• Nenhum resultado encontrado

Cobalamin Receptors: Transitions for Novel Functions?

N/A
N/A
Protected

Academic year: 2021

Share "Cobalamin Receptors: Transitions for Novel Functions?"

Copied!
56
0
0

Texto

(1)

Cobalamin

Receptors:

Transitions

for Novel

Functions?

Diogo Jorge Faria Oliveira

Mestrado em Bioquímica

Departamento de Química e Bioquímica 2017

Orientador

Raquel Ruivo, Investigadora Pós-Doutorada, CIIMAR

Coorientador

Filipe Castro, Professor Auxiliar Convidado da FCUP e

Investigador Auxiliar do CIIMAR

(2)
(3)
(4)
(5)

Abstract

Vitamin B12, or cobalamin, is a nutrient that is essential in human diet. This cofactor is a

crucial participant in the conversion of homocysteine to methione, by methionine synthase, and the conversion of CoA to succinyl-CoA by methylmalonyl-CoA mutase: participating in the citric acid cycle, haemoglobin synthesis, DNA and protein methylation and, possibly, nerve myelination. After absorption, transcobalamin transports this vitamin in the blood and both are internalized in target cells by the transcobalamin receptor (CD320/TCblR). This receptor plays a key role in brain vitamin B12 internalization. Structurally, this transmembrane receptor contains two LDLR class A

repeats, domains that are typical of lipoprotein receptors, which suggests a common evolutionary origin. After examining the “locus of origin” of its coding gene, we found that it is well conserved in mammals, birds, reptiles, amphibians and fish. However, while mammals exhibit high conservation of the two-domain receptor, other groups display receptors with variable length. In the case of fishes and amphibians, they retain a gene coding for a longer receptor, with additional LDLa repeats and other domains similar to lipoprotein receptors. Analysis of the “locus of origin” of other lipoprotein receptors revealed that CD320, VLDLR, LDLR and LRP8 likely originated from the same ancestral gene through the two rounds of genome duplication at the basis of vertebrate origin. These observations put forward a, structurally longer, 2R originated CD320, that underwent successive truncation events that gave origin to the vitamin B12-specific

receptor. To elucidate the functional evolution of cobalamin metabolism in vertebrates, cell-based internalization assays are currently being carried out.

Keywords: Vitamin B12, Transcobalamin Receptor, CD320, Membrane Receptor

(6)
(7)

Resumo

A vitamina B12, também conhecida como cobalamina, é um nutriente essencial na dieta

humana. Este cofator é um participante crucial na reação de conversão de homocisteína em metionina, pela enzima metionina sintetase, e na conversão de metilmalonil-CoA em succinil-CoA, pela metilmalonil-CoA mutase: participando no ciclo de Krebs, síntese de hemoglobina, metilação de proteínas e DNA e, possivelmente, mielinização nervosa. Após absorção, a transcobalamina transporta esta vitamina na corrente sanguínea sendo ambos internalizados nas células alvo pelo recetor de transcobalamina (CD320/TCblR). Este recetor contém dois “LDLR class A repeats”, domínios tipicamente encontrados em recetores de lipoproteínas, o que sugere uma relação evolutiva. Análise do “locus of origin” do seu gene codificante revelou que este é bem conservado em mamíferos, aves, répteis, anfíbios e peixes. No entanto, apesar de os mamíferos exibirem elevada conservação do recetor com dois domínios, os outros grupos detêm recetores com comprimentos variáveis. No caso dos peixes e anfíbios, estes retêm um gene que codifica um recetor mais comprido, com “LDLa repeats” adicionais e outros domínios semelhantes aos de recetores de lipoproteínas. Análise do “locus of origin” de outros recetores de lipoproteínas revela que CD320, VLDLR, LDLR e LRP8 deverão ter originado do mesmo gene ancestral através das duas rondas de duplicação genómica na base da origem dos vertebrados. Estas observações indicam a existência de um CD320 mais comprido, originado por 2R, que sofreu eventos de truncagem sucessivos e deu origem ao recetor específico para a vitamina B12. De modo a elucidar a evolução

do metabolismo da cobalamina em vertebrados, encontram-se em curso ensaios de internalização celulares.

Palavras-chave: Vitamina B12, Recetor da Transcobalamina, CD320, Evolução de

(8)
(9)

Table of Contents

Introduction ... 1

Cobalamin ... 1

Structure and role ... 1

Absorption and metabolism ... 2

Cobalamin deficiency ... 4

The transcobalamin receptor: from gene to function ... 4

Isolation ... 4

CD320/TCblR protein structure, function and targeting ... 5

Knock-out mouse model ... 7

Evolution by Gene Duplication ... 7

Objectives ... 8

Materials and Methods ... 9

Results ... 13

Synteny analysis ... 13

Structure of the CD320 coding proteins ... 14

Mammals ... 14

Birds ... 15

Reptiles ... 16

Xenopus tropicalis and fishes ... 17

The lipoprotein receptor/CD320 family ... 17

Phylogenetic tree ... 19

Functional assays ... 21

CD320 cloning and cell expression ... 21

TCN2 cloning, production and purification ... 23

TCN2-B12 internalization essay ... 23

Discussion ... 29

Future perspectives ... 30

References ... 33

(10)
(11)

Table of Figures

Figure 1 – Structure of vitamin B12 ... 1

Figure 2 – Enzymatic reactions that involve B12 ... 2

Figure 3 – B12 absorption, delivery and reabsorption ... 3

Figure 4 – The structure of LDLa repeats ... 6

Figure 5 – Possible fates of duplicated genes ... 8

Figure 6 – Vitamin B12 internalization assay ... 12

Figure 7 – Synteny analysis of CD320 ... 13

Figure 8 – Mammal CD320 domains ... 14

Figure 9 – Bird CD320 domains ... 15

Figure 10 – Reptile CD320 domains ... 15

Figure 11 – Amphibians and fishes CD320 domains. ... 16

Figure 12 – Synteny of CD320 and its paralogues. ... 18

Figure 13 – Structure of CD320, VLDLR, LDLR and LRP8 ... 18

Figure 14 – CD320 family phylogenetic tree ... 20

Figure 15 – CD320-EGFP in COS-1 cells. ... 22

Figure 16 – TCN2 western blot. ... 23

Figure 17 – Immunofluorescence image of protocol 1. ... 25

Figure 18 – Immunofluorescence image of protocol 4. ... 26

Figure 19 – Immunofluorescence images of protocol 5 ... 27

Figure 20 – Evolutionary history of the CD320 gene family ... 32

Table 1 – Primer list ... 10

Table 2 – Ligands internalized by LRP family members ... 21

Appendix Figure 1 - Subtree of LRP4 from Figure 14... 37

Appendix Figure 2 – Subtree of VLDLR from Figure 14 ... 37

Appendix Figure 3 - Subtree of CD320 from Figure 14 ... 38

Appendix Figure 4 – Subtree of LDLR from Figure 14 ... 39

Appendix Figure 5 - Subtree of LRP8 from Figure 14... 39

(12)
(13)

Abbreviation List

TCN2 – Transcobalamin

TCblR – Transcobalamin receptor

TCN2-B12 – Transcobalamin receptor/Vitamin B12 complex

MS – Multiple sclerosis

LDLR – Low-density lipoprotein receptor VLDLR – Very-low-density lipoprotein receptor LRP2 – Low-density lipoprotein-related protein 2 LRP4 – Low-density lipoprotein-related protein 4 LRP8 – Low-density lipoprotein-related protein 8 LRP – Low-density lipoprotein-related

CNS – Central nervous system

LDLa repeat – Low-density lipoprotein receptor type A repeat LDLb repeat – Low-density lipoprotein receptor type B repeat EGF-like – Epidermal growth factor-like

EGFP – Enhanced green fluorescent protein CMV promoter – Cytomegalovirus promtoer BSA – Bovine serum albumin

(14)
(15)

Introduction

Cobalamin

Structure and role

Cobalamins are essential, water-soluble vitamins that compose the vitamin B12 group.

