These specific molecular features of mtDNA replication were manipulated by altering the expression of the multifunctional DNA binding protein TFAM as well as by expressing catalytic mutants of mitochondrial DNA polymerase gamma (PolG) and Twinkle DNA helicase in cultured cells human. Faithful replication of mtDNA ensures the maintenance of the respiratory chain in future cell generations.
Mitochondria
The gradient is released through the F1Fo-ATP synthase complex, allowing the synthesis of high-energy ATP molecules. The formed electrochemical gradient is released through ATP synthase (CV), and the energy obtained is used to drive the energetically unfavorable reaction of ATP synthesis (ADP + P´Æ ATP).
Mitochondrial origins
It is estimated that more than 99% of mitochondrial proteins are encoded by nuclear genes today (Gray et al. 1999). In addition to the trend of gradual reduction of the mitochondrial genome and its functions through the evolution of eukaryotes, there is also evidence that the complete loss of the mitochondrial genome has also occurred in some lineages (Biagini et al. 1997, Hackstein et al. 1999 , Dyall & Johnson 2000).
The mitochondrial genome
The structure and organization of mtDNA
In addition to the gene content, there is also a high variability in the size of the mitochondrial genomes. Other multipartite mtDNAs can be found in the phylum Cnidaria, several of which possess mitochondrial genomes consisting of two to four non-identical linear DNA molecules (Ender & Schierwater 2003).
The human mtDNA
More organized and uniform linear genomes can be found in the mitochondria of some ciliate protozoa such as Paramecium and Tetrahymena, as well as in algae such as Chlamydomonas and yeasts such as Candida (Nosek & Tomaska 2003). In the NCR, there can also be a special triplex structure, the displacement loop (D-loop), where a 650 bp long single-stranded DNA molecule (7S DNA) is hybridized to.
Instead, paternal mitochondria are recognized and tagged for proteolytic destruction by adding the peptide marker ubiquitin ( Sutovsky et al. 2000 ). It may be that mussel DUI has evolved to counteract this imbalance of sexual selection (Breton et al. 2007).
Segregation of mtDNA and maintenance of homoplasmy
It is worth noting that in cultured cells and in the absence of selection, the overall mitochondrial genotype can be relatively stable, with an estimated segregation number >1000 (Lehtinen et al. 2000). In rapidly dividing somatic cells, changes in heteroplasmy result from clonal expansion and random drift over several generations (Elson et al. 2001).
Mitochondrial nucleoids
General aspects of DNA replication
The proteins mentioned above are the key players in the replication fork; however, the functional replicase complexes capable of DNA replication alone are multicomponent machines. Unlike mitochondrial genomes, chromosomal DNAs are huge molecules whose sheer size accounts for most of the complexity involved in their replication (Johnson & O´Donnell 2005).
Replication of T7 phage
Interrupted lagging strand replication is predetermined by the primase activity of gp4. The gp4 primase-helicase cleaves the template duplex and adds short RNA primers to the lagging strand every 0.5–6 kb.
Replication of T4 phage
The first fork can recruit another replisome and initiate bidirectional replication from the site of strand invasion. The second leading strand is initially prepared with the Okazaki fragment of the first replication fork.
Replication of circular bacterial plasmids
The theta mechanism
One of the best characterized termini are ter sequences in plasmid R6K, which function as a terminus for unidirectional theta replication. The stalling of the replication fork may be due to the presence of an unhybridized RNA strand (Solar et al.
Strand displacement replication
Rolling circle replication (RCR)
Continuous replication of the leading strand is possible, producing head-to-tail concatemers of multiple genome sizes, which are later processed into circular monomers by recombination. The final step of RCR is the replication of the displaced single-stranded parental (+) strand into dsDNA.
Special aspects of replicating linear DNA
They take advantage of an enzyme-associated RNA template to synthesize short telomeric repeat sequences and ligate them to the 3' ends of chromosomes. It is hypothesized that rolling circle replication of telomeres may take advantage of the t-loop formation.
Replication of mitochondrial DNA
- Theta replication
- Rolling circle replication (RCR)
- Recombination‐dependent replication
- Replication of linear mtDNA
- Reverse transcription in mitochondria
- Replication of animal (vertebrate) mtDNA
- Proteins of the mammalian mitochondrial replisome
Yeast mtDNA can replicate in the absence of RNA synthesis, indicating that other priming mechanisms are equally important (Fangman et al. 1990). The recent discovery of recombination initiation in ρ-genomes lends further support to this hypothesis (Ling et al. 2007).
As an example, the mtDNA helicase Twinkle bears striking similarity to the T7 phage primase/helicase protein gp4 (Spelbrink et al. 2001). The only mitochondrial protein known to have contrahelicase activity in vitro is mtDBP, a homologue of the mammalian sea urchin mTERF (Polosa et al. 2005).
