albur
New da
rnoides
U
D
ata on t
s comple
MestradoNIVERS
F
ACULD
EPARTAMENhe repr
ex: a his
Migue
o em BiologiIDADE D
DADE DE
C
NTO DEB
IOLroductiv
stologic
l Paulo Ma
a Evolutiva e 2010DE
L
ISBO
C
IÊNCIAS
LOGIAA
NIMve strate
al and m
achado
e do DesenvoOA
AL
egy of S
molecul
olvimentoSqualius
lar appr
s
roach
albur
New da
rnoides
U
D
ata on t
s comple
Pro MestradoNIVERS
F
ACULD
EPARTAMENhe repr
ex: a his
Migue
Dissert ofessora Dou o em BiologiIDADE D
DADE DE
C
NTO DEB
IOLroductiv
stologic
l Paulo Ma
tação orienta utora Maria M a Evolutiva e 2010DE
L
ISBO
C
IÊNCIAS
LOGIAA
NIMve strate
al and m
achado
ada por: Manuela Coe e do DesenvoOA
AL
egy of S
molecul
elho olvimentoSqualius
lar appr
s
roach
Contents
Agradecimentos ... iii Resumo ... iv Abstract ... vii I. Introduction... 1 1.1. Hybridization and polyploidization ... 1 1.2. Hermaphroditism ... 2 1.3. Sex cascade elements in teleost fish ... 2 The sox9 genes ... 3 1.4. The Squalius alburnoides complex ... 4 Gene‐copy silencing and dosage compensation ... 5 Initial characterization of sex cascade elements ... 5 Occurrence of hermaphroditism ... 5 II. Aims ... 6 III. Material and methods ... 7 3.1. Sampling, ploidy assessment and genotyping ... 7 3.2. Gonads’ Collection ... 8 3.3. Histological preparation and analysis ... 8 3.4. RNA extraction and cDNA synthesis ... 9 3.5. Isolation of sox9a gene and exon‐intron structure ... 9 3.6. Quantification of gene expression ... 10 figlα expression levels ... 10 dmrt1 expression levels ... 11 sox9a expression levels ... 11 IV. Results ... 12 4.1. Histological observations of gonads ... 12 Temporal assessment of maturation states ... 12 Maturation states of other populations ... 12 Occurrence of a widespread adjacent cellular mass ... 14 Histological observations of captive fish ... 16 4.2. Genes’ expression levels ... 16 figlα expression levels ... 16 dmrt1 expression levels ... 18sox9a gene expression levels ... 19 V. Discussion ... 22 5.1. Gonads maturation states ... 22 5.2. Cellular mass as putative male tissue ... 23 5.3. Sex related gene expression ... 25 figlα expression ... 25 dmrt1 expression ... 26 sox9a expression ... 27 VI. Concluding remarks ... 29 VII. References ... 30
Agradecimentos
Quero em primeiro lugar agradecer à Professora Manuela ter aceite orientar‐me nesta tese, não imaginando no que se iria meter. Agradeço toda a paciência e compreensão e, inclusivamente, fé que teve para comigo, nomeadamente nos inúmeros relatórios sempre prometidos e quase nunca entregues, e na minha constante tendência em não cumprir horários e prazos.
Quero agradecer ao Carlos Carrapato do ICNB, por ter fornecido amostras, bem como nos ter acompanhado das diversas vezes que pescamos no Guadiana e nos ter facultado preciosas indicações de como reproduzir os peixes em laboratório.
Não me posso esquecer também da Ana Santos do IGC que fatiou quase uma centena de gónadas, e a quem agradeço todo o trabalho.
Peço imensas desculpas a todos os utilizadores do laboratório pela indisponibilidade dos termocicladores nas devidas horas, por não conseguir fazer um PCR em menos de uma hora!
Agradeço ao grupo da BD, e em especial à Raquel Vaz, por ter feito comigo litros de PFA que utilizei para a histologia.
Agradeço ao Simon e à D. Branca por me terem feito crescer quanto às boas práticas laboratoriais. Ao Simon por me ter demonstrado o papel indispensável dos UVs, lixívia e outros produtos de limpeza na remoção de contaminações, e à D. Branca por me ter iniciado nas artes de autoclavagem para assegurar um ambiente mais RNase‐free!
À Professora Maria do Mar por não se chatear quando vê o seu material de laboratório, micropipetas, termoblocos, entre outros, extraviado para outra bancada.
Não me posso esquecer de todas as pessoas do grupo, Silke, Tiago, Ângela, Maria Ana, Mónica (e mais paro o fim também à pequena Mariana), Ana Rita, Josefina e Max, por terem conseguido sobreviver a um ano de constante entropia dentro daquele gabinete, e agradecer, pois, terem‐me tolerado! Agradeço à Isa e ao Miguel por me terem muitas vezes ajudado nessa tarefa.
Tenho de agradecer às diversas pessoas que me fizeram companhia nas alternativas e intermináveis saídas de campo, muitas vezes de quase 24 horas. Agradeço, pois, à Isa, Miguel, Tiago e Ângela, e mais recentemente à Joana Pinho, por terem um coração forte e terem sobrevivido à minha condução.
Agradeço à Ângela e à Isa terem partilhado comigo os extensos dias de dissecação de peixes, e ao Miguel as inúmeras horas à frente do citómetro.
Agradeço a todos os meus amigos por terem consentido na minha ausência e por ainda se darem comigo mesmo depois de todas as negas que lhes dei ao longo deste tempo.
À minha Mãe, Pai e Irmão, um grande obrigado por não se terem esquecido que tinham um filho e um irmão durante os longos períodos que passei longe deles. E a toda a minha família por volta e meia perguntarem se não precisava de mais uma mãozinha.
Um agradecimento especial à Isa e ao Miguel, pelas imensuráveis horas de discussão à volta do Alburnoides, por me terem suportado e sem os quais esta tese não seria a mesma.
Resumo
A determinação/diferenciação sexual em peixes teleósteos tem suscitado grande interesse devido à grande diversidade de mecanismos que têm sido descritos, sendo estes constantemente reinventados, mesmo entre espécies irmãs.
A poliploidia e a hibridação correspondem a importantes factores na evolução e especiação de vertebrados, levando frequentemente a uma alteração brusca das redes regulatórias da expressão génica. O complexo ciprinícola Squalius alburnoides surge, deste modo, como um modelo interessante para endereçar questões relacionadas com a determinação/diferenciação sexual num contexto alopoliplóide.
Tratando‐se de um peixe dulçaquícola endémico da Península Ibérica, S. alburnoides teve origem num processo de hibridação resultante de cruzamentos intergenéricos entre a espécie Squalius pyrenaicus (ancestral materno, genoma P) e uma espécie presumivelmente extinta da linhagem de Anaecypris hispanica (ancestral paterno, genoma A). Este complexo compreende várias formas que variam na sua ploidia (2n, 3n e 4n) e constituição genómica (PA, PAA, PPA, PPAA, nas populações do sul). Squalius alburnoides apresenta ainda uma forma diplóide de composição nuclear não híbrida (AA) constituída apenas por machos. Actualmente, o complexo S. alburnoides encontra‐se em simpatria com outras espécies de Squalius (S.
pyrenaicus, S. carolitertii e S. aradensis) que participam activamente na dinâmica reprodutiva
do complexo, intercruzando‐se com as várias formas do mesmo.
