454-pyrosequencing

Understanding the mechanisms beyond the resistance of coffee plants (Coffea spp.) to leaf rust (caused by Hemileia vastatrix) is of vital importance for breeding coffee varieties with durable resistance. However, loss of resistance due to the appearance of new rust races is occurring, but some genotypes are still resistant to all known H. vastatrix races, such as HDT832/2. Previous studies show that the resistance to H. vastatrix in this genotype shares common immunity components with the nonhost resistance. 454 pyrosequencing transcriptomic data representing HDT832/2 host and nonhost resistance, along a healthy plant control, were analyzed with the purpose of better understanding this resistance. Expressed sequence tags (ESTs) are a very common and interesting solution for transcriptomic studies because they lack the non-expressed part of the genome. The small amount of reads generated for this project present a limitation that has not an established solution. To analyze this dataset, two different assembly strategies (individual assembly versus global assembly) and two different assemblers (Newbler versus MIRA) were used, and the results of all four assemblies are reported and analyzed. Assemblies were compared by assessing the number of transcripts shared by the three libraries, by a blast searches against NCBI nr protein and Coffea spp. EST databases and searching for previously studied genes. Overall the global assembly strategy performed better than the individual strategy, and Newbler performed better than MIRA in most but not all parameters. Here we provide a good strategy for small budget transcriptome projects to optimize their data and we present an annotated transcriptome of coffee line HDT832/2 resistance response to rust in host and nonhost interactions.

Deep sequencing technologies are transforming the resolution at which the genetic complexity of viral populations can be assayed. Using the 454 pyrosequencing strategy we identified 17 residue changes unique to D2S10 that were previously unrecorded (Table S1). 53% of these in D2S20 reverted back to the parental virus sequence found in PL046, suggesting they play little role in the enhanced mouse virulence phenotype. Even after 20 passages in vivo, little variation was seen in the genome. However, D2S20 is a fitter virus than D2S10 in mice. The outcome of D2S20 infection may be a combination of host and viral factors such as viral replication, increased viral loads, dissemination, and host immune response. Reverse genetic experiments will be needed to elucidate the functional contribution of the mutations captured in this study.

The DNA was extracted using the PowerSoil DNA extraction kit (MO BIO Laboratories, Inc., Carlsbad, CA) according to the instruction, and the DNA was amplified using universal bacterial primer 8F (5’-3’ AGAGTTTGATCCTGGCTCAG) and 533R (5’-3’ TTACCGCGG CTGCTGGCAC ) covering the V1 and V3 regions. Different ten-nucleotide barcode sequences and pyrosequencing adapters were added at the 5’ end of the universal bacterial primer. The PCR products were purified using the TaKaRa Agarose Gel DNA Purification Kit (TaKaRa, China) and quantified using NanoDrop. 454 pyrosequencing was carried out using the Roche 454 FLX Titanium platform at the National Human Genome Centre of China at Shanghai, China (CHGC).

All 11 species in the mock community were retrieved by 454 pyrosequencing of the SSU rDNA V4 region, when using RNA/ cDNA as template and primer pair Hap454. For a sample consisting of 11 species of haptophytes, with equal proportions in terms of cell number, rarefaction analysis suggested that 1400 reads were required to recover all of the species, with our primers and experimental setup. Relative read abundance did not correlate to relative cell numbers, and showed only a weak correlation to proportional biomass of the different species. 454 pyrosequencing data from environmental studies should therefore be interpreted with caution with respect to abundance both in terms of cell numbers and biomass of the different taxa. However, to obtain an estimate of relative abundance in terms of biomass of a haptophyte taxon, DNA as template may possibly be more appropriate than cDNA. Data on average cell size and rRNA gene copy number of species found in a sample may help to interpret the proportional read abundance in terms of proportional biomass abundance. To retrieve most of the active diversity present in a sample, cDNA as template may be the choice, although care should be taken to avoid increased chimera formation associated with cDNA synthesis.Of the filtering methods we tested, Table 5. Summary statistics of the 454 pyrosequencing reads and effect of bioinformatic filtering strategies.

