achievement of the primary goals of evolutionary research (Som, 2014). Here, we used a treespace approach (Hillis et al., 2005) to visualize putative incongruence across our gene trees. This method provides a simple framework for exploring landscapes of phylogenetic trees and investigating phylogenetic incongruence using tree distances (Jombart et al., 2017). The analyses were performed using the R package treespace v.1.1.3 (Jombart et al., 2017), with default parameters. In our treespace analysis, we included the bootstrap tree and the best tree set from ML analysis and the Maximum Clade Credibility (MCC) tree from the BI analysis for each data set.
ROGUE TAXA
The resolution in a consensus tree and the branch support on the best-known tree can be substantially deteriorated by rogues (Aberer et al., 2013). Rogues are one or few taxa whose position is unstable due to missing data, an elevated substitution rate causing homoplasy, or extremely low rates inside and outside the clade, all of which can cause low BS (Sanderson & Shaffer, 2002). Here, we used the RogueNaRok method (Aberer
et al., 2013) to identify potential rogue taxa. RogueNaRok takes a bootstrap tree set
from ML analysis as input and the analysis was performed in its web server (http://rnr.h-its.org/). RogueNaRok parameters were set as: threshold = extended majority-rule consensus, optimize = support, maximum dropset size = 1.
A morphological matrix was compiled to investigate the evolution of selected morphological characters and to identify putative diagnostic characters for each formed clade. These characters were used to circumscribe the genera in Microlicieae by Don (1823), Candolle (1828), Naudin (1849), Triana (1871), Cogniaux (1883, 1891), Renner (1993), Almeda & Martins (2001), Martins & Almeda (2017). The characters were coded by observations in herbarium specimens (BHCB, CEN, ESA, HUFU, IBGE, MBM, NY, RB, SPF, UB, UEC, UEG, UPCB, US) (acronyms according to Thiers, 2020). and bibliographical survey (Renner, 1990; Martins, 1997; Romero, 2003; Woodgyer, 2005; Koschnitzke & Martins, 2006; Romero & Woodgyer, 2010; Romero 2013b; Rocha et al., 2016b; Martins & Almeda, 2017, Romero et al., 2017). The morphological matrix was edited using Mesquite v.3.04 (Maddison & Maddison, 2001). All characters were mapped on the MCC tree, in which the stable posterior distributions were combined using LogCombiner v.1.7.5. and summarized on TreeAnnotator v.1.7.5 (Bouckaert et al., 2014).
Three models of morphological character evolution (“ER”, Equal Rates; “SYM”, Symmetric; and “ARD”, All Rates Different) were first evaluated under the corrected Akaike information criterion (AICc) using the fitDiscrete function of the R package geiger v.2.0.6 (Harmon et al., 2008). Ancestral state reconstruction was performed through stochastic mapping implemented in the R package phytools v.0.6 (Revell, 2012), where for each character 1000 stochastic maps were generated and summarized using the functions make.simmap and describe.simmap (Revell, 2012). Taxa with polymorphic data were treated as having the same probability for each possible state. The results were plotted over the phylogenetic tree using the basic functions of the R package ape (Paradis et al., 2004).
Twelve characters including habit, leaves, perianth, gynoecium, androecium, fruit and trichomes were coded (see Supplementary Material, Table S2).
Habit: herbaceous (0); woody (1). Subshrub, shrub, small tree and tree have
woody tissue while in herbs it is lacking.
Leaf secondary veins: absent (0); present (1). The secondary and tertiary veins
may form a reticulated pattern visible on the adaxial and/or abaxial surface, or they may be absent and only primary veins are visible (Fig. 2A).
Flower arrangement: solitary (0); dichasium (1); paired (2); glomerule (3). The
inflorescence terminology followed Martins & Almeda (2017). Solitary flowers do not have bracteoles at the flower base (pedicel), while dichasia, paired and glomerular arrangements have these bracteoles.
Petal number: less than five (0); five (1); more than five (2). The number of petals
is extremely important to recognize some groups in Melastomataceae, such as
Acisanthera (Rocha et al., 2016a), Marcetia (Rocha et al., 2016a), Pterolepis (Renner,
1994), and Siphanthera (Almeda & Robinson, 2011). In Microlicieae the variation ranges from five to nine, within and between each genus (Almeda & Martins, 2001; Fritsch et al., 2004).
Bristles on the hypanthium apex: absent (0); present (1). The bristles are a series
of rigid set and erect structures that form a crown on the hypanthium apex, on the outer surface (Fig. 2B1−B2).
Stamens dimorphism: isomorphic (0); subisomorphic (1); dimorphic (2).
Isomorphic stamens occur when the stamens from both whorls have the same length and form, and the ventral appendage is usually inconspicuous or only articulated to the filament (Fig. 2C1−C2); in subisomorphic stamens the antepetalous and the antesepalous are almost the same size, and the shape can be the same or not in both whorls, with a conspicuous ventral appendage or only articulated to the filament (Fig.
2E1−E2); and dimorphic occurs when the stamens from the antepetalous whorl are ½ or less as long as the antesepalous and with a distinct shape and a conspicuous ventral appendage in the antesepalous whorl (Fig. 2D1−D2).
