Top PDF Aplicação da reação em cadeia da polimerase (PCR) e amplificação aleatória de DNA polimórfico (RAPD-PCR) na detecção e identificação de Leptospira sp

Comparação entre método bioquímico e reação em cadeia de polimerase para identificação de Lactobacillus spp., isolados de aves.

Comparação entre método bioquímico e reação em cadeia de polimerase para identificação de Lactobacillus spp., isolados de aves.

pela fermentação de carboidratos. Utilizaram-se os iniciadores: Lac 1/23-10C para detecção de Lactobacillus acidophilus, L. crispatus, L. amylovorus, L. gasseri, L. helveticus e L. jensenii; Lac 2/LU-1’ para L. acidophilus; Fer 3/Fer 4 para L. fermentum; Reu 1/Reu 2 para L. reuteri e Sal 1 e Sal 2 para L. salivarius. L. reuteri e L. salivarius foram identificados pela reação em cadeia de polimerase (PCR) e pelo teste bioquímico, enquanto L. acidophilus, L. fermentum e Lactobacillus sp. somente pelo teste bioquímico. Os resultados obtidos na PCR foram mais precisos quando comparados aos obtidos com o método bioquímico, que demonstrou ser subjetivo devido às variações na fermentação de carboidratos, principalmente na diferenciação entre L. fermentum e L. reuteri.
Mostrar mais

7 Ler mais

Padronização de condições para detecção de DNA de Leishmania spp. em flebotomíneos (Diptera, Psychodidae) pela reação em cadeia da polimerase.

Padronização de condições para detecção de DNA de Leishmania spp. em flebotomíneos (Diptera, Psychodidae) pela reação em cadeia da polimerase.

A correta identificação dos agentes etiológicos em insetos vetores é de crucial importância aos estudos epidemio- lógicos. A pesquisa de flagelado nesses vetores, pela dis- secção de seu trato digestivo, observação microscópica do seu conteúdo ou por isolamento dos parasitas prove- nientes de insetos em meios de cultura, tem-se mostrado operacionalmente inadequada e com baixa especificida- de do diagnóstico, pois fêmeas de flebotomíneos também podem albergar outros flagelados como Trypanosoma e Endotrypanum. Acreditamos que por sua eficiência e es- pecificidade, a amplificação de seqüências-alvo do DNA da Leishmania, por meio da reação em cadeia de polime- rase, pode ser aplicada na investigação de sua presença em flebotomíneos, desde que estes estejam devidamente acondicionados e o DNA do parasita extraído a partir de metodologia adequada. Este trabalho descreve me- todologias utilizadas na padronização da conservação dos espécimes de flebotomíneos e extração do DNA da Leishmania como uma alternativa mais prática que os métodos tradicionais.
Mostrar mais

8 Ler mais

Comparação da reação em cadeia da polimerase com o exame microscópico na detecção...

Comparação da reação em cadeia da polimerase com o exame microscópico na detecção...

amazonensis, L. braziliensis e L. chagasii quando o par de oligonucleotídeos iniciadores do presente estudo foi utilizado para o teste de especificidade. Por outro lado, ao serem testados com amostras de T. rangeli, houve amplificação com concentrações de DNA variando de 1 µg até 10 ng, o que não ocorreu quando o DNA total das amostras foi diluído de 1 ng até 10 pg. No entanto, tendo em vista que a PCR utilizando este par de iniciadores é acoplada ao xenodiagnóstico e tem como objetivo a identificação de pacientes imunossuprimidos com reativação da doença de Chagas, as amplificações de DNA do T. rangeli não comprometem a aplicação desta PCR na prática clínica. Da mesma forma, no estudo de Lindoso, 1998, utilizando os iniciadores TCZ1 e TCZ2, verificou-se amplificação de DNA de duas cepas de T. rangeli, além da L. mexicana e L. chagasi. Por outro lado, vários autores, que também utilizaram os iniciadores TCZ1 e TCZ2, não observaram amplificação ao testarem DNA de
Mostrar mais

136 Ler mais

Identificação da espécie animal em amostras de carne através da reação em cadeia...

Identificação da espécie animal em amostras de carne através da reação em cadeia...

