heterologous protein expression
Heterologous protein expression is enhanced by harmonizing the codon usage frequencies of the target gene with those of the expression host.
... change protein structure and function, indicating that protein structure depends on DNA ...During heterologous protein expression, low expression or formation of insoluble ...
10
Translational arrest due to cytoplasmic redox stress delays adaptation to growth on methanol and heterologous protein expression in a typical fed-batch culture of Pichia pastoris.
... Pex5p. Expression of the ...The expression of SEC61 in GS115 was down-regulated within 2h of methanol addi- tion (S16 ...of expression of SEC61 has to be seen in the light of declining ER ca- ...
25
Xenobiotic Compounds Degradation by Heterologous Expression of a Trametes sanguineus Laccase in Trichoderma atroviride.
... [7]. Heterologous protein expression in microbial hosts such as Saccharomyces cerevisiae is many times hindered probably due to differences in the glycosylation pattern of the enzyme ...that ...
13
Engineering attenuated virulence of a Theileria annulata-infected macrophage.
... relative expression shows adam19 and mmp9 are diminished and timp3 levels are augmented in V-Delta 169 ...ADAM19 protein levels are also decreased in V- Delta 169 ...
8
Expression of p53 protein in pituitary adenomas
... Expression of p53 protein has seldom been studied in pituitary adenomas and dif- ferent results were obtained in the available reports. A number of studies failed to detect p53 in adenomas and even in ...
5
Allergenic properties of apples – molecular basis, factors determining level of allergens
... W rejonie Morza Śródziemnego, gdzie nie rośnie brzoza, głównym alergenem jabłek jest Mal d 3 (Fernández-Rivas i in., 2006; Gao i in., 2005b). Jest to małocząsteczkowe białko o masie 9 kD, które zaliczono do grupy 14 ...
8
Protein Expression upon Desiccation and Imbibition of
... Total protein extracts were prepared from the seeds dried at different water contents and from the seeds subsequently imbibed for 10 ...Total protein was extracted according to Gallardo et al (2003), with ...
12
Global Identification of EVI1 Target Genes in Acute Myeloid Leukemia.
... retinoblastoma protein (Rb), a tumor suppressor that prevents excessive cellular division ...Serpinb2 expression to surprisingly high levels (up to 10,000- fold) ...PAI-2 protein due to a ...
18
Improved cellulolytic efficacy in Penicilium decumbens via heterologous expression of Hypocrea jecorina endoglucanase II
... As expected, expression of Hjegl2 in P. decum- bens led to increased CMCase activity. However, since the ilter paper assay is an indication of what can be considered total cellulase activity in the sense that it ...
10
Deregulated expression of Nucleophosmin 1 in gastric cancer and its clinicopathological implications
... mRNA expression did not differ between tumors and non-neoplastic ...mRNA expression, about 27% of GC presented more than ...increased expression compared to matched non- neoplastic ...increased ...
10
miR-221 Promotes Epithelial-Mesenchymal Transition through Targeting PTEN and Forms a Positive Feedback Loop with β-catenin/c-Jun Signaling Pathway in Extra-Hepatic Cholangiocarcinoma.
... the expression of miR-221 and miR-222 in pros- tate carcinoma and glioblastoma cells ...the expression of miR- 221 in ...the expression of the oncogenic miR- 221 in both QBC939 and HuCCT1 ...the ...
16
A new chitinase-like xylanase inhibitor protein (XIP) from coffee (Coffea arabica) affects Soybean Asian rust (Phakopsora pachyrhizi) spore germination
... constitutive expression in Pichia pastoris pGEM T-Easy bearing CaclXIP gene from ...mature protein: CaclXIPfwd 5’ TAAGAATT- CAA GCTGGAATTGCCACCTAC 3’; CaclXIPrev 5’ TT AGTCGACCTCATCCACAAAAGACTTTATCATG ...
8
Preparative scale production of functional mouse aquaporin 4 using different cell-free expression modes.
... This protein is an important central regulator of cerebrospinal fluid which has to be very tightly controlled in order to prevent intracranial pressure resulting in compression of brain tissue, neurological ...
8
Fungal His-tagged nitrilase from Gibberella intermedia: gene cloning, heterologous expression and biochemical properties.
... nitrilase superfamily. As previously reported, nitrilase contained the invariant catalytic triad residues, glutamate, lysine and cysteine as one of the members in the nitrilase superfamily [26]. The amino acid residues ...
8
Isoflurane induces learning impairment that is mediated by interleukin 1β in rodents.
... the expression of interleukin 6 (IL-6), activated/cleaved caspase 3 and cluster of differentiation 11b (CD-11b) in rat brain ...CD-11b protein abundance quantified by integrating the volume of ...
11
Comparative transcriptome analysis of two rice varieties in response to rice stripe virus and small brown planthoppers during early interaction.
... gene expression profiling following different treatments of two rice ...gene expression measurements; thus, it avoids many of the inherent limitations of microarray ...gene expression between the ...
9
Investigating the localization of an avian hairy homolog (c-Hairy1) protein
... oscillatory expression of c-hairy1 in the chick embryo PSM, many of the studies have been much focused on the understanding of the gene expression mechanisms rather that in the protein mechanisms ...
111
EXPRESSION OF SCHISTOSOMAL CATHEPSIN L1 IN Escherichia coli AND EVALUATION OF ITS PROTECTIVE CAPACITY IN AN ANIMAL CHALLENGE Miyasato PA (1), Ramos CRR (2), Abreu PAE (3), Dias WO (2), Nascimento C (1), Ho PL (2), Kawano T (1)
... high-level expression of heterologous proteins in Escherichia ...recombinant protein was expressed as inclusion bodies, purified under denaturing conditions through nickel-charged chromatography and ...
16
Extraction of matrine from Sophora flavescens Ait. and evaluation of its inhibitory effects on human nasopharyngeal carcinoma CNE-2 cells
... This study has obtained the relatively optimal extraction and purification technology of matrine from Sophora flavescens Ait., under which the purity of matrine is 81.56%. On addition, the in vitro experiments indicate ...
5
Heterologous expression in Caenorhabditis elegans as an alternative approach to functional studies in Schistosoma mansoni
... Protein kinases (PK) play key roles in signaling pathways and have been proposed as potential targets for the devel- opment of new anti-schistosome drugs (Dissous et al., 2007). Approximately 1.9% (252 proteins) ...
5