Structurally, these compounds include a complex formed by a central cobalt atom coordinated to the four nitrogen atoms of a tetrapyrrolic corrin ring, and to a dymethylbenzimidazole in the lower surface of the ring. The chemical nature of the upper ligand of this cobalt atom is dependent on the cobalamin type – the inactive cyanocobalamin and hydroxocobalamin occur when this ligand is cyanide or hydroxyl group, and the active forms methylcobalamin and adenosylcobalamin include methyl or deoxyadenosine ligands (Figure 1) [1, 2]. All four of these vitamers can be inter-converted by removal of the upper ligand and subsequent introduction of the required substituting group; this is performed by a series of proteins named methylmalonic aciduria and homocystinuria type A, B, C, D, E, F, G and J proteins [3]. Cobalamin active forms are particularly important as coenzymes, acting in two major reactions in

Figure 1 – Structure of vitamin B12. On the left, the general structure of vitamin B12, R representing the substitutable ligand; representation of the plane of the ring and the position of each ligand for cyanocobalamin, methylcobalamin and adenosylcobalamin, in this order. Image extracted from reference [1].

(16)

2 FCUP

Cobalamin Receptors: Transitions for Novel Functions?

mammalian cells. Methylcobalamin participates in the methyltransferase reaction for the conversion of homocysteine into methionine, catalysed by methionine synthase, which simultaneously converts 5’-methyl-tetrahydrofolate into tetrahydrofolate. Hence, this reaction has a crucial role in two cycles – in tetrahydrofolate recycling, an important cofactor for the biosynthesis of nucleotides, and in methionine regeneration, that can then be converted into S-adenosyl methionine to act as a methyl group donor. Adenosylcobalamin serves as coenzyme in the isomerization of L-methylmalonyl-CoA into succinyl-CoA by methylmalonyl-CoA mutase, important in the metabolism of odd-chained fatty acids and branch-odd-chained amino acids. These reactions are depicted in Figure 2.

Absorption and metabolism

Considering vitamin B12 is only synthesized by some microorganisms, animals need to

take it up from their diet. To this end, in humans, there is a set of multiple carrier proteins that relay the vitamin between themselves, transporting it through the digestive tract, the bloodstream and ultimately delivering it to target cells. Haptocorrin, the first intervenient in the internalization pathway, is present in the saliva where it binds the ingested B12,

Figure 2 – Enzymatic reactions that involve B12. Representation of the reactions mediated by the active forms of

cobalamin in each respective cellular compartment – recycling of THF in the cytosol and isomerization of Methylmalonyl-CoA in mitochondria. Image extracted from reference [12].

(17)

shielding it from hydrolysis in the acidic environment of the stomach. After reaching the duodenum, haptocorrin is degraded by pancreatic enzymes freeing the vitamin and allowing it to bind the gastric intrinsic factor [4]. This carrier protein is resistant to pancreatic degradation and is synthesized by the parietal cells of the stomach [5]. The switch in carrier protein allows for the interaction and subsequent internalization of the vitamin B12-intrinsic factor complex by enterocytes in the terminal ileum possessing the

cubam internalization complex in the brush border. This protein complex comprises the multifunctional endocytic receptor cubilin, responsible for the ligand interaction with the intrinsic factor-B12 complex, present on the surface of the membrane and bound to the

second intervenient of the complex, amnionless, an intermembrane protein that seems to be responsible for the endocytosis mechanism of the receptor complex [6, 7]. Ensuing internalization, the intrinsic factor is degraded in lysosomes and B12 can then exit the

cells into the bloodstream through the multidrug resistance protein 1, an ABC transporter [8]. In the bloodstream, there are two carrier proteins in charge of the transportation of B12 – haptocorrin and transcobalamin (TCN2). Given its faster binding kinetics, lower

specificity and glycosylation status, plasma haptocorrin has been suggested to use liver asialoglycoprotein receptors to 1) recycle B12, to an additional round of intestinal

Figure 3 – B12 absorption, delivery and reabsorption. Schematic representation of the cobalamin absorption

pathway, entering the blood through intrinsic factor-B12-Cubam interaction; delivery to target cells from the bloodstream through interaction of TCN2-B12 with CD320; reabsorption of TCN2-B12 in proximal tubules mediated by the cubam complex and megalin. Image extracted from reference [12].

(18)

4 FCUP

Cobalamin Receptors: Transitions for Novel Functions?

absorption, as well as 2) excrete toxic B12-derived molecules [9, 10]. TCN2, on the other

hand, is responsible for cell delivery of vitamin B12 by interacting with the transcobalamin

receptor (CD320/TCblR) in target cells [11]. The pathway is represented in Figure 3 [12].

Cobalamin deficiency

Cobalamin deficiency can be caused by inadequate dietary intake, as in the case of strict vegetarian diets, or by inborn errors in genes coding for B12 enzymatic modules and

uptake machinery. They combine a group of disorders generally termed methylmalonic acidemia with homocystinuria, due to the ineffectiveness of the organism to metabolize these substrates, leading to the build-up of homocysteine and L-methylmalonyl-CoA in the bloodstream, which is hypothesized as being the cause of the neurological complications of B12 deficiency [13-15]. Cobalamin deficiencies are characterized by

megaloblastic anaemia, lethargy, failure to thrive, developmental delay, intellectual deficit and seizures, and, during pregnancy, potential foetal neural tube defects [14-16]. In addition to the abovementioned biochemical functions, cobalamin and the methionine pathway were also suggested to participate in the synthesis and/or maintenance of myelin sheaths; yet, the underlying mechanism is not fully understood [17].This possible role in myelination could account for the neurological deterioration and brain abnormalities commonly observed in patients, leading to neuropsychiatric symptoms: spinal cord myelopathy, myelitis, brain white matter loss, delayed myelination and atrophy of the corpus callosum, the largest bundle of myelinated neurons in the human brain [18, 19]. Curiously, B12 deficiency exhibits inflammatory and neurodegenerative

pathophysiological characteristics comparable to Multiple Sclerosis (MS); conversely, low B12 levels seem frequent in MS patients [17].

The transcobalamin receptor: from gene to function

Isolation

CD320/TCblR binds the TCN2-B12 complex with high affinity internalizing it through

receptor-mediated endocytosis. Its specificity towards this complex does not allow binding to similar proteins, like haptocorrin or even free TCN2 [11]. The existence of a membrane receptor for TCN2-B12 was first proposed in 1975 by testing the affinity of

TCN2-B12 for plasma membranes isolated from rat liver [20]. Subsequent attempts to

isolate and characterize this receptor were made, but this proved to be a challenging task as separate groups would obtain different proteins with conflicting characteristics after isolation [21-24]. It was not until decades after it was first discovered that, in 2009, Quadros et al. would succeed in definitively identifying the protein and its respective

(19)

encoding gene [11] – it was a protein that had been previously identified as being involved in B cell development, giving it the alternative names of 8D6 or CD320 antigen [25, 26].