O presente estudo teve por objetivos padronizar a reação em cadeia pela polimerase (PCR) para a identificação da espécie bovina, suína e canina em amostras de carne utilizando diferentes concentrações (0% 0,001%, 0,01%, 0,1%, 1%, 10%, 25%, 50%, 75%, 100%); analisar as amostras provenientes de vistorias realizadas pela Coordenação de Vigilância à Saúde (COVISA) do Município de São Paulo e, aferir os custos do método para oferecer como atividade de extensão, as análises laboratoriais. Na padronização o limite mínimo de detecção foi de 0,1% para material bovino, 0,01% para suíno e 10% para cão. É necessário aprimorar a técnica na identificação de cães e testar outros primers, além de padronizar outras espécies. Cinquenta e três amostras foram encaminhadas pela COVISA, sendo analisadas e obtendo os seguintes resultados: 60% bovina, 19% suína, 13% espécie não foi identificada (falta do primer específico) e em 8% ocorreu algum tipo de contaminação da amostra, provavelmente no estabelecimento vistoriado (contaminação cruzada). O custo final da reação para três espécies foi de R$ 100,47 sendo R$ 55,27 (55,01%) correspondente aos reagentes e R$ 45,20 (44,99%) referente a mão de obra. O tempo médio para obtenção dos resultados foi de 9h03’23’’, estimado sem qualquer contaminação ou repetição de etapa.
Mostrar mais

114 Ler mais

Utilização da reação em cadeia da polimerase (PCR) para detecção de leite bovino em leite caprino

Utilização da reação em cadeia da polimerase (PCR) para detecção de leite bovino em leite caprino

Tendo em vista a importância quanto às questões de segurança alimentar em termos de autenticidade em produtos é que têm surgido novas e cada vez mais sofisticadas técnicas para a detecção de adição de substâncias que alterem a constituição de produtos alimentares, devido, principalmente, ao aumento da sensibilização para a valorização deste tema em todo o mundo. Sobre este assunto, a identificação de espécies de origem nos alimentos como o leite, por exemplo, é um dos pontos predominantes de aplicação. Pois, no caso do leite de vaca, que é evitado por alguns consumidores por diversas razões, incluindo intolerância ou alergia, questões religiosas, éticas ou culturais, ou preferência pessoal, quando então se busca o consumo de leite de espécies alternativas é indispensável dar a garantia de que a espécie que se consome não seja adulterada com leite de origem diferente.
Mostrar mais

65 Ler mais

Detecção de Histophilus somni (Haemophilus somnus) no sêmen bovino mediante reação em cadeia pela polimerase (PCR)

Detecção de Histophilus somni (Haemophilus somnus) no sêmen bovino mediante reação em cadeia pela polimerase (PCR)

Dentre os diversos patógenos que afetam a bo- vinocultura, listados pela Organização Mundial de Saúde Animal (World Organization For Animal Health - OIE) (THIBIER; GUERIN, 2000), alguns têm papel de relevante importância na situação brasileira como, por exemplo, a Brucella abortus (POESTER; GONÇALVES; LAGE, 2002), a Leptospira sp. (HEINEMANN et al., 2000) e o Campylobacter fe- tus (VARGAS et al., 2003). Outro patógeno da lista B da OIE que apresenta significância econômica em outros países mas ainda não foi devidamente estu- dado no Brasil é o H. somni (TEGTMEIER; ANGEN; AHRENS, 2000).
Mostrar mais

6 Ler mais

Detecção da infecção pelo vírus da artrite-encefalite caprina: imunodifusão em ágar e reação em cadeia da polimerase com "primers" degenerados.

Detecção da infecção pelo vírus da artrite-encefalite caprina: imunodifusão em ágar e reação em cadeia da polimerase com "primers" degenerados.

para a gp135 (proteína do envelope viral) e soro caprino positivo para a p28 (proteína do capsídeo). Após disposição dos soros suspeitos, dos controles positivos e do antígeno nos orifícios respectivos, a placa de imunodifusão foi incubada à temperatura ambiente, ao abrigo da luz, por 48h, quando foi realizada a leitura. A presença de uma linha de precipitação com identidade frente aos controles positivos era o indicativo da presença de Ac nos soros em teste. A presença de uma linha de fraca intensidade, impossibilitando a identificação de uma linha similar aos controles positivos, levou à classificação do soro como suspeito. As amostras foram inicialmente testadas com o controle positivo para gp135 e, em caso de soro suspeito ou negativo, um novo teste foi realizado com o controle positivo para p28 (Adams & Gorham, 1986).
Mostrar mais

6 Ler mais

Desenvolvimento da reação em cadeia pela polimerase para detecção de Actinobaculum...

Desenvolvimento da reação em cadeia pela polimerase para detecção de Actinobaculum...