Estudos recentes comparativos da expressão génica entre as diferentes formas do complexo revelaram a existência de um mecanismo de compensação de dosagem em S.
alburnoides que reduz os níveis dos transcritos das formas poliplóides para o nível encontrado
nas formas diplóides. Os mesmos estudos sugeriram ainda que, nas formas triplóides das bacias hidrográficas do Sul, os alelos do genoma menos representado estão a ser preferencialmente silenciados. No entanto, um cenário diferente foi encontrado nas populações do Norte, tendo os indivíduos uma expressão quase sempre bialélica, independentemente da sua constituição genómica.
Relativamente à determinação/diferenciação sexual neste complexo alopoliplóide, alguns estudos foram realizados para avaliar quais os genes envolvidos na regulação do processo de manutenção de identidade da gónada neste organismo e na espécie parental simpátrica S. pyrenaicus. Hibridação in situ dos genes amh, dmrt1, wt1, dax1, figlα e aromatase (estudados em outros vertebrados) não revelou uma expressão dimórfica entre sexos, nem um padrão diferente entre indivíduos do complexo hibridogenético e de S.
pyrenaicus.
Recentemente foi reportada a ocorrência de hermafroditismo em S. alburnoides, factor relevante na interpretação de resultados de expressão dos genes ligados ao sexo.
No presente trabalho pretendeu‐se esclarecer algumas dúvidas que ainda restavam sobre o hermafroditismo no complexo S. alburnoides, nomeadamente, se este seria um estado de transição num contexto de hermafroditismo sequencial e se seria extensível a outras populações e, inclusivamente, a outras espécies de Squalius. Para este fim, efectuou‐se uma série temporal de amostragens na bacia hidrográfica do Guadiana (onde anteriormente tinha sido observado o fenómeno), para além de capturas pontuais noutras bacias hidrográficas.
Uma das gónadas de cada indivíduo foi processada para histologia e a outra, sempre que necessário, para extracção de RNA e subsequente análise dos níveis de expressão dos
genes dmrt1, figlα e sox9a. Esta metodologia permitiu despistar possíveis desvios da expressão esperada dos genes devido à influência do hermafroditismo. Note‐se que o gene sox9a foi isolado e analisado pela primeira vez no complexo S. alburnoides e na espécie S. pyrenaicus.
A análise histológica da morfologia das gónadas recolhidas anteriormente permitiu averiguar o seu estado de maturação nas diferentes formas do complexo, bem como na espécie simpátrica S. pyrenaicus. A análise dos resultados obtidos revelou uma interessante correlação entre os estados de maturação e a expressão dos genes analisados em trabalhos anteriores e no presente. Assim, foi observado que indivíduos cuja expressão do genoma P é inevitável, como a espécie S. pyrenaicus e as formas PA e PPA, apresentam oócitos imaturos até mais tarde, comparativamente com as formas triplóides PAA que, tendencialmente, apresentam apenas transcritos do genoma A. Este possível alargamento da época de reprodução das fêmeas diplóides em particular, juntamente com o facto de produzirem um maior número de ovos comparativamente às fêmeas triplóides, poderá contribuir para a elevada proporção de indivíduos triplóides nas populações naturais do complexo, uma vez que a sua descendência será maioritariamente triplóide, tendo em conta as formas mais frequentes e os seus modos de reprodução.
Ao longo dos vários meses de amostragem, através das observações histológicas, foi encontrada uma massa celular nas proximidades do tecido reprodutor masculino e feminino dos indivíduos das diferentes populações de S. alburnoides e S. pyrenaicus estudadas. O conhecimento prévio da ocorrência de hermafroditismo em S. alburnoides levou a suspeitar que esta massa celular correspondesse a tecido reprodutor masculino. No entanto, a presença do mesmo também em machos levantou algumas dúvidas quanto à sua possível origem. Nas fêmeas, vários factores parecem indicar indirectamente tratar‐se de um verdadeiro tecido masculino, nomeadamente, a) o facto de neste sexo a massa celular parecer acompanhar o ciclo de maturação da gónada feminina, alterando a sua cor e complexidade; b) ter sido encontrado verdadeiro tecido testicular maduro numa fêmea; e c) os níveis de expressão diferencial dos genes dmrt1 e figlα (respectivamente, masculino e feminino, como referido posteriormente) em diferentes porções de uma mesma gónada.
À semelhança de outros vertebrados, a expressão do gene figlα revelou ser caracteristicamente feminina, possuindo as fêmeas maior quantidade de mRNA deste gene do que os machos. Comparando as diferentes formas de fêmeas, uma maior expressão deste gene parece existir nas fêmeas diplóides. Esta diferença poderá dever‐se ao facto deste gene ser expresso em oócitos imaturos e estar descrito que esta forma possui maior número de oócitos.
Os níveis de expressão do gene dmrt1 revelaram‐se, por sua vez, caracteristicamente masculinos, possuindo os machos maior expressão que as fêmeas, resultados que se encontram em concordância com o seu papel fundamental na diferenciação e manutenção da gónada masculina em outros vertebrados.
No presente trabalho, o gene ortólogo sox9a foi isolado em S. alburnoides e S.
pyrenaicus e a sua expressão averiguada. A análise dos níveis de expressão deste gene revelou
uma possível variação populacional interessante. Verificou‐se que nas populações do Sul filogeneticamente próximas, nomeadamente, Sado, Guadiana e Almargem, este gene se apresentava mais expresso nos machos, sendo encontrado um cenário completamente oposto nas populações mais distantes (Cobrão, Raia e Colares), nas quais o gene é mais expresso nas fêmeas.
A confirmar‐se verdadeiramente a natureza masculina da massa celular observada nas fêmeas, esta não será resultado de um estado de transição entre sexos num contexto de hermafroditismo sequencial. Assim, uma estratégia reprodutora androdióica (ou, pelo menos, trióica) parece mais provável de estar a ocorrer em S. alburnoides e, possivelmente, ser extensível a outras espécies de Squalius. A evolução destas estratégias reprodutora no complexo S. alburnoides é facilmente entendível devido ao enviesamento sexual para fêmeas triplóides, uma vez que a existência de hermafroditas poderá aumentar a produção de descendência numa população, reduzindo a dificuldade em encontrar parceiros sexuais. A vantagem adaptativa desta característica em S. pyrenaicus é menos clara, uma vez que esta espécie tem sido descrita como tendo um rácio sexual equilibrado. No entanto, vários factores importantes para a compreensão da evolução do hermafroditismo nesta espécie são ainda desconhecidos, nomeadamente, o seu comportamento social e sistemas de acasalamento.