CD320/TCblR protein structure, function and targeting

In humans, the gene encoding the protein, CD320, is located on chromosome 19 and is divided into 5 exons. The receptor is a short 282 amino acid long protein including a cleavable 31-residue signal peptide, yielding a final 251 amino acid long membrane receptor. Despite its short length, it exhibits a molecular weight of 58 kDa in SDS-PAGE due to extensive glycosylation. In the extracellular domain, it includes two 36 amino acid long low-density lipoprotein receptor class A repeats that are responsible for ligand binding [11]. These repeats, characteristic of lipoprotein receptor-related proteins, are composed of several conserved, mostly acidic residues that bind calcium through their side chain or backbone carbonyl groups; the binding of calcium to these repeats is critical for the TCN2-B12 complex internalization. LDLa repeats also contain six cysteine

residues that form three disulphide bonds: cysteines 1-3, 2-5 and 4-6 (Figure 4). Since the repeats are characteristic of lipoprotein receptor proteins, their presence in CD320/TCblR suggests that it belongs to the lipoprotein receptor family. This family is composed of several members like the Low-Density Lipoprotein Receptor (LDLR), the Very-Low-Density Lipoprotein Receptor (VLDLR), Lipoprotein-Related Protein 2 and 8 (LRP2 and LRP8) – receptors that can bind multiple ligands, including TCN2-B12, for

internalization or even cell signalling. Despite their similarity, CD320/TCblR does not bind ligands typical of the lipoprotein receptor family like the Low-Density Lipoprotein (LDL) or the Receptor-Associated Protein, suggesting it underwent an evolutionary specialization for TCN2-B12. The two LDLa repeats are separated by a different

cysteine-rich, intrinsically disordered structure, which ensures that each repeat binds different regions of the same B12-transporting TCN2; despite this, the structure does not seem to

be required for ligand binding. Cell culture assays reveal that both LDLa repeats are crucial for binding of TCN2-B12 to CD320 to occur, while other structures like the inter

LDLa linker, or even most of the protein after the second repeat, are not necessary for this interaction [27]. Contrary to these results, Alam et al. (2016) were able to generate crystal complexes of each individual repeat bound to TCN2-B12, showing that the

complex with the second repeat has a higher stability than with the first one. Crystallographic structure of the CD320/TCblR-TCN2 complex confirmed that the second repeat is of notable relevance in the receptor-ligand interaction. It also revealed that the binding interface between the LDLa repeats and TCN2 is, among other interactions, especially dependent on the formation of an “acidic necklace”, as seen in

(20)

6 FCUP

Cobalamin Receptors: Transitions for Novel Functions?

other LRP family members, forming salt bridges between two calcium coordinating aspartates and lysines from TCN2 [28]. Regarding the intracellular portion of the receptor, the sequence contains a dileucine-based signal and two PDZ domain binding motifs that seem to be responsible for signalling for internalization [27]. PDZ domain binding motifs are recognized by NHERF family members, mostly expressed in polarized epithelia, which establish protein-protein interaction networks with a wide range of proteins, including receptors, transporters and channels [29, 30]. Besides its scaffolding role, NHERF family members were also shown to modulate the activity of protein assemblages [29, 31, 32]. The internalization of ligands by receptors containing repeats that involve calcium-binding (CR, CUB, etc.) seem to involve some very particular mechanisms of ligand, release associated with the changing environment in the endocytic vesicles. After internalization, the export of calcium from the early endosomes causes the interior of these vesicles to achieve very low concentrations of the ion, leading to displacement of the ligand from the receptor. A different mechanism, termed “histidine switch”, is triggered by the decreasing pH inside the endocytic vesicles. The increase in acidity inside the vesicle may be responsible for protonation of specific histidine residues which can promote a structural rearrangement of the receptor or ligand that triggers their dissociation. The change in charge of the histidine residue also introduces the possibility of displacement of the calcium ion from the repeats promoting the subsequent ligand release [33]. A proposed mechanism for TCN2-B12 release after internalization relies on

this “histidine switch” mechanism, possibly mediated by two histidine residues from transcobalamin that are positioned in proximity to the interaction interface, or by the

Figure 4 – The structure of LDLa repeats. Alignment of the two LDLa repeats found in the CD320 of various mammalian

species. The logo in the top represents the level of conservation of each residue – larger letters mean that the residue is highly present in that position. In the sequences, only the completely conserved residues are shown, the rest are represented by dots. Dashes represent gaps in the alignment. The connected cysteines form disulphide bonds; the residues denoted with a single arrow are acidic and bind calcium through their side-chain groups and the residues denoted with double arrows bind calcium using their carbonyl groups. Image obtained using the Geneious 10.0.6. software and adapted.

(21)

calcium-binding histidine present in the second LDLa repeat. In support of this hypothesis, in an in vitro assay low pH levels induced TCN2-B12 release from the receptor

[28].

Knock-out mouse model

A CD320 knock-out mouse model suggests that the receptor is critical for TCN2-B12

internalization in the CNS, as there is an accumulation of homocysteine and methylmalonic acid in the CNS organs. In other tissues, however, additional yet unidentified mechanisms seem to compensate for the lack of CD320. Also intriguing was the non-lethality of the null embryos. Thus, additional mechanisms seem to compensate for the lack of CD320 in peripheral tissues and during development. A possible compensatory mechanism is LRP2, the large spectrum receptor belonging to the lipoprotein receptor family [34]. In absorptive renal brush-border epithelium, the Cubilin-LRP2 complex was shown to mediate transcobalamin-B12 internalization, as observed

with the intrinsic factor in the small intestine [35]. Thus, it is plausible to hypothesize that the Cubilin-LRP2 complex may act as the sought compensatory mechanism in peripheral tissues. Nonetheless, LRP2 is unable to compensate for the loss of CD320 in adult neural tissues. Despite being expressed in CNS cells, LRP2 exhibits differential expression at distinct developmental stages: being expressed in cortical areas only during the embryonic stage. In the developing CNS, their expression is progressively restricted to the ventricular system, namely the plexus choroid, major site of cerebrospinal fluid (CSF) production and route for blood-CNS exchange [36]. Thus, while compensating for the lack of CD320 during development, LRP2 expression in adult mice seems to impair such mechanism. This would also explain the non-lethality of the knock-out [37].

Evolution by Gene Duplication

Gene duplication is a critical evolutionary driver, generating new genes and functions. Tandem or whole genome duplications provide redundant genetic material on which distinct evolutionary pressures act, originating novelty. Nonetheless, the most common fate for duplicated genes seems to be gene loss; yet, other possible outcomes are likely: in the cases of highest divergence, the genes might resolve into non-overlapping functions; they can also maintain partial similarity of structure and perform complementary functions or simply encode the same protein and be subject to differential gene regulation Figure 5 [38]. New genes originated through duplication are known as paralogs.

(22)

8 FCUP

Cobalamin Receptors: Transitions for Novel Functions?

Duplicated genes can arise from two possible events: they can be duplicated locally in small segments of the chromosome, through tandem duplications, leading to the formation of a small number of new genes, or through organism polyploidy in which the whole genome is duplicated [39]. This phenomenon creates a very large number of new genes, allowing for the possibility of a huge evolutionary leap. Thus, the 2R hypothesis proposes that the origin of vertebrates is characterized by two rounds of whole genome duplications, allowing the possibility of divergence of the original genes that existed before this event into up to 4 differently functionalized genes, when no gene losses occur for the new copies [40].

Objectives

Although vitamin B12 is an essential nutrient

across vertebrates, CD320/TCblR has, so far, only been identified in mammals [11, 41]. Thus, the present work present aims to (1) elucidate the evolutionary history of the CD320/TCblR by exploring the relationship of this receptor with its paralogues.

Furthermore, using cell-based internalization assays, the present work further aims to (2) functionally characterize the affinity CD320/TCblR family members have towards B12

and other relevant ligands: such as lipoprotein receptor ligands. Together these results should contribute for a better understanding of the evolution of vertebrate B12 metabolism

and of the evolutionary and functional relationship of CD320/TCblR and the lipoprotein receptor family.

Figure 5 – Possible fates of duplicated genes. In a,

the most common occurrence, the gene is lost after duplication. In b, strong differential pressures induce a very large change in the gene structure, originating genes with non-overlapping functions. In c, different functional substructures of the gene are maintained in each copy so they perform complementary functions. In d, the regulatory regions of both genes diverge, allowing for differential regulation of the same gene. Image extracted from reference [38].

(23)

Materials and Methods

Sequence retrieval and gene synteny

Previously annotated CD320 sequences from selected mammalian, bird and reptile species were obtained from the GenBank database. Xenopus and fish sequences were identified by running a BLASTp in GenBank using various other CD320 sequences as the query. Synteny analysis of the retrieved genes was conducted using their genome location on the same database. The LDLR, LRP4, LRP8 and VLDLR protein sequences used were previously annotated in GenBank. Appendix Table 1 lists the accession numbers of all the protein sequences retrieved.