Culture-based methods have been extensively applied in the field of petroleum microbiology [13], [20]. However, due to their multi-extremophilic lifestyles only a very small fraction of the microbial diversity can be accessed using culture-based methods. In more recent studies, culture-independent approaches such as 16S rRNA gene cloning and sequencing, denaturing gradient gel electrophoresis (DGGE) and terminal restriction fragment length polymorphism (T-RFLP) have been successfully used providing insights into the uncultivated microbial communities in subsurface petroleum reservoirs [1], [4], [5], [21], [22], [23]. Nevertheless, the traditional molecular methods are often limited to the analysis of a relatively small number of clones and thus only a small fraction of the microbial diversity has been unraveled by the previous studies. During the last 5 years, new technologies have been developed that provide better access to microbial diversity. Tag-encoded FLX amplicon pyrosequencing (TEFAP), developed by Roche 454 Life Science (Branford, CT, USA), is a technique making possible to obtain high numbers of DNA reads through a massively parallel sequencing-by-synthesis approach [24]. This technology is now widely used to analyze the microbial community in various types of environmental samples, such as soil [25] and marine water [26]. However, to the best of our knowledge, until now only two studies have been published on the microbial diversity of Canadian oilfield using TEFAP [27], [28].

Figure 5. Identification of Methanoculleus variants. Partial view (A) of pyrosequencing reads aligned to the 16S rRNA sequence of Methanoculleus bourgensis (Genbank accession AY196674). Colored bases indicate differences between reads and the reference (shown in the bottom line). In the depicted part, two of the seven different variants are visible. To characterize the variants, a phylogenetic tree (B) was constructed together with various reference sequences. Most variants show close relationship to M. bourgensis; only variant VAR2 was placed in another branch formed by M. marisnigri, M. palmolei, M. chikugoensis and M. thermophilus. Several 16S rRNA sequences from the genus Methanoculleus were used: M. olentangyi (AF095270), M. bourgensis (AY196674), M. palmaeoli (Y16382), M. thermophilus (AB065297), M. chikugoensis MG62 (AB038795) and M. marisnigri JR1 (CP000562 (Memar_R0043)). Additional sequences in increasing taxonomic distance were included as outgroups: Methanosarcina mazeii (MMU20151), Methanococcus vannielii SB (CP000742 (Mevan_R0025)), Clavibacter michiganensis ssp. michiganensis NCPPB 382 (AM711867 (CMM_RNA_0001)) and two sequences from Escherichia coli K12 DH10B (NC_010473 (ECDH10B_3945 and ECDH10B_2759)).

ronmental acquisition and accumulation of poribacterial cells by sponge hosts from seawater. Such a mode of trans- mission could well explain the observation of genetically similar poribacteria inhabiting diverse sponge hosts over wide geographical scales. However, it has been demons- trated that vertical transmission of poribacterial symbionts in sponges is also likely to occur. For instance, a poribac- terial 16S rRNA gene sequence was reported in a Corticium sp. embryo (Sharp et al., 2007). Furthermore, Schmitt et al. (2008) detected poribacterial 16S rRNA gene sequences in both adult and embryo specimens of Agelas conifera, thus showing that these bacteria may effectively be vertically transmitted in sponges (Schmitt et al., 2008). Thus, the growing body of evidence points to the recognition of the Poribacteria as marine sponge symbionts that might exhibit both vertical and environmental modes of transmis- sion in the association with their hosts. Poribacterial 16S rRNA genes have mostly been studied in a more qualitative approach, whereby sequence representatives are solely used in the inference of phylogenetic relationships. Al- though such an approach is efficient in demonstrating that similar poribacterial sequences occur across large geo- graphic scales and in different sponge hosts, it does not enable assessments of diversity and structure within the group in a particular sample, or variations thereof across multiple samples. Here, the examination of the PC+PT clone library using 99% gene similarity cut-off resulted in a total of 25 observed poribacterial OTUs, delivering an esti- mated “OTU richness” of 36 and about 40 as determined by Chao1 and ACE richness estimators, respectively (Ta- ble 1). Such numbers drop to 9 observed and about 9-10 theoretical poribacterial OTUs in this library when the cut-off criterion used is 97%. We further observed that OTUs determined at both confidence thresholds displayed frequency abundance ranks typical of natural biological as- semblages (see Fig. 1 for abundance ranks of OTUs at 99% cut-off). Taken together, these results imply the coexis- tence of several poribacterial genotypes in a single sponge host, and are indicative of a prevalently “intra-specific” poribacterial genotypic diversity in A. fulva on the basis of 16S rRNA gene diversity assessments. Interestingly, a re- cent next generation 454 pyrosequencing study ranked the Poribacteria as the third most diverse bacterial phylum re- trieved from 32 marine sponges collected worldwide and, in accordance with this survey, several poribacterial OTUs at 97% similarity cut-off could be retrieved from a single host species (Schmitt et al., 2012).