Palavras‐chave
Squalius alburnoides, alopoliploidia, hermafroditismo, histologia das gónadas, níveis de
expressão génica, dmrt1, figlα, sox9a
Abstract
Teleost fishes are an interesting group to study sexual determination/differentiation, due to the high diversity of mechanisms involved and the common occurrence of hermaphroditism. The Iberian Squalius alburnoides hybridogenetic complex appears as an unusual case study, since it presents particular characteristics that enhances the interest of studying its sexual determination/differentiation mechanisms, namely, preponderance of triploid females, an all‐male lineage and recurrent interbreeding with the sympatric bisexual
Squalius species. Moreover, the occurrence of hermaphroditism was recently reported in this
complex.
In the present research, the assessment of hermaphroditism occurrence was extended to different catchments, in order to evaluate the extension and real implications of this particular phenotype. Histological analysis revealed the widespread presence of an adjacent cellular mass to female gonads, even in S. pyrenaicus bisexual species. Tissue morphology and molecular data (dmrt1 and figlα genes’ expression) indirectly suggested that the mentioned cellular mass might indeed correspond to a true male tissue.
The molecular survey was also extended to the study of another sex‐related gene,
sox9a, which was de novo isolated in S. alburnoides and S. pyrenaicus species. The
quantification of the expression levels for all genes was performed between sexes, ploidy levels and populations. sox9a expression results showed a possible population variation, meaning that the gender with higher expression switched between populations. Although the obtained histological and molecular results for S. alburnoides complex seemed coherent with hermaphroditism, the occurrence of these strategies in other Iberian Squalius still needs further investigation.
Thus, the present results suggested that an androdioecious reproductive strategy, or at least a trioecious strategy, is likely to be occurring in S. alburnoides as the referred cellular mass did not seem a result of a transitional step between sexes in a sequencial hermaphroditism context. These strategies could have evolved in S. alburnoides natural populations in response to the sex bias towards triploid females, since it might increase the total zygotic production, reducing efforts in finding mates.
Keywords
Squalius alburnoides, allopolyploidy, hermaphroditism, gonad histology, gene expression
levels, dmrt1, figlα, sox9a
Introduction
I. Introduction
1.1. Hybridization and polyploidization
Polyploidization played a crucial role in the evolution of vertebrates (reviewed in Wolfe 2001), once gene duplication leads to the evolution of new functions, promoting diversification and evolutionary success (e.g. Comai 2005; Hurles 2004). Polyploidy can arise by several ways, like failure in cell division after mitotic doubling, production of unreduced eggs and due to hybridization (Otto & Whitton 2000), resulting in the presence of more than two complete sets of chromosomes in the respective taxa.Depending on the chromosomal composition and on the mechanism that leaded to polyploidy, polyploids can be divided in two main groups: autopolyploids and allopolyploids. The former ones arise from chromosome doubling within an individual or from the merging of two similar genomes from distinct individuals of the same species. On the other hand, allopolyploids are a consequence of hybridization, usually between different species (reviewed in Otto 2007).
In plants, polyploidy is common as an ancient and an ongoing evolutionary process (Adams & Wendel 2005). However, it is considered rare among animals, especially in higher vertebrates (Orr 1990; Otto & Whitton 2000). Orr (1990) proposed that the occurrence of polyploidy in animals would be impeached by its interference with sex determination processes and the disruption of gene dosage imbalance. Although there are some known examples of stable polyploids among several animal taxa, namely amphibians and reptiles (reviewed in Otto & Whitton 2000), in fish (Leggatt & Iwama 2003) and even in mammals (Gallardo et al. 2006).
In fishes, hybridization is a widespread process, positively related with polyploidy (Le Comber & Smith 2004). Several contributing factors seem to explain the high incidence of hybridization in fish taxa, namely external fertilization, weak behavioural isolating mechanisms, unequal abundance of the two parental species, competition for limited spawning habitat, decreasing habitat complexity and susceptibility to secondary contact between recently evolved forms (Chávez & Turgeon 2007; Scribner et al. 2001). Viable hybrids between distantly related fish species are frequently found, suggesting that this group appears to be less susceptible to the severe developmental incompatibilities that affect interspecific hybrids in other vertebrates (Scribner et al. 2001). Moreover, allopolyploidization seems to be the predominant mode of polyploidization, being a recurrent process in Cobitidae and
Cyprinidae families (Gromicho & Collares‐Pereira 2007).
When polyploidy results from hybridization, one of the most often consequences is the establishment of asexual reproduction. Among vertebrates, such system was for the first time described in the fish species Poecilia formosa (Hubbs & Hubbs 1932). In asexual systems, no recombination is involved in reproduction, which is performed clonally and might or not involve syngamy or karyogamy. There are several asexual reproductive modes known among vertebrates (Dawley 1989), which can be divided in two main groups: sperm dependent and sperm independent. Some asexual reptiles reproduce sperm independently by strict or facultative parthenogenesis. In this reproductive mode, eggs are produced without syngamy, genetic recombination or reduction in ploidy and develop into clonal offspring. On the other hand, asexual fish and amphibians usually reproduce through gynogenesis or hybridogenesis,
Introduction
depending on sexual species as sperm donors (Adams et al. 2003; Vrijenhoek et al. 1989; Watts et al. 2006). Gynogenesis is a reproductive mode similar to parthenogenesis, however, in this case, sperm is necessary to trigger embryogenesis, although without karyogamy occurrence. Consequently, the paternal genome is eliminated or degenerated, which leads to the production of clonal offspring. Another sperm dependent asexual reproductive mode is hybridogenesis, in which, during gametogenesis, the paternal genome is excluded and the maternal genome is transmitted clonally to the haploid egg. Eggs are then fertilized by the paternal species sperm (requiring syngamy and karyogamy), reconstituting the hybrid condition. Thus, the paternal genome is replaced in each generation (hemiclonal inheritance).
There is a particular reproductive mode that is very similar to hybridogenesis, but since it involves meiosis is called meiotic hybridogenesis, in which, after exclusion of the heterospecific genome, the remaining homospecific genomes undergo meiosis with random segregation and recombination. This reproductive mode is very uncommon, being found in very few species and hybrid complexes, one of which is Squalius alburnoides complex. Notice that, this Cyprinidae complex presents the higher known variability of reproductive modes, engaging production of unreduced gametes, meiotic hybridogenesis, meiosis and, very rarely, hybridogenesis and parthenogenesis (reviewed in Alves et al. 2001). Therefore, the Squalius
alburnoides complex emerges as an excellent model to study reproductive strategies in an
allopolyploid context due to this high variability in the reproductive modes.
1.2. Hermaphroditism
Fishes are a very interesting and intriguing group concerning sexual determination, presenting a great diversity of mechanisms (Luckenbach et al. 2009). Moreover, these organisms are frequently hermaphrodites (Chopelet et al. 2009). There are two main types of hermaphroditism: synchronous/simultaneous, characterized by the existence of a testicular and an ovary tissues in the same specimen, that could maturate or spawn simultaneously or at different times; and sequential hermaphroditism, in which a specimen of a given sex change the type of gonad tissue to the one of the opposite sex (Crews & Bull 2009).