Sequence alignment and phylogenetic analysis

The retrieved protein sequences were aligned with the MAFFT [42] software web service (http://mafft.cbrc.jp/alignment/software/) using the automatic settings. The output alignment was used to construct a phylogenetic tree using the PhyML 3.0 software [43] with Smart Model Selection web service (http://www.atgc-montpellier.fr/phyml-sms/) in default settings. aBayes was used to compute likelihood of branch support.

Structure prediction

Protein secondary structure was predicted using the Interpro web service (https://www.ebi.ac.uk/interpro/) [44]. Transmembrane domains were predicted using the TopCons membrane topology prediction web service (http://topcons.net/) [45].

RNA extraction and cDNA synthesis

Xenopus tropicalis (African clawed frog) tissues were collected and preserved in RNA

later and the total RNA was then isolated and purified using an Illustra RNAspin Mini RNA Isolation Kit (GE Healthcare, UK) according to manufacturer’s recommendations with on-column DNase I digestion. RNA quality was assessed by electrophoresis and its concentration determined with a microplate spectrophotometer (Synergy HT Multi-Mode Microplate Reader, Biotek). Mus musculus (mouse) heart total RNA was obtained as a control sample contained in the SMARTer RACE 5'/3' Kit (Clontech). First-strand cDNA was synthesized from total RNA using the iScriptTM cDNA Synthesis Kit (Bio-Rad), according to the manufacturer’s instructions.

Coding sequence isolation

Mouse CD320 and TCN2 cDNA were amplified from heart tissue cDNA by PCR using the Phusion Flash DNA polymerase (Thermofisher). Frog TCN2 and CD320 were

(24)

10 FCUP

Cobalamin Receptors: Transitions for Novel Functions?

amplified from a liver and kidney tissue cDNA pool by PCR. The primers used in the reactions are listed in Table 1. Each PCR reaction was carried out as per supplied protocol: an initial denaturation step of 10s at 98 °C, followed by denaturation for 1s at 98 °C, annealing at the annealing temperatures specified on Table 1 for 5s and an extension step at 72 °C for 15s per kilobase of amplified gene length. These three steps were repeated for 35 cycles. A final extension step was then executed at 72 °C for 1 min. The products were then purified using the NZYGelpure kit (NZYTech). Afterwards, the purified cDNA were cloned into pGEM®-T Easy vectors (Promega). The sequence was confirmed by automatic sequencing services (GATC-biotech).

Cloning into expression vectors

For protein purification purposes, mouse and frog TCN2 cDNAs were cloned into the pcDNA™3.1/myc-His(-) B vector (Invitrogen), using the restriction enzyme binding sites of XhoI and HindIII. For sub-cellular localization studies, CD320 cDNAs were cloned into the pEGFP-N1 (Clontech) vector using the restriction enzyme binding sites for the pairs

XhoI/EcoRI and NheI/HindIII, respectively. The primers listed in Table 1were used to

add the restriction enzyme cut sites to the cDNA.

Table 1 – Primer list. List of the primers used in the experimental protocols, along with the used annealing temperature.

Primers are listed from 5’ to 3’.

Primers used to amplify the cDNA

Gene Primer sequence

Annealing temperature

/°C Mouse TCN2 Forward AGTCAGACAAGCCCTCAAG 65,1

Reverse TCAGGAGGGATCGTAGGA

Mouse CD320 Forward AGTTCGGCTAGCTGTTGG 63,9 Reverse CTCCTTTGTCCCAGTCTGA

Frog TCN2 Forward ACTTGCAAGGGAGACAATGG 63,4 Reverse CCCAGTAGGACACCGTCAGT

Frog CD320 Forward GAGTGAGTGGAGTAGTGATG 56,0 Reverse CTCATCTTCATCTTCACTTT

Primers used to add restriction sites to clone into pcDNA™3.1/myc-His(-) B

Gene Primer sequence

Annealing temperature

/°C Mouse TCN2 Forward TAAACTCGAGAAGATGGAGCTCCTGAAGGCG 72,0

Reverse AGTCAAGCTTCCCCATCTAACTAGCCGCA

Frog TCN2 Forward GAACCTCGAGAAGATGGAGGCTTACCTTTG 70,7 Reverse AGTCAAGCTTCCCCAATTACTCAACCGC

Primers used to add restriction sites to clone into pEGFP-N1

Gene Primer sequence

Annealing temperature

/°C Mouse CD320 Forward ATATCTCGAGATGGCGCGGGGCGGAGCT 69,4

Reverse GCTTGAATTCCGATCAGAGAGGTTTTCCT

Frog CD320 Forward ATATGCTAGCCATGTGCTGTGGTACGTTC 71,0 Reverse AAATCTCGAGCTTGTCCTCATCTTCATCTTCACT

(25)

TCN2 expression and purification

COS-1 cells (2×105) were seeded in complete Dulbecco’s Modified Eagle Medium

(DMEM) (PAN biotech) containing 10% foetal bovine serum and 1% penicillin and streptomycin in a 24-well plate. These cells were then transfected with 1 μg of the expression plasmids containing mouse and frog TCN2 using 2 μL Lipofectamine® 2000 (Thermofisher) per well. After 48h, the incubation medium was harvested and HisTrap FF 1mL columns (GE Healthcare) were used to purify the 6×His-tagged TCN2. Partial purification was carried out as per supplied protocol with a one-step elution. Purification was confirmed by SDS-PAGE and Western Blotting using a primary rabbit monoclonal Anti-6X His tag® IgG antibody (Abcam, ab200537) and a secondary Goat Anti-Rabbit IgG conjugated to horseradish peroxidase (Abcam, ab6721).

CD320 expression and internalization assays

Various protocols were tested in an attempt to perform the internalization assays:

Protocol 1 – 1,5×105 COS-1 cells were seeded in complete DMEM containing 10% foetal

bovine serum and 1% penicillin and streptomycin in a 24-well plate containing coverslips. The cells were transfected with the plasmids containing mouse and frog CD320 using Lipofectamine® 2000 (Thermofisher) and incubated for 48h. DMEM without phenol red, charcoal stripped (PAN biotech) was incubated for 1h with purified 6×His-tagged TCN2 and cobalamin (SIGMA) to form the TCN2-B12 complex. The cells were incubated with

the TCN2-B12 containing medium for 1h. After fixation in 4% paraformaldehyde in PBS

supplemented with 100μM CaCl2 and 100μM MgCl2 (PBS++), the cells were simultaneously permeabilized and blocked by incubation with 0,05% saponin/0,2% BSA in PBS++ for 20 minutes. They were then incubated with the primary rabbit monoclonal Anti-6X His tag® IgG antibody (Abcam, ab200537) diluted 1:300 for 1h, washed with PBS++ and incubated with a donkey anti-rabbit IgG (H+L) secondary antibody conjugated to the Alexa Fluor 568 fluorescent dye (Thermofisher, A10042) diluted 1:500 for 1h. The coverslips were then washed in PBS++ and mounted in slides with Fluoroshield™ with DAPI (SIGMA). A schematic representation of the protocol is portrayed in Figure 6.

Protocol 2 – This protocol is similar to protocol 1 but instead of simultaneous permeabilization and blocking, the cells were blocked after permeabilization with a 1% BSA solution in PBS++. After fixation in % paraformaldehyde in PBS++, the cells were permeabilized by incubation with 0,05% saponin in PBS++ for 20 minutes. The cells were then blocked using 1% BSA in PBS++.

(26)

12 FCUP

Cobalamin Receptors: Transitions for Novel Functions?

Protocol 3 – This protocol is analogous to protocol 2 but HeLa cells were used instead of COS-1 cells.

Protocol 4 – In this protocol, rabbit Anti-6X His tag primary antibody was added to the TCN2-B12 containing medium and incubated for 1h. This aimed at labelling externally

added 6×His-tagged TCN2 only, in order to reduce non-specific background. HeLa cells were used as in Protocol 3.