Massively-parallel DNA sequencing using the 454/pyrosequencing platform allows in-depth probing of diverse sequence populations, such as within an HIV-1 infected individual. Analysis of this sequence data, however, remains challenging due to the shorter read lengths relative to that obtained by Sanger sequencing as well as errors introduced during DNA template amplification and during pyrosequencing. The ability to distinguish real variation from pyrosequencing errors with high sensitivity and specificity is crucial to interpreting sequence data. We introduce a new algorithm, CorQ (Correction through Quality), which utilizes the inherent base quality in a sequence-specific context to correct for homopolymer and non-homopolymer insertion and deletion (indel) errors. CorQ also takes uneven read mapping into account for correcting pyrosequencing miscall errors and it identifies and corrects carry forward errors. We tested the ability of CorQ to correctly call SNPs on a set of pyrosequences derived from ten viral genomes from an HIV-1 infected individual, as well as on six simulated pyrosequencing datasets generated using non-zero error rates to emulate errors introduced by PCR. When combined with the AmpliconNoise error correction method developed to remove ambiguities in signal intensities, we attained a 97% reduction in indel errors, a 98% reduction in carry forward errors, and .97% specificity of SNP detection. When compared to four other error correction methods, AmpliconNoise+CorQ performed at equal or higher SNP identification specificity, but the sensitivity of SNP detection was consistently higher (.98%) than other methods tested. This combined procedure will therefore permit examination of complex genetic populations with improved accuracy.

Pyrosequencing using the 454 platform on non-model organ- isms is increasingly proven to be an effective and efficient means to provide large scale transcriptomic information. Given the dynamic nature of gene expression, advances in technology and the variety of analytical techniques available make it difficult to directly compare studies, however generally our results are similar to other sequencing efforts. One of the initial applications of 454 pyrosequencing on non-model organisms was carried out on the butterfly, Melitaea cinxia [12]. More recently, this platform has been used to provide resources for aquatic organisms of ecological importance. In the lake sturgeon (Acipenser fulvescens), 47,060 reads were produced and assembled into 1831 contigs [13]. In chum salmon, two individual fish testes were sequenced and combined, resulting in 1.9 million reads and 118,546 contigs [8]. In both of these efforts, novel SNPs were characterized. In addition to using 454 pyrosequencing for gene discovery and SNP development, the platform provides the opportunity for large-scale expression analysis (RNA-Seq) in organisms of ecological importance. For example, in the lake trout (Salvelinus namaycush), 425,821 quality- trimmed reads from liver tissue were assembled into 2276 contigs that were then used for comparative transcriptomic analysis of two lake trout ecotypes [14]. In the studies listed above, methodologies other than pyrosequencing were employed for SNP validation (e.g. HRMA analysis and Sanger sequencing) and RNA-Seq analysis (e.g. quantitative reverse transcription PCR). Likewise, we present Figure 2. Functional categorization of contig sequences. Contig sequences were generated from de novo assembly of both libraries (n = 42,953) and annotations performed using BLASTx with Swiss-Prot and Gene Ontology databases.

main technologies are 454 pyrosequencing technology, Illumina sequencing technology, SOLiD sequencing technology, Ion Torrent sequencing technology and Single Molecule Re[r]

In this study, we developed a suite of molecular mark- ers for the brown brocket deer M. gouazoubira, the most abundant deer species of the Neotropical region (Duarte, 1996). In order to characterize the genetic structure of M. gouazoubira and determine the impact of habitat fragmen- tation on the genetic variability of deer populations, we un- dertook a partial 454-pyrosequencing run based on which we designed a set of seven polymorphic microsatellite markers and recovered the full mitochondrial DNA se- quence. Combined, these markers will provide a valuable resource for investigating the population genetics and de- mographic history of M. gouazoubira in response to habitat fragmentation in South America.