Interestingly, Tus can also block transcription in a similarly polar fashion and transcription from the permissive direction can overcome the replication block (Mohanty et al. 1996). Interestingly, different cells differ in their ability to repair mtDNA (LeDoux et al. 1998, LeDoux et al. 1999).
General aspects of recombination in regard to mitochondrial DNA
It has even been suggested that the early eukaryotes inherited their recombinases from the ancestral endosymbionts (Lin et al. 2006). There is also genetic evidence that some metazoans have recombinogenic mtDNA (Ladoukakis & Zouros 2001, Burzynski et al. 2003).
Tissue-specific requirements for energy production and mtDNA copy number control
Fairly recently, a case of bioparental transmission in a human individual with a fraction of recombinant mtDNA between the parental types was reported (Kraytsberg et al. 2004). More likely, it is part of the link between mitochondrial biogenesis and external stimuli - such as exercise (Wang et al. 1999) and hormones (Moraes 2001).
Due to its highly active metabolism in the adult heart, there are significant changes in the mitochondrial physiology of the heart muscle during development (Lopachuk et al. 1992). Both mitochondrial mass and mtDNA copy number increase during development in anticipation of the O2-rich environment outside the mother (Marin-Garcia et al. 2000).
Human mitochondrial disorders and heart pathology
A few reported cardiac manifestations of DNA maintenance disease are associated with autosomal recessive progressive external ophthalmoplegia (arPEO) (Bohlega et al. 1996). Similarly, knockout of manganese superoxide dismutase (MnSOD), one of the enzymes responsible for the elimination of reactive oxygen species in mitochondria, caused dilated cardiomyopathy in mice (Li et al. 1995).
Mitochondria, ischemia, preconditioning and damage response in human heart
Inflammation due to ischemic myocardial injury can also cause myocardial remodeling in dilated cardiomyopathy (DCM), where the pumping efficiency of the heart decreases due to the enlargement of the left ventricle (Pankuweit et al. 2004). This study was designed to address the significance of the abundant recombination in human heart mtDNA (Kajander et al. 2001).
TFAM contructs
The restriction-digested PCR product was ligated into the HindIII + BamHI-cut pcDNA3.1(+) vector (Invitrogen), to create the mtTFApcDNA3.1 construct for transient expression. This clone was used to generate two constructs using one of the AUGs (mtTFA-sv133, mtTFA-sv155).
Twinkle and PolG constructs
Mitochondrially targeted RecA constructs
Sequencing
RNA interference studies (RNAi)
Cell culture and transfections
Inhibition of replication and transcription
Creation of doxycyclin-inducible Flp-In™ T-Rex™ -293 cell lines
Transgenic mice
Autopsy samples
RNA and DNA extraction and quantification
- DNA from cultured cells
- DNA from tissues
- mtDNA copy number estimation
- RNA extraction and quantification from cultured cells
Copy number was also assessed by quantitative real-time PCR with Taqman probes for mitochondrial cytochrome b and amyloid precursor protein (APP) as a single-copy nuclear DNA standard. The probes were 32P end-labeled oligonucleotides as follows (5' to 3'): for ND3 mRNA, GTCACTCATAGGCCAGACTT, for 5S rRNA (loading control), GGGTGGTATGGCCGTAGAC, for tRNALeu(UUR) and tRNATyr as described previously (alu et al. 2002). , altoomp). ).
Isolation of mitochondria
From cultured cells
From human and mouse tissues
The supernatant was transferred to a fresh tube and centrifuged again at 9000 gmax for 10 minutes at 4°C to pellet the mitochondria. After centrifugation, the mitochondrial layer was transferred to a fresh 2 ml tube and one volume of HB was added.
Isolation of mtDNA
Sub-fractionation of mitochondria
SDS PAGE and Western blots
Immunocytochemistry
Enzymatic treatments of DNA
One-dimensional agarose gel electrophoresis
Southern blotting
Two-dimensional neutral-neutral agarose gel electrophoresis (2DNAGE)
Interpretation of 2DNAGE results
Therefore, when the lagging strand is rich in RNA, replication intermediates migrate as higher molecular weight species with different lengths of asymmetric Y-arms depending on the extent of RNA incorporation. In case ii, most of the replication intermediates are tailed circles (t), which start from uncut monomeric circles (nc) and grow in size until they reach 2nc and form a distinct "eyebrow" arc.
Radiolabeled probes and blot hybridization
In case i, the constraint site is too far from the unilateral origin, resulting in an almost complete bubble arc (b). These will migrate as a band from the 2nc dimeric species (uncut circular molecules; either catenanes or termination intermediates).