Protocol 5 – This protocol is analogous to protocol 4 but primary rabbit polyclonal anti-GFP IgG antibody (Abcam, ab6556) was used instead of the Anti-6X His tag antibody. This aimed at detecting, not TNC2 but CD320 fused to GFP.

Figure 6 – Vitamin B12 internalization assay. Schematic representation of protocol 1. More information about the steps

(27)

Results

Synteny analysis

First, putative CD320 protein sequences of representative vertebrate species were retrieved from GenBank. Synteny analysis showed a high conservation of the CD320 genomic loci across vertebrates, suggestive of an orthologous relationship (Figure 7). Next, the obtained protein sequences were aligned and their domains and respective conservation patterns analysed. High structural divergence was found when comparing mammalian CD320 sequences with other vertebrate orthologues.

Following this, a closer analysis of the structural domains present in each orthologue was conducted. Due to the high divergence of structure between orthologues, this analysis will be subdivided, detailing each of the structural patterns found in separate subchapters.

Figure 7 – Synteny analysis of CD320. Synteny analysis of the CD320 locus for various representative species. The

analysed species’ name is displayed on the left, followed by the chromosome or scaffold in which the gene is located. Each coloured box represents a different orthologue in each species. The “-l” after a gene represents a non-annotated gene that was found to be similar to the gene’s given name by BLASTp; “-p” represents a pseudogene.

(28)

14 FCUP

Cobalamin Receptors: Transitions for Novel Functions?

Structure of the CD320 coding proteins

Mammals

Various mammalian proteins were analysed, and a schematic representation of the domains found in representative sequences can be seen in Figure 8. The mammalian CD320 is analogous to its human orthologue - a short transmembrane receptor containing two LDLa domains. Because the structure of these domains is very well known and characterised, it was possible to predict and annotate their positions by hand, starting on the first and ending on the last of the six mandatory cysteines. The conservation of these domains, critical for the TCN2- B12 internalization, was found to be

very high in this group. The flexible linker joining them was also found to be conserved in most sequences – it spans about 34 residues and contains six conserved cysteines, like LDLa domains. There were exceptions to the conservation, however – in the case of

Bos Taurus, this linker was shorter comprising only four of the cysteine residues; in

marsupials, in place of the linker, the alignment contains a third LDLa domain. Due to the structural similarity between the flexible linker and LDLa domains and the fact that marsupial sequences (Sarcophilus harrisii) contain an LDLa domain in the same position, it seems likely that this linker, that is only present in placental mammals, evolved from an ancestral LDLa domain. This degenerated domain, despite containing their signature conserved cysteines, mostly differs from the ordinary domain in the calcium-binding acidic amino acids.

Figure 8 – Mammal CD320 domains. Schematic representation of the domains found in various mammalian receptors.

The represented species are Homo sapiens, Mus musculus, Bos Taurus, Equus caballus and Sarcophilus harrisii. The yellow boxes represent LDLa domains; the faded ones represent degenerated linker domains; the red boxes represent transmembrane domains. The number at the end of each receptor is representative of its respective length.

(29)

Birds

The bird CD320 sequence, unlike mammals, is of shorter length and encompasses only one copy of the LDLa domains. The CD320 sequences found were mostly homogeneous in structure, and are represented by the sequence from Gallus gallus in Figure 9.

Figure 9 – Bird CD320 domains. Schematic representation of the structure of Gallus gallus CD320. The yellow box

represents a LDLa domain and the red box a transmembrane domain. The number at the end of the receptor is its amino acid length.

Figure 10 – Reptile CD320 domains. Schematic representation of the domains found in reptilian CD320 proteins. From

top to bottom, Alligator mississippiensis, Alligator sinensis, Gavialis gangeticus, Crocodylus porosus, Python bivittatus,

Pogona vitticeps and Gekko japonicus. The yellow boxes represent the LDLa domains, the gray boxes represent LDLa

domains with some sort of mutation, described in the text, and the red box represents the transmembrane domain. Above the boxes, the length of each domain is present, and the number at the end of the sequence is indicative of its length.

(30)

16 FCUP

Cobalamin Receptors: Transitions for Novel Functions?

Reptiles

In reptile species, the encoded receptor displays higher structural divergence than in the other species. As shown in Figure 10, except for the Alligator species, the receptors tend to be shorter in length when compared to mammals. Despite this, most of these receptors have three instances of the LDLa domain, like mammals. These domains, however, display a bizarre pattern of structural conservation: in Gavialis gangeticus (gharial) the receptor has all three domains intact; in Python bivittatus the first domain of the receptor has mutations in one of the mandatory cysteines and two of the characteristic negative-charge amino acids; in Gekko japonicus the first cysteine of the protein’s first domain is mutated, and in the second domain of both G. japonicus and Pogona vitticeps, a characteristic glutamic acid is mutated to an alanine. The receptor of Crocodylus porosus is even shorter than in the remaining reptiles, containing only one intact LDLa domain, and a second domain truncated in half. As for Alligator mississippiensis and Alligator

sinensis, their receptors are longer and include five copies of LDLa domains. In the case

of A. mississippiensis, there are two LDLa domains containing mutations in one of the acidic residues, and in the case of A. sinensis this mutation only exists in one of the domains.

Figure 11 – Amphibians and fishes CD320 domains. Schematic representation of the domains found in the fish’

and amphibians’ receptor. The represented species are Xenopus tropicalis, Latimeria chalumnae, Lepisosteus

oculatus, Danio rerio, Oryzias latipes, Poecilia Formosa and Callorhinchus milii. The yellow boxes represent LDLa

domains, the gray boxes LDLa domains that contain some sort of mutation, the green boxes epidermal growth factor-like calcium binding domains, the brown boxes LDL receptor class B repeats, and the red boxes the transmembrane domain. The EGF-like and LDLb domains were predicted using SMART and PROSITE, respectively, in the Interpro domain prediction web service.

(31)

Xenopus tropicalis and fishes

Fishes and amphibians, like reptiles, also display high divergence between the coding receptors, not only in the number of domains present, but also in the type of domain. These receptors are longer than the ones seen in other species, displaying up to five LDLa repeats and two distinct new types of repeats predicted using the Interpro web service: epidermal growth factor like calcium binding domains (EGF-like) and LDL receptor class B repeats (LDLb) (Figure 11). The EGF-like calcium binding domain, like the LDLa domain, is a short domain composed of about 40 amino acids characterized by containing six cysteine residues and by binding calcium in order to maintain its structural integrity. Unlike LDLa domains, however, this domain is not reported to be responsible for ligand internalization in any of the LDLR family members – in LDLR, it is the binding site for the proprotein convertase subtilisin/kexin type 9, which downregulates the receptors’ activity [46]. This domain seems to also have a key role in acidic-dependent ligand release after internalization in the LDLR [47]. LDL receptor class B repeats, also known as YWTD repeats, typically form a six-bladed beta-propeller domain when six repeats are found in tandem [48]. There is little information regarding the specific function of the beta-propeller domain, but it seems to act as a methylmalonic acid sensor for LRP2 stacking in kidney [49], and to be responsible for Sepp1 binding and internalization in LRP8 [50].

Some LDLa domains found in these receptors also differ from the typical LDLa domain – the first and second domain from O. latipes and P. formosa contain a mutation in a glutamic acid and the first domain from C. milii only contains four cysteines.