From an evolutionary point of view, gonochorism and synchronous hermaphroditism are considered endpoints in a reproductive spectrum with intermediate mixed‐sex states such as gynodioecy (existence of females and hermaphrodites), androdioecy (males and hermaphrodites) and trioecy (all the three classes presented, males, females and hermaphrodites) (Avise & Mank 2009). In fish, hermaphroditism is evolutionarily derived and polyphyletic, detected in only 2% of the teleost species investigated so far (Avise & Mank 2009).
Hermaphroditism can be part of the natural gonad developmental pathway to maturity or appear to be socially conditioned, resulting in sex changers (Crews & Bull 2009). In hermaphroditic organisms the sexual ratio is often biased (Allsop & West 2004; Chopelet et al. 2009). Despite the relatively common presence of hermaphroditism among certain groups of fish, there is only one reported occurrence in a hybrid fish (Matos et al. 2010).
1.3. Sex cascade elements in teleost fish
The mechanisms of sexual determination in animals have generated a great interest due to the diversity of determination systems that have been described, which could have an
Introduction
environmental, genetic or even both components (Crews & Bull 2009). In each of these types, there is a considerable plasticity in the way that determination occurs. In teleosts, determination pathways are constantly reinvented, even between sister species (Quinn et al. 2009), challenging the idea of a tendency for conserved biological systems. This variability constitutes an additional difficulty when considering sex determination in hybrid fishes, since hybridization can bring abrupt changes in these cascades, compared to those found in parental species (Volff & Schartl 2001). Despite the variety of mechanisms, the components of sex determination cascades are apparently conserved throughout the vertebrate lineage (Schartl 2004; Smith et al. 1999), although their position in gene hierarchies and their interaction patterns can vary according to group, special in primary determinants (Piferrer & Guiguen 2008). Between teleosts, medaka (Oryzias latipes) emerges as a model to the study of sexual determination due to its features (many established genetic lines, XX/XY sexual determination and the possibility of performing sexual reversion). Many mammalian orthologous genes in the sexual determination cascade have been isolated in this organism and one gene was found to be essential to males development, dmy, which results from a dmrt1 gene duplication and is localized in Y sexual chromosome (reviewed in Schartl 2004). This gene is assumed as a master gene in the sexual determination of this organism, as sry gene in mammalian lineage.
In other fish species, amh, dmrt1, wt1, dax1, aromatase, figlα and sox9 genes have been implicated in the functionality of specific cell types, in the safeguarding of adult gonad integrity and, directly or indirectly, in germ cell maturation (Klüver et al. 2005; Kobayashi et al. 2004; Nakamoto et al. 2005; Rodríguez‐Marí et al. 2005).
For instance, dmrt1 gene has been shown for many organisms to be of essential importance for male differentiation pathway, with a marked expression in this sex (Ferguson‐ ‐Smith 2007), being one of the most conserved genes in sex differentiation cascade (Piferrer & Guiguen 2008). On the other hand, figlα gene is critical for developing a functional ovary (Soyal et al. 2000) and has been pointed as a female specific gene for many vertebrates (Soyal et al. 2000; Wu et al. 2008). The sox9 genes
The SRY‐related high mobility group (HMG) containing box (SOX) genes encode a family of transcription factors involved in several developmental processes, including sex differentiation (Piferrer & Guiguen 2008).
sox genes are abundant in mammals and their number in fish is probably even larger,
since genome duplications have occurred in this group of vertebrates (Meyer & Schartl 1999). In mammals, sox9 plays an essential role in testis determination and cartilage development (Foster et al. 1994; Zhao et al. 1997). The importance of sox9 in the regulation of the cartilage formation and male gonad development seems to be conserved among vertebrates (Chiang et al. 2001; Foster et al. 1994; Klüver et al. 2005; Zhou et al. 2003).
In medaka and zebrafish, for example, two co‐orthologous of the mammalian sox9 gene were found (Chiang et al. 2001; Klüver et al. 2005; Yokoi et al. 2002). This is in agreement with similar findings for other genes which suggested that a genome‐wide duplication in the ray‐fin fish lineage occurred before the divergence of the teleosts. This whole genome duplication may have facilitated lineage divergence by partitioning different ancestral gene sub‐functions among co‐orthologs of tetrapod genes. Detailed studies in zebrafish and medaka
Introduction
have shown that the combined expression pattern of the two sox9 genes correspond approximately to that of the single sox9 in mouse, indicative of a partitioning of ancestral sub‐ functions (Chiang et al. 2001; Klüver et al. 2005).
1.4. The Squalius alburnoides complex
The Squalius alburnoides complex (for a taxonomic review see Collares‐Pereira & Coelho 2010) is an Iberian Peninsula’s endemic freshwater fish with a wide distribution range, being sympatric with three Squalius bisexual species, namely Squalius pyrenaicus, Squalius
aradensis and Squalius carolitertii.
S. alburnoides had a unidirectional hybrid origin, with S. pyrenaicus as maternal
ancestor (P genome) (Alves et al. 1997; Carmona et al. 1997) and an Anaecypris hispanica‐like species as paternal ancestor (A genome) (Crespo‐López et al. 2006; Gromicho et al. 2006; Robalo et al. 2006). The unidirectionality of this hybridization process was inferred from the fact that the Anaecypris‐like mitochondrial DNA (mtDNA) was never detected in S. alburnoides. This hybridogenetic complex gathers several forms with different ploidies, including diploid (2n=50), triploid (3n=75) and tetraploid (4n=100) individuals. Moreover, individuals of each ploidy may show distinct genomic constitutions, with different proportions of the parental genomes, and variable sex ratios, being the triploid females de most common biotype in natural populations (reviewed in Collares‐Pereira & Coelho 2010).
In southern populations where S. alburnoides complex is in sympatry with S.
pyrenaicus, hybrid forms include diploids PA, triploids PAA and PPA (the latter rarely found),
and tetraploids PPAA (unbalanced tetraploids can also occur, Sousa‐Santos et al. 2007). Besides all these hybrid forms, S. alburnoides also comprises a nuclear non‐hybrid diploid form, presenting S. pyrenaicus related mtDNA but the nuclear genome of the Anaecypris‐like ancestor in homozygosity (AA genome). Interestingly all this AA individuals are males (with the exception of two females reported by Carmona 1997; Sousa‐Santos et al. 2006b). The presence of S. pyrenaicus‐like mtDNA in these nuclear AA individuals indicates that this nuclear non‐ hybrid form was reconstituted from the hybrids, discarding the hypothesis of being true descendants of the missing ancestor. All these different forms of the S. alburnoides complex intercross through highly diverse reproductive modes, as previously referred (Alves et al. 2001; Crespo‐López et al. 2006).
Some reproductive traits of diploid and triploid forms from the southern Guadiana River were previously assessed during a two‐years period (Ribeiro et al. 2003). It was found a spawning period between March and June, suggesting multiple‐spawning behaviour. Moreover, the time of spawning of both female forms appeared to be synchronized.
