• Nenhum resultado encontrado

Pharmacological and Genetic Evidence for Gap Junctions as Potential New Insecticide Targets in the Yellow Fever Mosquito, Aedes aegypti.

N/A
N/A
Protected

Academic year: 2017

Share "Pharmacological and Genetic Evidence for Gap Junctions as Potential New Insecticide Targets in the Yellow Fever Mosquito, Aedes aegypti."

Copied!
15
0
0

Texto

Loading

Imagem

Table 1. dsRNA template synthesis primers. Each primer set consists of an innexin specific region for amplification of the target gene from plasmid, and the T7 promoter sequence ( TAATACGACTCACTATAGGGAGA ).
Table 2. qPCR primer pairs. Each set of primers was selected for innexin specificity and determined specific through melt curve analysis and sequencing (MCIC, OARDC).
Fig 1. Dose-response curves of gap junction inhibitors injected directly into the hemolymph of adult female A
Fig 2. Dose-response curves of gap junction inhibitors applied directly to the cuticle of adult female A
+6

Referências

Documentos relacionados

From the unique identifiers of workers and establishments, we construct a large longitudinal data base that allows us to include various types of fixed effects to examine

In addition, decompositions of the racial hourly earnings gap in 2010 using the aggregated classification provided by the 2010 Census with 8 groups, instead of the one adopted in

The probability of attending school four our group of interest in this region increased by 6.5 percentage points after the expansion of the Bolsa Família program in 2007 and

Alguns destes aspectos sensoriais e diferenças da carne de suínos da raça Bísara em relação à carne de suíno comercial, podem estar relacionados com a

[r]

3: contour maps of temephos resistance in Brazilian populations of the yellow fever mosquito ( Aedes aegypti ) generated using spatial inter- polation.. The colour legend indicates

Nevertheless, there are exceptions: in rat leptomeningeal cells (8), and in a rat liver epithelial cell line (IRA 20) (54) the phosphorylated forms of Cx43 predominate and TPA

Ousasse apontar algumas hipóteses para a solução desse problema público a partir do exposto dos autores usados como base para fundamentação teórica, da análise dos dados