The lipoprotein receptor/CD320 family

Both EGF-like and LDLb repeats are archetypal domains in most LRP family members, thus, their presence in CD320 orthologues reinforces the hypothesis that these receptors are a part of the LRP family. To gain a better insight into how this proximity to the LRP family is characterised, the syntenic locus of various members from the family was compared to CD320. Several paralogues were found within the CD320, LRP8, VLDLR and LDLR neighbouring genes, depicted in Figure 12. Both human and spotted gar were used to perform the comparison since the number of paralogue neighbouring genes from human CD320 and LRP8 was low. A structural comparison between these related genes was also performed (Figure 13), revealing strong similarities between them and the longer orthologues from CD320. Since the other members of the LRP family are reported

(32)

18 FCUP

Cobalamin Receptors: Transitions for Novel Functions?

to contain six LDLb repeats, the number required to form the beta-propeller domain, and Interpro only predicts 4 to 5 domains for these receptors, the domains in this figure were predicted using an alignment between the receptors and a previous report for the sequence of the beta-propeller domain in LDLR [48].

The close structural similarity and the high number of paralogue neighbouring genes suggests that these Lrp paralogues might have been generated by the 2R event at the base of vertebrate origin. To confirm this hypothesis, the ancestral location of their

Figure 12 – Synteny of CD320 and its paralogues. Synteny analysis of the locus of the human LRP family members

CD320, LRP8, VLDLR and LDLR and Lepisosteus oculatus’ Cd320 and Lrp8. The numbers to the left of the genes

represent the genomic location of the displayed regions; in the case of human genes, the chromosome number is followed by the starting base pair for the LRP gene represented and the genome segment number. All four of these chromosomic regions map to the linkage group 1 according to reference [30].

Figure 13 – Structure of CD320, VLDLR, LDLR and LRP8. Schematic representation of the structure of the four

paralogues discussed in the text. Xenopus tropicalis’ orthologue was chosen to represent the CD320 structure. The

remaining paralogues are represented by the structure of human genes. The yellow boxes symbolize LDLa domains, the green boxes calcium binding EGF-like domains, the gray boxes LDLb domains, the light green non-calcium binding EGF-like domains, and the red boxes the transmembrane domain. The EGF-like domains were predicted using the Interpro web service.

(33)

genomic locus on the amphioxus genome was predicted, according to Putnam et al. [51]. In human, the genes are located in genome segments 19.1, 1.5, 9.2 and 19.2, and were thus allocated to linkage group 1 (Figure 12).

Phylogenetic tree

A phylogenetic tree using various protein sequences from CD320 and the remaining 2R paralogues was constructed, after being aligned with MAFFT. A total number of 112 sequences were considered: 21 from VLDLR, 48 from CD320, 15 from LDLR and 15 from LRP8. To root the tree 13 sequences from LRP4 were chosen.

As expected, the branching pattern of the phylogenetic analysis is strongly supported, using a likelihood-based approach, and is in agreement with a 2R origin of this group of genes: that is deriving from two rounds of duplication of an ancestral gene (Figure 14). All sequences are out-grouped by LRP4 sequences. Because the number of used sequences was too large, the fully expanded tree did not fit in a single image. As such, each branch was separated into a different figure present in the appendix (Appendix Figures 1-5).

(34)

20 FCUP

Cobalamin Receptors: Transitions for Novel Functions?

Fi gure 14 C D 3 2 0 f a m ily ph y logene tic t re e . P h y log e n e tic tr e e c o n s tr u c te d u s ing a M A FFT a lig n men t o f p ro te in s e q u e n c e s fr o m C D 3 2 0 a n d it s p a ra log u e s , V L D L R , L D L R a n d L R P 8 . The P h y M L 3 .0 s o ftw a re w a s u s e d to g e n e ra te th e tr e e . The b ra n c h n o d e v a lue s r e p re s e n t a B a y e s c a lc u lat e d b ra n c h s u p p o rt.

(35)

Functional assays

In order to better understand the CD320 evolution from a functional perspective, laboratory cell internalization assays that sought to elucidate the function of the Xenopus

tropicalis’ CD320 orthologue were devised. In these assays, mammalian cells

expressing CD320 from Mus musculus (mouse) and Xenopus tropicalis (frog) were to be incubated with various ligands that are known to bind and be internalized by other members of the LRP family. These ligands are listed in Table 2.

Table 2 – Ligands internalized by LRP family members. List of ligands to be tested for internalization in mouse and

frog CD320. It also contains information about the receptor the ligand originally binds to and the structure it binds to in that receptor.

Ligand Receptor Binding structure Reference

TCN2-B12 CD320 LDLa repeats [27]

Low-density lipoprotein LDLR LDLa repeats [52]

Apolipoprotein E VLDLR LDLa repeats [53]

Reelin VLDLR/LRP8 LDLa repeats [54]

Selenoprotein P LRP8 Beta-propeller [50]

The functional characterization should bring to light some information regarding the strong evolutionary drive that urged CD320 to be truncated and lose a handful of domains at a high rate.

CD320 cloning and cell expression

To start with, CD320 receptors were expressed in mammalian cells. To this end, the

CD320 cDNA from mouse and frog was amplified by PCR and cloned into the

pEGFP-N1 plasmid. This plasmid attaches the coding sequence for an enhanced green fluorescent protein (EGFP) to the N-terminal region of the protein inserted within it, and contains a cytomegalovirus (CMV) promoter. The EGFP emits green light under fluorescence microscopy after being excited by a blue light in the 490nm range. The CMV promoter is commonly used in mammalian expression vectors to drive gene expression. The final plasmid constructs were used in COS-1 and HeLa cell transfection and the receptors from both species were successfully expressed (Figure 15).

(36)

22 FCUP

Cobalamin Receptors: Transitions for Novel Functions?

Figure 15 – CD320-EGFP in COS-1 cells. Immunofluorescence images of cellular expression of CD320-EGFP in

COS-1 cells. In blue, the nuclei colored by DAPI; in green, the CD320-EGFP. In A) cells were transfected with mouse CD320; in B) cells were transfected with frog CD320

A

(37)

TCN2 cloning, production and purification

Next, we sought to incubate CD320 expressing cells with the ligands listed in Table 2. To this end, TCN2 from both mouse and frog was produced in mammalian cells and purified.

TCN2 cDNA from mouse and frog was amplified by PCR and cloned into the pcDNA™3.1/myc-His(-) B plasmid. This plasmid attaches a C-terminal 6x His-tag to the inserted protein. It also includes a CMV promoter sequence. COS-1 cells were transfected with the plasmids and the cell media was harvested after 48h. The cell media was run through nickel affinity columns, to which the 6X His-tag in the TCN2 binds strongly, and then eluted. The presence of TCN2 in the eluate fractions was confirmed by western blot using an antibody against the 6X-His tag, where a band of the TCN2 size, ~48kDa, can be observed (Figure 16).

TCN2-B

12

internalization essay

To test for the internalization of TCN2-B12, the cells expressing each of the receptors

were incubated with the ligand. TCN2 from each species was incubated with B12 in cell

medium to form the TCN2-B12 complex and the cells were exposed to the resulting

media. Unexpectedly, high background and non-specific binding was observable when cells expressing the mouse CD320 was incubated with this complex. As such, several protocols were carried out, described below. In all of them, ligand internalization in cells was confirmed by immunofluorescence – using a secondary anti-rabbit antibody conjugated to Alexa Fluor 568, a fluorescent dye that becomes red under the microscope

Figure 16 – TCN2 western blot. Western blot of the eluted fractions after TCN2 purification using the antibody

against the 6XHis tag. On the left, purification of mouse TCN2, and on the right purification of the frog TCN2. The numbers represent the ladder positions.

63 kDa - 48 kDa - 35 kDa -

(38)

24 FCUP

Cobalamin Receptors: Transitions for Novel Functions?

after excitation – and looking for yellow colocalization of the red target with the green, cell expressed EGFP.

Protocols 1, 2 and 3

In these protocols, after the cells were incubated with the TCN2-B12 complex for 1h, they

were fixated, permeabilized, blocked and incubated with the antibody for the 6X-His tag, which penetrated cell membrane and was used to mark the internalized TCN2 containing this tag. The results, however, did not show the labelled ligand only – the cells were heavily marked with the fluorescent dye from the secondary antibody, both in the positive and in the negative controls (Figure 17). In protocol 2, in a failed attempt to eliminate this non-specific binding, the cell blocking step was extended to 1h and a higher concentration of BSA was used. In protocol 3, this increased blocking step was maintained and HeLa cells were used instead of the COS-1 cells, but the problem persisted.