The S. alburnoides forms have a differential distribution along its range, with distinct populations presenting different composition of forms (Alves et al. 2001; Pala & Coelho 2005). These populational differences are mainly due to the allopatric distribution of the bisexual
Squalius species with which S. alburnoides complex is sympatric. The Squalius species actively
participate in the reproductive dynamics of the complex, interbreeding with several forms of the complex and acting as a source of genetic material. The recurrent crosses of S. alburnoides individuals with those species led to the introgression of their genes into the complex and, over the time, to a total substitution of the ancestor S. pyrenaicus nuclear genome in the respective drainages (Alves et al. 1997). Thus, in northern populations (Mondedo and Douro drainages), where S. alburnoides is sympatric with S. carolitertii, the characteristic P genome
Introduction
was fully replaced by the one of that species (C genome), however possessing mtDNA related to the S. pyrenaicus ones. On the other hand, in the southern population of Quarteira drainage, interspecific crosses between S. alburnoides and S. aradensis led to a similar situation, but with a massive nuclear and mitochondrial introgression of the genome of the latter species (Q genome) (Sousa‐Santos et al. 2006a).
Gene‐copy silencing and dosage compensation
As previously referred, little is known about the impact of hybridization and polyploidization on the regulatory networks that guarantee the appropriate quantitative and qualitative gene expression programme. From the study of gene expression in the triploid form of the S. alburnoides complex emerged relevant results in that field. A dosage compensation mechanism that reduces transcript levels of polyploids to the diploid state has been found in this organism (Pala et al. 2008a; Pala et al. 2010).
Through the study of genome‐specific allele expression of many housekeeping and tissue‐specific genes in different organs, the silencing of one of the three alleles in triploids was observed in the southern populations (Pala et al. 2008a). Unexpectedly, it was not a whole genome that is inactivated, although there is a tendency for silencing the alleles from the minority genome.
This allele‐specific pattern of silencing has been recently shown to vary within the complex, according to the geographical origin and the type of genome involved in the hybridization process, once, in northern populations, polyploids exhibit preferential biallelic gene expression patterns, irrespective of genomic composition (Pala et al. 2010). Initial characterization of sex cascade elements In the S. alburnoides complex, the preponderance of triploid females and the existence of a line consisting solely of males (Alves et al. 2001) suggested that sex determination would have a strong genetic basis.
Some advances were made in an attempt to understand which genes could be interacting in order to regulate the process of sex determination and differentiation in these organisms (Pala et al. 2008b; Pala et al. 2009).
Through an approach of candidate genes previously described in vertebrates, the adult expression of some genes that could be involved in the mechanisms of sex determination and differentiation was analyzed (amh, dmrt1, wt1, dax1, aromatase and figlα). Non dimorphic pattern between males and females was found and no differences in cellular location of individual genes in gonads of the parental species S. pyrenaicus and in the hybrid S.
alburnoides were found.
Occurrence of hermaphroditism
S. alburnoides was considered a strict gonochoristic reproductive complex, until
hermaphrodites were detected in this hybridogenetic complex in the most southern catchments of Portugal by Matos et al. (2010).
The simultaneous hermaphrodites found did not seem be related with any ploidy levels and possible relation with endocrine disrupting chemicals was unlikely. Matos et al. (2010) also found differential male and female gamete maturation in hermaphrodites, which should work as a natural barrier to self‐fertilization.
Aims
II. Aims
Assessing the causes, the extent and the developmental and evolutionary implications of hermaphroditism in S. alburnoides complex is of crucial importance to fully understand its intricate reproductive dynamics. Consequently, in this study, the main specific goals were the following: a) Assess whether S. alburnoides hermaphroditism is part of the natural life cycle of the complex (sequential or simultaneous hermaphroditism) or an occasional abnormal state;b) Assess the extent of such phenomenon to other S. alburnoides populations rather the ones previously reported;
c) Extend the survey to other Iberian Squalius species to prospect whether hermaphroditism is an exclusive feature of the S. alburnoides complex or a more generalised phenomenon. This study will be conducted performing an exhaustive histological analysis of gonads, complemented with a molecular approach. The expression levels of dmrt1 and figlα genes will be assessed in male and female gonads of individuals of the complex by semi‐quantitative RT‐ ‐PCR in order to confirm whether there is a significant sex related difference in the expression levels of these genes. Additionally, the expression levels of another sex related gene, sox9a, was also quantified. Since this gene has been implicated in sexual determination and differentiation of many vertebrates and nothing is known about its expression in S. alburnoides and S. pyrenaicus, these data might give an important contribution to understand the puzzling molecular network of gonad identity maintenance in the complex. The expression of all referred genes (dmrt1, figlα and sox9a) was integrated in a hermaphroditism context, since their expression can be directly related with this feature.
III.
from allopa tribut Small 1) we (Tabl used anaes of plo all ind when was a was ‐Sant diplo Figure pyrena riversiMater
3.1. S
Specimen several sout atric Squaliu All fish w taries of Gua ler samples f ere also colle e 1). Occasio in other stud Captured sthetic MS22 oidy level by dividuals we n genomic co Specimen attributed to inferred bas tos et al. 200 id females P e 1. Samplingaicus); e Caste
de; i Foupana r
rial and m
Sampling, p
ns of S. albur thern popula us species, we were capture adiana river from other s ected in ord onally and f dies were re fishes were 22. From eac y flow cytom ere also colle onstitution a ns were iden o each one. A sed on morp 07) in Guadia A and diploisites: a Cobrã lhanos riversid riverside; j Alma
methods
ploidy asse
rnoides and ations. A few ere also used d by electro basin, name southern rive er to prospe for specific p covered for e brought to ch fish, bloo metry followi ected and pre ssessment (a ntified by m After ploidy phology and ana and Sad d males assu o riverside; b de; f Torgal rivargem riverside
s
essment an
of the symp w specimens d. ofishing from ely Carreiras, ers (Castelha ect the exten purposes, sa this one (Ta o the laborad was taken ing Próspero eserved in 1 according to morphologica determinati d reported f do river basin umed as AA) Sever river; c verside (allopat e.
nd genotyp
patric S. pyre of Squalius m October 20 , Foupana an anos, Colare nsion of her mples from ble 1). atory and sa and frozen o & Collares‐ 00% ethano Inácio et al. al observatio on, genotyp frequency of ns (triploid f . c Raia riverside tric S. torgalen Maping
enaicus speci torgalensis, 009 to April nd Oeiras riv s and Cobrão maphroditis fishes alrea acrificed wit at ‐80 °C for ‐Pereira (200 l for posterio 2010) was r ons and spe e of S. albur f each geno emales were e; d Colares ri nsis); g Carreira aterial and me ies were coll another sou 2010, in diff versides (Figu o riverside, F m to other b ady in the lah an overdo r later assess 00). Fin clips or DNA extra required. ecies classific rnoides indiv omic form (S e considered iverside (allop as riverside; h ethods lected uthern ferent ure 1). Figure basins b and ose of sment s from action cation viduals Sousa‐ d PAA, atric S. Oeiras
Material and methods
Table 1. Sampled specimens used for histology and expression analysis, with corresponding capture site, ploidy, genotype and sex.