Normality (Shapiro-Wilk) and equal variance tests were performed to inspect the distribution of the OTU richness and diversity measures, as well as of relative abundance values of the most dominant bacterial phyla and genera found across the seven sample categories, all estimated from 454-pyrosequencing data. One-Way Analysis of Variance (ANOVA) was performed on log-transformed alpha diversity measures (OTU richness, Chao1 and Shannon indices), all of which showing normal data distributions, to test whether mean values obtained for all sample groups were equal, followed by all pair-wise multiple comparison procedures using the Holm-Sidak method to determine significance between groups, in our case the seven sample categories. The Kruskal-Wallis test (One-Way ANOVA on Ranks) was employed to test whether the relative abundances of the most dominant bacterial phyla and genera changed significantly across the seven sample categories, given the absence of normal data distributions in most cases. A post- hoc Dunn’s test was used to verify differences among sample categories in a pair-wise manner. Analyses were conducted using SigmaPlot 11 (Systat Software Inc., London, UK). Jackknifed beta-diversity procedures were run within the QIIME environment (jackknifed_beta_diversity.py) to test the statistical validity of sample groups generated by cluster and ordination (PCoA) analyses of OTU data, and thus whether bacterial community profiles generated by 454 pyrosequencing could discriminate between the seven sample categories defined in this study. The Similarity Percentage (SIMPER) test (Clarke, 1993) was run on PAST software (Hammer et al., 2001) version 3.10 to identify which bacterial OTUs contributed the most to the (Bray-Curtis) dissimilarities observed among microhabitats.

Consequently, in this study, we used 454 pyrosequencing to: (1) reveal the diversity and structure of microbial communities in groundwater and sediments with different geochemis- try; (2) assess the potential relationships between microbial communities and geochemical conditions, and subsequently (3) evaluate the putative roles of microorganisms in As release and mobilization in arsenic-rich aquifers of the Hetao Basin in Inner Mongolia of China. To achieve these objectives, a coordinated geochemical and molecular survey was conducted on 20 groundwater samples and 19 sediments from three boreholes in Hangjinhouqi County. The re- lationships among microbial diversity, community structure, and geochemistry were explored. The results of this study identify certain microorganisms that may be potentially important in regulating As biogeochemical transformation in the basin and expand our current understand- ing of As geomicrobiology in high As aquifers around the world.

O uso benéfico deve considerar a caracterização e classificação do material dragado, bem como a avaliação ambiental e a análise da viabilidade econô- mica e operacional das opções de disposição, atendidas às regulamentações específicas e pertinentes. Para isso, o empreendedor poderá elaborar pro- postas ao órgão ambiental licenciador em parceria com instituições, enti- dades públicas, universidades, empresas e organizações da sociedade civil. A regulamentação desse tema na Resolução CONAMA n° 454/12 demonstra que a revisão da Resolução CONAMA n° 344/04 não se limitou aos valores orientadores previstos na Tabela III de seu Anexo, avançando também em outros aspectos relativos ao gerenciamento e disposição do material dragado. A avaliação quanto ao uso benéfico dos materiais oriundos de dragagens contribui para evitar ou mitigar os impactos ambientais negativos decorrentes dessas atividades.

Com tudo isso, no contexto de acelerada urbanização do mundo, jovens e adolescentes começaram a aparecer como categorias identitárias, enquanto o aumento dos crimes gerou uma notorieda[r]

A partir desta versão, estas cons- tantes devem ser obtidas por meio de calibração do equi- pamento escolhido para medir textura e atrito, como os e- quipamentos CT-Meter (Circular Textu[r]

Avaliação das competências básicas, sociais, comunicativas e linguísticas de crianças com PEA De acordo com Quill, Bracken & Fair 2002, os instrumentos de avaliação podem ser: formais – [r]

as teses sobre a metáfora são sustentadas. É, semelhante ao que faz John Searle, a partir dessa sua filosofia da linguagem e da comunicação que Davidson pode identificar como equívoco [r]

O trabalho de investigação que nos propusemos realizar, como dissertação do Mestrado de Psicologia da Educação, especialização em Necessidades Educativas Especiais, [r]

Têm-se então como fatores facilitadores para a implantação e implementação nos municípios estudados, principalmente: 1)  a presença de médicos homeopatas no serviço; e 2)  a adesão e [r]