Protocol 4

In this variation of the protocol, the medium containing the TCN2-B12 complex was

incubated with the primary antibody for the 6X-His tag before being added to the HeLa cells, with the objective of labelling the ligand before internalization. Afterwards, it was followed similarly to protocol 3, but there was no incubation with the primary antibody after fixation. In this situation, no internalization was detected. Figure 18 depicts the overall expression of the GFP-fused receptor and illustrates the lack of TCN2 labelling (in red).

Protocol 5

The objective of this protocol was to label the internalized receptor instead of the ligand. Hence, to the medium containing the TCN2-B12 complex a different antibody was added

- a primary anti-GFP antibody that would bind to the receptor CD320, and not TCN2. Protocol was carried out similarly to protocol 4. Thus, the subset of CD320 proteins localized to the cell membrane at the time of incubation, would be further labelled with an anti-GFP antibody. Despite clearly expressed (Figure 19), as shown by the GFP green signal, labelling with an externally added anti-GFP antibody did not yield positive results.

(39)

Figure 17 – Immunofluorescence image of protocol 1. Binding of the secondary antibody containing Alexa Fluor

568 to COS-1 cells expressing mouse CD320. The cells in A) were incubated with TCN2-B12 for 1h; B) represents the negative control where cells were not incubated with the TCN2-B12 ligand.

A

(40)

26 FCUP

Cobalamin Receptors: Transitions for Novel Functions?

Figure 18 – Immunofluorescence image of protocol 4. HeLa cells expressing mouse CD320. In this assay, A) the

TCN2-B12 ligand was incubated with the anti-6X-His antibody before being added to the cells; B) is the negative control with no TCN2- B12 added to the cells. In blue, the nuclei are colored by DAPI; in green, the mouse CD320-EGFP, and in red the Alexa Fluor 568 secondary antibody (not visible).

A

(41)

Figure 19 – Immunofluorescence images of protocol 5. HeLa cells expressing mouse CD320. In this assay, A)

the cells were incubated with TCN2- B12 and anti-EGFP antibody to test for receptor internalization. B) represents the negative control where no TCN2- B12 was added to the cells. In blue, the nuclei are colored by DAPI; in green, the mouse CD320-EGFP, and in red the Alexa Fluor 568 secondary antibody bound to the anti-GFP antibody.

A

(42)
(43)

Discussion

The synteny analysis of the locus of origin of the CD320 gene in various species, revealed that a genuine orthologue of the receptor is present not only in mammals, but also across most vertebrates.

Structurally, the CD320 from mammals is very well conserved – most of the sequences contain the two LDLa repeats that had been previously reported, as well as the cysteine-rich flexible linker. This linker does not display strong primary structure conservation, as is expected from intrinsically disordered protein segments. The cysteines present in this domain are, however, very well conserved, and align to a third LDLa repeat from this region of marsupials CD320. Due to this, we hypothesize that the linker is actually a third, degenerated LDLa repeat.

In birds, CD320 is shorter than in mammals; it only contains one LDLa repeat. This receptor has actually been previously reported as being the Tva receptor, the target responsible for avian sarcoma and leukosis viruses subgroup A entry into avian cells [55]. The avian LDLa repeat is thus responsible for virus entry, and polymorphisms conferring resistance to the virus that map to this domain have been reported [56]. The receptors’ actual function is unknown, yet we hypothesize that the avian receptor is unable to bind TCN2-B12 – of note is that the second repeat reported to be critical for

TCN2-B12 binding and internalization in human CD320 is absent in these receptors.

The CD320 receptors found in the remaining species have a highly variable number of structures within the same groups. In the case of reptiles, the receptors can have as little as one LDLa repeat to as many as four. Amphibians and most fishes can have from three to five LDLa repeats and different structures – EGF-like calcium binding repeats and LDLb repeats. The presence of these repeats together with LDLa domains in CD320 strongly supports its link to the LRP family, as these domains are quintessential in several members of this family.

Synteny analysis of CD320 and other LRP family members revealed that CD320 shares orthologue neighbours with VLDLR, LDLR and LRP8. The chromosome segments where these genes are placed belong to the same Linkage Group from amphioxus, as proposed by Putnam et al. [51]. Hence, we propose that these 4 genes originated from the same ancestral gene through the two rounds of whole genome duplication that is currently hypothesized as being a driving basis of vertebrate evolution. The constructed phylogenetic tree apparently supports this conclusion. The proposed evolutionary of the CD320 family genes is represented in Figure 20.

(44)

30 FCUP

Cobalamin Receptors: Transitions for Novel Functions?

After the genome duplication events, CD320 suffered a series of domain truncations until it became a very specific receptor for TCN2-B12 in mammals. Since the longer CD320

orthologues resemble the other members of the CD320 subfamily in structure, and these members internalize a variety of ligands, we hypothesize that these successive domain losses increased CD320 specificity for internalization of vitamin B12.To confirm this

hypothesis, internalization assays with mouse CD320 and the longer CD320 orthologue from frog were carried out. In this on-going experiment, cells expressing CD320 from both species fused to GFP are to be incubated with ligands that are internalized by the other members of the CD320 subfamily.

One curious aspect of the putative specificity of CD320 towards TCN2-B12 in mammals

relates to the requirement of CD320 for delivery of B12 to the CNS, as suggested by a

knock-out mouse model. Furthermore, B12 deficiency was shown to lead to important

neurological deterioration and brain abnormalities: including brain white matter loss, delayed myelination and atrophy of the corpus callosum [15, 19, 57]. In fact, the development of the mammalian brain was suggested to have been propelled by increased olfactory sensitivity and neuromuscular coordination, considering the increase in size of the olfactory bulbs and olfactory cortex [58, 59]. Furthermore, brain evolution also included enlargement, the development of the neocortex, with a stratified structure, and the appearance of the corpus callosum, the largest bundle of myelinated axons of the CNS, in placental mammals [60]. Considering that (i) in mammals CD320 loss leads to deficiencies in the CNS [34], (ii) cobalamin is linked to myelin synthesis [17], (iii) myelinated axons are found in the spinal cord, inner core of the cerebellum, corpus callosum and constitute the foundation of the neocortex and (iv) the mammalian brain evolution, we bring forward the possibility that the increased specificity that accompanied the evolution of the receptor might have paralleled a greater requirement for myelin during the expansion of the mammalian brain. Yet, further work is needed to test this hypothesis.

Future perspectives

In order to assess the function of the non-mammalian CD320 receptor, an additional cell-based internalization assay is being tested. Briefly, the anti-GFP antibody will be used to label the receptor instead of the ligand. The cell incubation with the antibody and ligand will, however, be conducted at 0 °C for 30 minutes. This should temporarily stop cell receptor recycling and allow for the binding of TCN2-B12 and antibody to the receptors.

Cells will briefly be brought back to 37 °C, for 1 hour, to promote receptor internalization. After, they will be incubated with acetic acid to remove the antibody from non-internalized

(45)

receptors. Cells will then be fixated and stained using the secondary antibody with the red fluorescent dye. If this protocol succeeds, the other proposed ligands from lipoprotein receptors, listed in Table 2, will be tested in a similar fashion. Once established, this protocol will allow us to gain further insight into the molecular function of the receptors from other groups, such as marsupials, birds, reptiles and fish. This expanded analysis will provide a phylogenetic functional mapping of CD320 across vertebrates. Alternatively, binding assays using the purified receptor and radiolabelled ligands can also be conducted.