When possible, three samples were included for gene expression analysis of Guadiana individuals. For the other drainages, one sample of each sex of S. pyrenaicus and of each S. alburnoides form were used. * Sexing performed by macroscopic observation of gonad morphology; a) fish captured in the same population sampled in the previous S. alburnoides expression study (Pala et al. 2009); b) fish from the southern side of Tejo catchment; c) fish of a allopatric Squalius species non‐participating in the S. alburnoides complex. Note that these fish were subjected to 30 °C temperature stress in other study; d) fish from another southern river, in which a putative male tissue was found together with the female gonad.
3.2. Gonads’ Collection
Adult gonads were dissected form the body, macroscopically evaluated and classified as male or female. Both gonads were taken and, randomly, one was frozen at ‐80 °C for expression analysis and the other one fixed in 4% PFA for histology.
One gonad from a PA individual from Almargem riverside (A5 specimen) were added (Table 1), because, after dissection and during macroscopical evaluation, it seemed to present two distinct tissues (different textures) running alongside with each other (Figure 2) (also found by Matos et al. 2010). Those tissues were separated using forceps and frozen separately, being one of them an ovary and the other a putative male tissue. Another PA female gonad from the same riverside, in which no different textures were found, was also added as a control of the previous gonad (just for expression analyses purposes).
3.3. Histological preparation and analysis
After PFA fixation, gonads were dehydrated (70% to absolute ethanol), treated with xylene and embedded in paraffin. Paraffin sections of approximately 5 µm were stained with Hematoxylin and Eosin.
Basin Riverside Date Species Ploidy/Genotype Sex* N histologyN RNA
F 2 2 M 1 1 3n F 5 3 2n M 1 1 3n F 12 3 2n M 5 2 3n F 6 3 F 1 1 M 5 2 3n F 4 3 F 1 1 M 5 3 3n F 3 3 PA F 1 3n F 17 1 PPA F 1 1 4n F 1 1 F 1 1 M 1 1 F 1 1 M 1 1 2n M 1 1 F 3 1 M 3 1 S. pyrenaicus 2n M 2 1
Raia S. alburnoides PAA F 1 a)
3n F 5
4n M 1
2n F 1
2n M 2
Almargem Almargem S. alburnoides PA F 2 d)
Tejo
b) c)
Sever S. alburnoides
Mira Torgal S. torgalensis
Guadiana
Foupana November 2009 S. alburnoides
March 2010 S. alburnoides January 2010 S. alburnoides Oeiras April 2010 S. alburnoides 2n S. alburnoides October 2009 Carreiras 2n 2n S. pyrenaicus S. alburnoides 3n Sado
Cobrão March 2010 S. alburnoides
2n
Colares Colares March 2010 S. pyrenaicus 2n
a DP5 Figure sidewi Reage DNA Corp. an et was s oligo temp repla geno were numb using sox9a confi prote set o exon while Sequ disen gene neigh Histologic 50 Olympus e 2. Macroscop ise with an ova
3.4. R
Total RN ent® Solutio was elimina .). The RNA thanol precip synthesized (dT)18 prime plate. Minus cing the RT b3.5. Is
From DN me) already isolated in o Using Da bers of Gen g ClustalX2 aR2, Table 2 rmed with B The first ein domain t f primers (so . sox9aF2 p e sox9aR2 wa All seque encher v.4.0 ntangle the e The prop and its phyl hbor‐joining cal sections w digital came pical morpholo ry. L left gonadRNA extrac
A was extra on (Ambion, ted by treat was then pu pitation with with RevertA er, following s‐reverse tra by RNase‐fre
solation of
NA samples o y available in order to asse anio rerio an Bank and E software. T ) were desig BioEdit v.7.0. set of prim hat, in D. rer ox9aF2 and rimer was d as also desig ences obtain 0 software exon‐intron o per isolation ogeny were analysis. were visualiz ra. Images wgy of one gon , R right gonad,
ction and c
acted from Inc.) accord tment of the urified with a h LiCl to elim Aid™ H Min g supplier’s anscriptase ee water, forf sox9a gen
of S. alburno n the lab, ge ess the exon‐ nd Oryzias la nsembl data Two sets of gned with Pri 5 software. ers (sox9aF1 rio, is locate R2) amplifie designed wit ned with seq ned were al (Gene Code organization. of the obta assessed us zed with an O were prepare nad containing , A anterior, P pcDNA synth
adult gonad ding to the s e RNA sampl a standard p minate RQ1 D us First Stra recommend reaction w r DNA contamne and exo
oides nuclea enomic sequ ‐intron struc atipes sox9a abases were primers (s imer3 progra 1 and R1) w d in the first ed the rest o th sequence quences from igned with es Corporat . ained coding sing Mega v.4 Olympus BX ed in ImageJ an unknown t posterior.hesis
ds frozen a supplier’s re es with RQ1 phenol:chlor DNase and B nd cDNA Sy dation for a was perform mination conon‐intron s
ar non hybr uences of sox
cture of this g a orthologou e mentioned ox9aF1 and am (http://fr was designed t and second of the HMG s obtained m the model others from ion, Inc.) fo g sequences 4.1 software Ma 60 microsco software.
tissue with dis
t ‐80 °C (Ta commendat RNase‐Free roform extra Buffer salts. nthesis Kit ( n amount o ed as desc ntrol.