Stamens number: androecium with one whorl of fertile stamens (0); androecium
with two whorls of fertile stamens (1). Most genera of Melastomataceae have androecia with two whorls, both with fertile stamens (Rocha et al., 2016a). However, some species or even genera have androecia with one whorl of fertile stamens; the second whorl may be reduced to staminodes or lacking.
Anthers, number of sporangia: tetrasporangiate (0); polysporangiate (1). In
Melastomataceae, the anthers are usually described as tetrasporangiate and bilocular at maturity (Baumgratz et al., 1996; Almeda & Martins, 2001). Nevertheless, multilocular anthers (polysporangiate) may also occur in Microlicia, i.e., when the thecae are internally divided into numerous small locules along the dorso-lateral face (Baumgratz
et al., 1996; Lima et al., 2018). In general, tetra and polysporangiate anthers can be
distinguished without a stereomicroscope, with tetrasporangiate anthers having a smooth surface (Fig. 2D1−D2) while polysporangiate anthers have a bullate surface (Fig. 2C1, 2E1−E2).
Ovary locule number: two (0); three (1); four (2); five (3); more than five (4). This
character is highly variable between and within each genus of Microlicieae.
Ovary position: (0) superior; (1) partly inferior; (2) inferior. Although the ovary
position is considered a stable character in angiosperms (Endress, 2010, 2011), Melastomataceae species have perigynous flowers in which the ovary varies from superior to inferior (Basso-Alves et al., 2017). The ovary is superior when there is no adnation between ovary wall and hypanthium (Fig. 2F), partly inferior when the adnation reaches half the length of the ovary (Fig. 2G) and inferior when the ovary is fully adnate to the hypanthium (Fig. 2H).
Figure 2. Morphological variation in the recognized genera in Microlicieae. A, leaf blade showing the secondary and tertiary veins in Trembleya (M. Monge et al., 2595, UEC); B1, bristles on the hypanthium
apex in Chaetostoma, B2, detail of the same bristles (F. Almeda et al., 9434, UEC); C1, isomorphic
stamen and tetrasporangiate anther in Microlicia (W. Ganev, 2803, UEC), C2, flower with isomorphic
stamens (W. Ganev, 2803, UEC); D1−D2, dimorphic stamens and polysporangiate anthers in Microlicia
(F.S. Meyer, 2053, UEC); E1−E2, subisomorphic stamens and tetrasporangiate anthers in Microlicia (F.S.
Meyer, 1185, UEC); F, superior ovary in Microlicia (F.S. Meyer, 2053, UEC); G, semi-inferior ovary in
Lavoisiera (F. Almeda et al., 8562, UEC); H, inferior ovary in Lavoisiera (I.M. Araújo et al., 233, UEC);
I, fruit showing the basipetal dehiscence in Microlicia (F. Almeda et al., 8305, UEC); J, fruit showing the
acropetal dehiscence in Lavoisiera (F. Almeda et al., 8525, UEC); K, persistent columella in Lavoisiera
RESULTS
MOLECULAR MARKERS
A total of 501 new sequences from five DNA regions were generated during this study, and the final alignment of the concatenated sequences included 4,475 base pairs (bp), from which 1746 (39%) were variable and 1113 (24.9%) parsimony informative within the ingroup. From these, the nrETS was the most variable marker (65.3%) and the
atpF-atpH the less variable (26.6%). The characteristics of each aligned locus and the best fit
nucleotide substitution model are provided in Table 2.
Table 2. Datasets and summary statistical obtained from phylogenetic analyses.
TREESPACE
A treespace depicting topological distances between the gene tree bootstrap sets, the concatenated bootstrap set, the best tree, and the MCC trees of all data set is presented in Figure 3. In the first axis, there is not a clear separation of the bootstrap tree sets across all data sets, while in the second axis the plastidial and waxy trees are closer, the nrITS appears on an intermediary position overlapping with the Nuclear and Total concatenated trees, and the nrETS on the other extreme. The Nuclear and Total concatenated bootstrap sets show the highest cohesion in the treespace, indicating less phylogenetic uncertainty. Also, these two data sets are highly overlapping in the tree space, indicating great similarity. All data sets, to some extent and with varied intensity, present some degree of overlap among them, indicating that incongruences among the
nrITS nrETS Waxy atpF-atpH trnS-trnG Concatenated nuclear
Concatenated
plastidial
Total
Number of taxa sequenced 127 119 95 107 86 129 114 129
Alignment length (bp) 1004 674 843 927 1027 2521 1954 4475
Variable sites 326 (32.5%) 440 (65.3%) 381 (45.2%) 247 (26.6%) 352 (34.3%) 1147 (45.5%) 599 (30.7%) 1746 (39%) Parsimony informative sites (bp) 246 (24.5%) 361 (53.6%) 166 (19.7%) 115 (12.4%) 225 (21.9%) 773 (30.7%) 340 (17.4%) 1113 (24.9%)
Retention index (RI) 0.85 0.79 0.6 0.69 0.75 0.74 0.68 0.70
data sets could at least be partially explained by uncertainty of the nuclear and plastidial concatenated trees (available at the Supplementary Material - Figures S1−S2).