To further gain insight into the phenotypical outcomes of CD320 truncation, it would be interesting to establish knock-out and gene replacement (knock-out/knock-in) models using zebrafish. This could be carried-out using state-of-the-art CRISPR-Cas9 approaches. By swapping the fish receptor with the shorter mammalian version of CD320, one could explore its phenotypic and metabolic consequences: morphological alterations in organs and tissues, notably in the CNS, measurement of homocysteine and methylmalonic acid levels, substrates of B12 requiring enzymes. Also, a

morphological analysis of CNS tissues could be carried out with the existing mouse knock-out model. An additional collaboration with university hospitals could also provide a thorough survey of clinical and radiological findings related to B12 deficiencies, notably

in CNS tissues.

From an evolutionary standpoint, it would also be interesting to expand the phylogenetic analysis to the remaining members of the lipoprotein receptor family, e.g. LRP2, LRP4, LRP6, among others. Regarding, LRP2, or megalin, for instance, knock-down mice models and human pathogenic mutations agree on its crucial role in nutrient and metabolite supply to the brain, with LRP2 deficiency leading, among other findings, to severe brain malformation, including total absence of corpus callosum [61, 62]. Curiously, LRP2 was suggested to compensate for the lack of CD320 during the initial stages of development; yet, its progressively restricted expression was unable to do so in the adult (Introduction). The spatiotemporal expression of both, LRP2 and CD320, during mouse and zebrafish development, could also provide clues for their role in B12

provision to the brain during development, hence complementing the CD320 KO analysis. Overall, understanding the evolution of receptors, notably those required for brain supply, across vertebrates, is crucial for a better knowledge of vertebrate brain function, disease and evolution.

(46)

32 FCUP

Cobalamin Receptors: Transitions for Novel Functions?

Figure 20 – Evolutionary history of the CD320 gene family. Red nodes represent 2R gene duplications. The general

structure from each group of proteins is represented. Yellow boxes represent LDLa repeats, green boxes EGF-like calcium binding repeats, brown boxes the beta-propeller domain and light green boxes the EGF-like non-calcium binding repeats. LRP8, VLDLR and LDLR structures are based off human receptors. The animal figures represent the group of the remaining CD320 structures – fishes, amphibians, reptiles, birds and mammals.

(47)

References

1. Gruber, K., B. Puffer, and B. Krautler, Vitamin B12-derivatives-enzyme

cofactors and ligands of proteins and nucleic acids. Chem Soc Rev, 2011.

40(8): p. 4346-63.

2. Kozyraki, R. and O. Cases, Vitamin B12 absorption: mammalian physiology and

acquired and inherited disorders. Biochimie, 2013. 95(5): p. 1002-7.

3. Watkins, D. and D.S. Rosenblatt, Lessons in biology from patients with inborn

errors of vitamin B12 metabolism. Biochimie, 2013. 95(5): p. 1019-22.

4. Allen, R.H., et al., Effect of proteolytic enzymes on the binding of cobalamin to

R protein and intrinsic factor. In vitro evidence that a failure to partially degrade R protein is responsible for cobalamin malabsorption in pancreatic insufficiency.

J Clin Invest, 1978. 61(1): p. 47-54.

5. Hurlimann, J. and C. Zuber, Vitamin B12-binders in human body fluids. I.

Antigenic and physico-chemical characteristics. Clin Exp Immunol, 1969. 4(1):

p. 125-40.

6. Fyfe, J.C., et al., The functional cobalamin (vitamin B12)-intrinsic factor receptor

is a novel complex of cubilin and amnionless. Blood, 2004. 103(5): p. 1573-9.

7. He, Q., et al., Amnionless function is required for cubilin brush-border

expression and intrinsic factor-cobalamin (vitamin B12) absorption in vivo.

Blood, 2005. 106(4): p. 1447-53.

8. Beedholm-Ebsen, R., et al., Identification of multidrug resistance protein 1

(MRP1/ABCC1) as a molecular gate for cellular export of cobalamin. Blood,

2010. 115(8): p. 1632-9.

9. Furger, E., et al., Comparison of recombinant human haptocorrin expressed in

human embryonic kidney cells and native haptocorrin. PLoS One, 2012. 7(5): p.

e37421.

10. Wuerges, J., S. Geremia, and L. Randaccio, Structural study on ligand

specificity of human vitamin B12 transporters. Biochem J, 2007. 403(3): p.

431-40.

11. Quadros, E.V., Y. Nakayama, and J.M. Sequeira, The protein and the gene

encoding the receptor for the cellular uptake of transcobalamin-bound cobalamin. Blood, 2009. 113(1): p. 186-92.

12. Nielsen, M.J., et al., Vitamin B12 transport from food to the body's cells--a

sophisticated, multistep pathway. Nat Rev Gastroenterol Hepatol, 2012. 9(6): p.

345-54.

13. Scalabrino, G., The multi-faceted basis of vitamin B12 (cobalamin)

neurotrophism in adult central nervous system: Lessons learned from its deficiency. Prog Neurobiol, 2009. 88(3): p. 203-20.

14. Kirsch, S.H., W. Herrmann, and R. Obeid, Genetic defects in folate and

cobalamin pathways affecting the brain. Clin Chem Lab Med, 2013. 51(1): p.

139-55.

15. Briani, C., et al., Cobalamin deficiency: clinical picture and radiological findings. Nutrients, 2013. 5(11): p. 4521-39.

16. Pangilinan, F., et al., Evaluation of common genetic variants in 82 candidate

genes as risk factors for neural tube defects. BMC Med Genet, 2012. 13: p. 62.

17. Miller, A., et al., Vitamin B12, demyelination, remyelination and repair in multiple

sclerosis. J Neurol Sci, 2005. 233(1-2): p. 93-7.

18. Miller, D.J., et al., Prolonged myelination in human neocortical evolution. Proc Natl Acad Sci U S A, 2012. 109(41): p. 16480-5.

19. Gizicki, R., et al., Long-term visual outcome of methylmalonic aciduria and

Imagem

Figure 1 – Structure of vitamin B 12 . On the left, the general structure of vitamin B 12 , R representing the substitutable  ligand; representation of the plane of the ring and the position of each ligand for cyanocobalamin, methylcobalamin  and adenosylc
Figure 2 – Enzymatic reactions that involve B 12 . Representation of the reactions mediated by the active forms of  cobalamin  in  each  respective  cellular  compartment  –  recycling  of  THF  in  the  cytosol  and  isomerization  of  Methylmalonyl-CoA i
Figure  3  –  B 12   absorption,  delivery  and  reabsorption.  Schematic  representation  of  the  cobalamin  absorption  pathway,  entering  the  blood  through  intrinsic  factor-B 12 -Cubam  interaction;  delivery  to  target  cells  from  the  bloodst
Figure 4 – The structure of LDLa repeats. Alignment of the two LDLa repeats found in the CD320 of various mammalian  species
+7

Referências

Documentos relacionados

The aim of the consumer survey was to find out how personality traits of Bulgarian consumers influence their attitude towards cosmetics and personal care private labels.. At

Como acontece com muitos outros termos me- dicos, a palavra incontinência (in-continere) não corresponde, pela sua significação etymologica á ver- dade d'um facto. E', porém, um

OBJECTIVE: To investigate the influence of (CA)n repeats in the insulin-like growth factor 1 gene and a variable number of tandem repeats of the insulin gene on birth size in

Após uma marcha acompanhada de canto de guerra da praia até o cais do lago, e de equipar elenco e público com armaduras de guerra (coletes salva-vidas), as pessoas que

Radiolabelled agonists and antagonists of peptide receptors other than the somatostatin receptors [like: vasoactive intestinal polypeptide (VIP) receptor subtype VPAC1,

Assim, surge o projeto de pesquisa Uso de Técnicas de Gamificação como Auxílio ao Ensino e Aprendizagem de Lógica de Programação, a fim de desenvolver um ambiente

(3) O que decorre da interpretação conjugada dos arts. Entre outras as comunicações elencadas no art. Participação de atos: 1 - Os notários devem enviar até ao dia 15 de cada mês:

The association between chemokines and their chemokine receptors revealed that acutely infected schistosome patients displaying decreased plasma levels of CCL24 are the same