structure
ids AA and
x9a teleost
gene. us gene sequ d on Figure sox9aR1, a rodo.wi.mit. to amplify d exons (Figu domain plus with the firs organisms. m D. rerio a or polymorp of sox9a te e for maximu aterial and me ope equipped stinct texture r able 1) usin tion. Contam e DNase (Pro action follow First strand Fermentas), of 40 ng of cribed previ S. pyrenaicu orthologous uences (acce 11) were a and sox9aF2 edu/) and vi part of the ure 3). The se
s part of the st set of pri nd analysed phism search leost orthol um parsimon ethods d with running ng TRI minant omega wed by cDNA using f RNA ously, us (PP s gene ession ligned 2 and isually HMG econd e third imers, d with h and ogous ny and
Figure seque in whi for exp asses gene rema durin Dens the e v.9.0 samp for A (Pala prime Table lack o as co diges (2U/µ (10x) HpaII produ at 37 with seque desig there figla_ e 3. Structure nces. Boxes rep ch black ones a pression levels
3.6. Q
The expre ssed by semi . rpl8 gene w ain stable ev ng maturatio All PCRs itometrical a expression of (StatSoft, In ple size for d NOVA test. figlα exp figlα teleo et al. 2009) ers FIG F2 a e 2). PCRs usin of expression ontrol), and stions with tw For the r µL) were use . The restric I (Amersham uct, with 7 µ °C and 300 Restrictio Webcutter ences depos After val gned, based efore conduc _SqF1 and fig and alignment present exons a are the primers quantification.Quantificat
ession levels i‐quantitative was chosen ven during e n. were cond analyses wer f the gene o nc.) was use diploid femal ression leve ost ortholog ). A first assa and FIG R1, ng only figlα n of this gene triploid fem wo different restriction a ed together ction reactio m/Pharmacia µL of H2O and rpm. on enzymes w v.2.0 pro sited on Genb idation of f on the same cted for figlα gla_SqR1, (PCt of sox9a of and V lines the designed for D Protein domai
tion of gen
s of each gen e RT‐PCR in as internal c estrogens’ fl ducted with re performed of interest an ed to do the les from Gua ls ous gene wa ay for figlα e already desc primers and e. The identi males and di restriction e ssays with S with 10 µL o n was done Biotech), 1 d 2 µL off On were selecte gram (www bank (access figlα identit e previous se α expression CR condition D. rerio codin Squalius sp. int DNA amplificati ns are highlightne expressi
ne of interest multiplex w control beca uctuations ( h GoTaq® F d using Imag nd the contr e required s adiana was a as already iso expression le cribed in Pa d extending c ity of the am ploid males endonucleas SfaNI (New of PCR produ in 3h, at 37 1 µL of enzy ne‐For‐All bu ed based on t w.firstmarke sion number ty for triplo equences, an n levels quan ns in Table 2) ng sequence w trons. Small lin on and the gre ted as grey boxion
t (figlα, dmrt ith the hous ause its expr (Filby & Tyle lexi DNA P geJ software, ol one (rpl8) statistical tre always below olated for S. evels quantif la et al. (20 cycles to 40 w mplified fragm were confir es, SfaNI and England Bio uct, 7,2 µL o 7 °C and 300 yme (7U/µL) ffer (10x). Th the predicte t.com/cutte s FJ587500, oid females, nd confirme ntification us ). Ma with Squalius s es represent th y ones the inte xes. t1 and sox9a ekeeping rib ression has b er 2007), as olymerase calculating t ) for each sa eatment of a w to the min alburnoides fication were 09) (PCR co were conduc ments of dipl rmed using d HpaII. labs, Inc.), 0 of H2O and 2 0 rpm. For t were used he digestion d restriction r/cut2.html) PP, and FJ58 new intern d by eye. A sing the new aterial and me sp partial sox9 he location of p ernal primers de a) were sepa bosomal prot been describ those that (Promega C the ratio bet ample. STATI all data, alth nimum 6 req and S. pyren e conducted onditions list cted to outw loid females two indepe 0,8 µL of en 2 µL of NEBu the digestion for 10 µL o was carried n pattern obt for figlα 87501, AA). nal primers second assa w internal pr ethods 9a DNA primers, esigned rately tein l8 bed to occur Corp.). tween ISTICA hough quired naicus using ed on wit the (used ndent nzyme uffer 3 n with of PCR in 3h, tained gene were ay was rimersMaterial and methods
dmrt1 expression levels
dmrt1 teleost orthologous gene was already isolated in S. alburnoides and S. pyrenaicus (Pala et al. 2008a). For semi‐quantitative RT‐PCR convenience, new internal primers were designed based on dmrt1 gene sequences (GenBank accession numbers EU199439, PP, and EU199440, AA). Quantification of dmrt1 expression levels were conducted using internal drmt1_SqF1 and dmrt1_SqR1 primers, following PCR conditions found in Table 2. sox9a expression levels Expression levels of sox9a gene were assessed with new internal primers, sox9a_SqF1 and sox9a_SqR1, designed based on sequences obtained previously for S. alburnoides AA and S. pyrenaicus (PCR conditions in Table 2). Table 2. Primers and PCR conditions used. Genes dmrt1_SqF1 dmrt1_SqR1 0,1 95 °C 95 °C 58 °C 72 °C 72 °C AACCTGTCCGGTTCAGACAC ATAGGAGGCATCCACCATCA cDNA 2' 1 x 30'' 30'' 1' 32 x 5' 1 x
FIG F2 FIG R1 0,1 95 °C 95 °C 54 °C 72 °C 72 °C cDNA 2' 1 x 30'' 45'' 1' 35 x 5' 1 x fi gl a _SqF1 fi gl a_SqR1 0,1 95 °C 95 °C 60 °C 72 °C 72 °C AGTACATCCGGCTCCTCTCA TCCTCGGAAAGAAAGGGATT cDNA 2' 1 x 30'' 30'' 1' 34 x 5' 1 x
s ox9a F1 s ox9aR1 8 95 °C 95 °C 58 °C 72 °C 72 °C CGACCCYTACCTGAAGATGA GGGGTGRTCYTTCTTGTGCT DNA 3' 1 x 30'' 30'' 1' 30 x 5' 1 x
s ox9a F2 s ox9aR2 8 95 °C 95 °C 58 °C 72 °C 72 °C KKGAAAAGCGTCCCTTCGT ACGTCCYGGAAGTYGATGYT DNA 3' 1 x 30'' 30'' 1'15'' 30 x 5' 1 x
s ox9a _SqF1 s ox9a _SqR1 0,1 95 °C 95 °C 58 °C 72 °C 72 °C GAACGCGTTTATGGTGTGG GAGTGCACTTCTCCCATGCT cDNA 2' 1 x 30'' 45'' 1' 35 x 5' 1 x
rpl 8 Forward rpl 8 Revers e ‐ Final PCR reagents concentrations TAQ Buffer (x) MgCl 2 (mM) dNTP (mM) BSA (mg/mL) Pri mers (μM) TAQ (U/μL) Sa mpl e (ng/μL) 0,4 0,1 0,03 figlα 1 1,4 0,6 dmrt1 1 1,4 0,6 0,03 (Pa l a et al. 2009) 1 1,4 0,6 ‐ 0,4 0,2 0,03 0,7 0,2 ‐ 0,4 0,01 0,1 rpl8 (Fi l by & Tyler 2007) sox9a 1 1,4 1 1,5 1 1,5 Ea ch primer of gene of i nteres t Ea ch pri mer of rpl8 PCR program Primers 0,6 0,1 0,03 0,6 0,01 ‐ 0,02 0,2 ‐ 0,4 ‐ 0,02
Results
IV. Results
4.1. Histological observations of gonads
Temporal assessment of maturation statesWith the temporal series sampling from Guadiana catchment, a comparative assessment of gonads’ maturation progression between different ploidies and genomic forms of the complex was performed (Figure 4).
Outside the breeding season (October and November months) (Ribeiro et al. 2003), gonads were composed by immature germ cells, with ovaries presenting perinucleolar oocytes (e.g. Figure 4, a) and testicles spermatids and spermatogonias (located in clusters along tubules, Figure 4, p).
Triploid females captured in October (Figure 4, a) had only perinucleolar oocytes, while in November pre‐vitellogenic oocytes were also observed (Figure 4, d), which might be due to the fact that the November sampling was performed in a southern catchment comparing to the October one (Figure 1). A comparison between the maturation states of triploid and diploid females was only possible in October, since it was the only month in which both PA and PAA females were simultaneously captured. Results showed that diploid females presented pre‐
‐vitellogenic oocytes (Figure 4, b), while triploid ones had only perinucleolar oocytes (Figure 4, a).