Figure 3. Visualization of the tree space occupied by 18 different data sets: bootstrap tree, best tree from ML analysis and the maximum clade credibility (MCC) tree from the BI analysis.
PHYLOGENETIC ANALYSES
In the data set, no individual was flagged as rogue. Among the gene trees, the median PP across nodes ranged from 0.05 in the atpF-atpH tree to 0.59 in the nrETS tree. The nrETS tree also had the higher amount of nodes with PP ≥ 0.95 (25% of the nodes), followed by nrITS (20%), waxy (19%); the plastid gene trees had lower PP values (atpF-atpH, 6% of the nodes, trnS-trnG, 19%). The median PP of the total concatenated tree was 0.76 and 38% of the nodes had support ≥ 95%. All splits in the backbone have low PP values and are usually supported by only one of the five gene trees. A summary of the PP values of the trees is listed in Table 3.
Table 3. Summary statistics for the posterior probabilities (PP) values in Bayesian trees.
The phylogenetic results showed three main lineages in Microlicieae (Fig. 4): Rhynchanthera (clade A), Poteranthera (clade B) and the remaining five genera in the tribe, hereafter referred to as Microlicia s.l. Within Microlicia s.l. (Fig. 4), seven well-supported clades were found: Trembleya s.s. (clade C), Stenodon and allies (clade D), Pinheiroi (clade E), Lavoisiera (clade F), Chaetostoma (Clade G), Viminalis (clade H); and Ericoides (clade I). Nevertheless, the resolution of their relationships is still impossible to infer, since they are clustered together into a polytomy. As well as,
Microlicia flava, Trembleya hatschbachii Wurdack & Martins, T. phlogiformis DC., and T. pradosiana which are unresolved species with no placement in clades along the
phylogenetic tree (Fig. 4).
Clades A and B. Rhynchanthera (clade A: PP = 1; BS = 100) is the sister group
of all other lineages in the tribe (PP = 1; BS = 100) and, together with Poteranthera (clade B), are the lineages which probably first diverged in the tribe Microlicieae (Fig. 4). Poteranthera is the sister group of Microlicia s.l. (PP =1; BS = 78).
Clade C. Trembleya s.s. is a strongly supported clade (PP = 1; BS = 98) in this
molecular phylogenetic hypothesis. It contains eight of 14 species of Trembleya sampled here, including the type species of the genus, T. rosmarinoides. (Fig. 1J).
Median % < 0.9 0.9 ≤ % < 0.95 % ≥0.95 Single trees nrITS 0.08 78 2 20 nrETS 0.59 70 5 25 Waxy 0.33 76 5 19 atpF-atpH 0.05 91 3 6 trnS-trnG 0.18 80 1 19 Concatenated trees Nuclear 0.6 66 6 28 Plastidial 0.04 87 1 12 Total 0.76 57 5 38
Figure 4. Majority consensus tree from Bayesian inference analysis of nuclear and plastidial concatenated sequences. Numbers on the left are posterior probabilities (PP) from Bayesian inference analysis and on the right are bootstrap support values (BS) from maximum likelihood analysis (only PP ≥ 0.90 and BS ≥ 71 are shown). The type species of each genus is marked with an asterisk (*). The colours and form of the symbols represent distinct genera. The letters indicate clades discussed in the text.
Clade D. Stenodon and allies includes the type species of the genus Stenodon (S.
suberosus, Fig. 1I) and 15 of 71 species of the genus Microlicia sampled here.
However, it had a strongly supported clade only in the BI analysis (PP = 0.96).
Clade E. Pinheiroi is a well-supported clade (PP = 0.98; BP = 94) with only two
species from Bahia states nested within it: Microlicia pinheiroi Wurdack and M.
giulietiana A.B. Martins & Almeda.
Clade F. Lavoisiera clade has all 18 species of the genus Lavoisiera sampled in
this study. It forms a strongly supported clade (PP = 1; BS = 89%), however, the relationships among its species are not resolved.
Clade G. Chaetostoma clade is fomed by all five species of the genus
Chaestostoma sampled here. The clade is highly supported in the BI and moderately
supported in the ML analysis (PP = 1; BS = 83%).
Clade H. Viminalis clade has five of 71 species of Microlicia sampled in this
study. It has support only in the BI analysis (clade K: PP = 1). Microlicia viminalis is the sister group of the remaining species in this clade (PP =1; BS = 80).
Clade I. Ericoides clade includes the type species of the genus Microlicia (M.
ericoides), most of the Microlicia species sampled here (52 out of the 70), including all
undescribed species, and some species of Trembleya (4 out of the 14). It is a strongly supported clade in the BI analysis but without support in the ML (clade L: PP = 0.96).
ANCESTRAL STATE RECONSTRUCTION
The ancestral state reconstructions indicated that most characters have some degree of homoplasy in Microlicieae. The ovary locule number and flower arrangement are the characters with more change in the tribe (Table 4). However, the bristles on the hypanthium apex, can be considered a diagnostic character to Chaetostoma clade and