Transmission electron microscopy (TEM)
In the following subsections, I will briefly summarize the key findings reported in the original publications I-IV. In an attempt to integrate these findings into a comprehensive view of mtDNA replication and recombination in mammals, some unpublished supporting data are also presented. More background information on mtDNA maintenance is available to place the findings in context.
Structure of mammalian mtDNA replication and recombination intermediates
Electron microscopy of mtDNA from cultured cells (unpublished data)
Exactly as predicted by the RITOLS model of mtDNA replication, the double-stranded theta intermediates were transformed into partially single-stranded SDM-like intermediates by RNase H treatment (Figure 5.4). RNase H treatment converts double-stranded theta molecules into partially single-stranded SDM-type intermediates.
Electron microscopy of mtDNA from human heart (IV)
Comparative analysis of mtDNA from various human tissues by 1D‐ and 2D‐AGE (IV,
As seen in Figure 5.8B-:i, the single genome-length supercoil (sc) migrated more slowly in the second dimension, with the same mobility as the open circles. Recombinant circular molecules as well as the 33 kb circles are likely to migrate to the same position as the 16.6 kb catenated circles (see Figure 5.12.).
Effects of mtDNA-binding proteins on mtDNA replication and recombination
- Manipulation of TFAM expression in cultured cells (I)
- Manipulation of Twinkle DNA helicase and PolG expression in cultured cells (II and
- Expression of mitochondrially‐targeted RecA (unpublished data)
- Manipulation of mTERF expression in cultured cells (III)
- Overexpression of Twinkle and TFAM in vivo in transgenic mice (IV)
In addition, a specific accumulation of replication intermediates was observed in the rDNA region after the natural pause site (Figure 5.10). Similarly, accumulation of replication intermediates in the OH region was observed on 2DNAGE of mtDNA from cells overexpressing mTERF (Fig. 4C in Article III).
Physiological variables affecting mtDNA replication and topology
Because mtDNA must be packaged into nucleoids, the copy number must be related to either the size or the number of nucleoids. Heart had the highest copy number of about 11,000 and lymph node the lowest of about 500 mtDNA copies per cell.
Oxidative damage of mtDNA and replication stall (unpublished data)
Modified mtDNA RIs in a case of a ischemic heart disease (unpublished data)
Most of the research has been concentrated on cultured cells or only on one model mammal - the mouse. Overall, the work published in the original communications I-IV has contributed to deepening our understanding of the maintenance of mammalian mtDNA.
Mitochondrial DNA replication in mammalian tissues and cultured cells
If MTRPOL is associated with the replication fork, synthesis of the lagging strand of RNA would be interrupted, as in the case of Okazaki fragments. This may be due to reduced compaction of the DNA template, resulting in better access for RNA polymerase.
Replication pausing in human mtDNA
In most cases described, the RFB blocks the replication fork until transcription enters the RFB from the permissive direction, removing the pause-binding protein and allowing DNA synthesis to continue (Mohanty et al. As transcription in cells overexpressing TFAM is inhibited, is reduced (at least when judged by the transient ND3 mRNA levels), this could indicate that, without the transcriptional illumination of the pause site, the replication complexes that reach the pause site stop and eventually pass through the rRNA in slow motion stutter area.
RDR in mammalian mitochondria
Interestingly, in cells overexpressing TFAM, there was a significant accumulation of replication intermediates in the rRNA region immediately downstream of the IQM pause site (Figure 5.10). At least in TFAM-overexpressing cells, there is a notable increase in Y-forms in 2DNAGE PvuII digested mtDNA (Fig. 2b:iv-vi in I).
A hypothesis for origin independent COSCOFA replication in cultured cells
Fixed replication forks must be resolved, leading to double-strand breaks (Figure 6.5) or fork regression, generating dsDNA linears. The distance of the replication forks from the branch point is equal and the distal end of the linear arm will map outside the bubble region, if the sequences are assumed to be homologous.
Modulation of mtDNA topology
In yeast, the TFAM homologue Abf2p is involved in the partitioning of mtDNA into daughter cells, although this process involves recombination rather than decatenation (MacAlpine et al. 2000). It is possible that they are held together by hemicatenation after ligation of at least one of the strands.
The sunken 3' end strand penetrates a homologous site further away in the same molecule, resulting in a deleted molecule when the bonds are dissolved.
Cardiac muscle mtDNA replication – physiology and pathology
2000: Diversity in organization and the origin of gene orders in mitochondrial DNA molecules of the genus Saccharomyces. After exposure of the lagging-strand initiation site (OL), synthesis of the nascent L-strand begins (4,5).