Both sexes started maturating in January (Figure 4), with triploid females’ ovaries starting to be filled by early vitellogenic oocytes (Figure 4, f) and males developing spermatids surrounded by spermatogonias (Figure 4, r). Although no spermatocytes were observed, occasional spermatozoa were found (Figure 4, g and r). Note that no diploid females were captured in this sampling month. During S. alburnoides reproductive season (March and April) (Ribeiro et al. 2003), fully mature gonads were found in diploid and triploid females (data not shown for the diploid, but equivalent to the latter), presenting a large number of vitellogenic oocytes with granular yolk and some immature perinucleolar ones (Figure 4, h). Concerning males, testicles were full of sperm (Figure 4, t). Particularly in March, one morphologically identified ovary from a triploid female revealed to also present testicular tissue after histological sections (Figure 4, j and u). The ovary of this triploid individual presented a similar maturation state comparing to other females (Figure 4, h) and the testicular tissue was fully developed and contained sperm (Figure 4, u) as in males (Figure 4, t). Concerning April sampling month, similar results were found, although mature testicular tissue inside or surrounding ovaries was not found (Figure 4, l and
m).
Maturation states of other populations
Fishes from Sado river basin were captured in November in Castelhanos riverside (Table 1). As observed in Guadiana drainage, some relation between maturation state and ploidy/genomic composition was found. The only PA and PPA females captured presented less immature occytes (early vitellogenic oocytes) than PAA females (pre‐vitellogenic oocytes) (Figure 5, a and b).
Results
Figure 4. Histological sections of gonads of S. alburnoides males and females from Guadiana river basin along the year. On lateral sides is indicated the month of sampling. The bigger images are magnifications of some interesting or representative zones. 3n F female gonad from a triploid; 2n F female gonad from a diploid; 2n M male gonad from a diploid; po perinucleolar oocytes; pvo pre‐vitellogenic oocytes; evo early vitellogenic oocyte; vo vitellogenic oocyte; er erythrocytes; ct connective tissue; sg spermatogonia; st spermatids; sc spermatocytes; sz spermatozoa; l tubules’ lumen; cm cellular mass (it could be testicular tissue, glandular mass composed by Leydig cells, or even fragments of liver); arrow cells from cellular mass common to all fragments analysed (it could be spermatogonias, Leydig cells or hepatocytes); ts testicular tissue. n) magnification of a cellular mass from a triploid female that is representative of the one found in diploid females (b). h) image representative of maturation state of the diploid female found on March, who do not present the cellular mass. Sections of approx. 5 µm, stained with HE. Scale bars: (a‐d) and (g‐m) 100 µm, (e) and (f) 50 µm, (n‐t) and (v‐x) 25 µm, (u) 10 µm.
Similarly to the diploid female, S. pyrenaicus (PP) one presented early vitellogenic oocytes (Figure 5, c). In turn, S. pyrenaicus male gonad (Figure 5, i) was very similar to those found in Guadiana males outside the breeding season (Figure 4, p), being composed by tubules connected to each other and surrounded by spermatids and clusters of spermatogonias. The only tetraploid female captured had pre‐vitellogenic oocytes as found in the PAA females.
In Cobrão riverside (northern side of Tejo river), triploid females were fully mature in March, presenting vitellogenic oocytes (Figure 5, l). All males (PP, 2n and 3n) presented spermatocytes (Figure 5, e, f and m), although spermatozoa was only found in the diploids (Figure 5, m).
Concerning the independent drainage of Colares, in which S. alburnoides is absent, S.
pyrenaicus female ovary was filled with vitellogenic oocytes in March (Figure 5, d) and male
gonad was full of sperm (Figure 5, k). Surprisingly, the female presented some spermatozoa next to the female reproductive tissue (Figure 5, j and d).
Occurrence of a widespread adjacent cellular mass
Along all the sampling period and in all populations, fragments of an unexpected cellular mass were found next to the regular gonadal tissue, composed by small rounded cells with distinct and dense nuclei.
Concerning Guadiana catchment, although not found in all fishes sampled, this cellular mass was present in both males and females of S. alburnoides (Figure 5, e.g. f and g; Table 3). In males, this tissue remained constant along seasons (Figure 4, r and x), but in females it seemed to follow their maturation state (Figure 4, n and s), changing from a light coloured tissue to a more complex darker one, only found during the breeding season (Figure 4, s). In one case, connective tissue between the cellular mass and the ovary lamella was found (Figure 4, w). Table 3. Occurrence of the cellular mass in Guadiana’s sampling.´ Gonad’s side is stressed as the tissue coloration. Dark coloration was just found during reproductive period in females. The triploid female presenting clearly testicular tissue was not considered here. The referred cellular mass was also found in Sado catchment, not only in S. alburnoides triploid females (Figure 5, g), but also in the only captured S. pyrenaicus female (Figure 5, h),
Presence Sex Color Side N
Left 8 Right 14 Left 6 Right 7 Dark Left 3 Left 5 Right 3 Left 2 Right 2 Light M Light No F M Yes F
Figur place pyren gona perin sperm Leydi being (e.g. was p mass breed (simil re 5. Histologic e and month of
naicus), all the
d from a triplo nucleolar oocyt matids; sc sper ig cells, or even g similar to t Figure 4, o). Although present in th In the riv was found ding season lar to those f al sections of m sampling. The other images oid; 2n M male e; pvo pre‐vite rmatocytes; sz n fragments of he one foun in Colares ri e male (Figu ver from the in all male and in previo found in Gua
male and fema bigger images are from S. alb
gonad from a llogenic oocyte spermatozoa; liver); arrow ce d in fish from iverside the ure 5, k). e northern s e forms (Figu
ously analyse adiana femal le gonads of fis are magnificati burnoides. 3n F diploid; PP F f es; evo early vit ld Leydig cells; ells from cellula m Guadiana cellular mas ide of Tejo ure 5, e.g. m ed males, e.g les during re shes captured ions of some in F female gonad female gonad f tellogenic oocy ; cm cellular m ar mass commo drainage ou s was not fo catchment, m) (resembl g. Figure 4, r eproductive s from different nteresting or re d from a triploi rom a S. pyrena yte; vo vitelloge mass (it could b on to all fragme tside the rep und in S. pyr Cobrão rive ling those fo r and x) and i season, e.g. F southern basin presentative zo d; 2n F female aicus; PP M m enic oocyte; er be testicular tis ents analysed ( R productive s renaicus fem erside, the ce ound outsid in triploid fe Figure 4, s). ns. On lateral s ones. Unless PP e gonad from a male gonad from erythrocytes; s ssue, glandular (it could be spe Results eason male, it ellular de the males sides is indicate P is indicated (fr a diploid; 3n M m a S. pyrenaicu sg spermatogon r mass compos ermatogonias, L ed the rom S. M male us; po nia; st sed by Leydig