O Actinobaculum suis é um dos principais micro-organismos relacionados a infecções de trato urinário em fêmeas suínas. As características de crescimento deste agente dificultam o isolamento bacteriano tradicional, o que pode tornar a sua prevalência subestimada. Este estudo teve por objetivos desenvolver a reação em cadeia pela polimerase (PCR) para detecção do A. suis, avaliar a sensibilidade e especificidade desta técnica e comparar seu desempenho com o isolamento bacteriano. Além disso, as cepas isoladas foram caracterizadas através do polimorfismo de comprimento de fragmentos amplificados (AFLP) e submetidas à determinação da concentração inibitória mínima para caracterização dos perfis de susceptibilidade antimicrobiana. Foram analisados 45 suabes prepuciais de machos e 192 urinas de fêmeas suínas provenientes de três granjas. Os resultados indicaram que a PCR desenvolvida foi específica para o A. suis e apresentou limiar de detecção entre 1,0 X 10 1 UF/mL e 1,0 X 10 2 UFC/mL. A frequência de A. suis encontrada através da PCR foi de 82,2% (37/45) nos suabes prepuciais e de 8,9% (17/192) nas urinas de fêmeas. No que se refere ao isolamento, nenhuma das amostras de urina foi positiva para o agente, enquanto 31,1% (14/45) dos suabes foram positivos. A partir das amostras positivas isoladas dos suabes prepuciais foram selecionadas 20 cepas de A. suis. Os perfis de susceptibilidade entre estas cepas foram semelhantes, no entanto diferiram dos isolados utilizados como controle e provenientes de uma fêmea com infecção urinária. A técnica de PCR foi mais eficiente que o isolamento na identificação de amostras positivas para A. suis. Através do AFLP com uma única enzima foi possível caracterizar todos os isolados e relacionar os dados obtidos com a origem das cepas e o perfil de resistência. Até o presente não há relatos na literatura de caracterização genotípica de A. suis através do AFLP ou detecção do agente através da PCR.
Mostrar mais

64 Ler mais

Detecção de Ornithobacterium rhinotracheale (ORT) por meio da reação em cadeia da polimerase (PCR).

Detecção de Ornithobacterium rhinotracheale (ORT) por meio da reação em cadeia da polimerase (PCR).

Ornithobacterium rhinotracheale (ORT) é uma bactéria Gram negativa recentemente descrita que se encontra associada às doenças do trato respiratório em criações de aves comerciais e silvestres em vários países do mundo. No Brasil, foram detectados anticorpos em um pequeno número de frangos de corte e suas matrizes dos Estados de São Paulo e Minas Gerais. Como a bactéria é fastidiosa, a Reação em Cadeia da Polimerase (PCR) torna-se útil para sua detecção e identificação. O presente trabalho visou verificar a ocorrência da ORT no Rio Grande do Sul pela detecção do DNA da bactéria. Foram coletadas 84 amostras de suabe de traquéia de aves pertencentes a 14 lotes de diferentes empresas avícolas. O DNA foi purificado e a PCR realizada com iniciadores específicos para o gene do RNA ribossomal 16S da ORT. Foram observados produtos de amplificação com 784 pares de bases em 10 das 84 amostras. As amostras positivas pertenciam a quatro lotes de três empresas estabelecidas em diferentes regiões do RS. Os resultados indicam que este patógeno respiratório de aves existe no Brasil e está presente em importantes regiões criatórias do RS. Outros estudos estão em andamento para determinar a prevalência e caracterização dos isolados obtidos. Palavras-chave: Ornithobacterium rhinotracheale, patologia
Mostrar mais

3 Ler mais

Detecção de Listeria monocytogenes em leite: sensibilidade e especificidade de Reação em Cadeia de Polimerase (PCR)

Detecção de Listeria monocytogenes em leite: sensibilidade e especificidade de Reação em Cadeia de Polimerase (PCR)

O objetivo deste trabalho foi detectar Listeria monocytogenes inoculada em leite, após um período de enriquecimento seletivo, por meio da técnica de PCR. Foi feita a padronização de uma PCR utilizando os oligonucleotídeos LM1/LM2 e de uma PCR multiplex com os oligonucleotídeos IAP1/IAP2 e LMA/LMB. Listeria monocytogenes foi inoculada em várias concentrações em leite esterilizado desnatado e em leite cru integral com dois níveis diferentes de contaminação. A PCR padronizada foi aplicada para identificar a bactéria inoculada experimentalmente e foi comparada com o método convencional de detecção de L. monocytogenes. Foram comparados, também, os métodos de extração de DNA utilizando fenol- clorofórmio e por lise térmica, a partir de um caldo de cultura e diretamente da colônia suspeita. Somente foi possível identificar L. monocytogenes por PCR no leite esterilizado desnatado, após 48 horas de enriquecimento em meio seletivo (LEB). Neste caso, a sensibilidade do teste foi de 1 UFC/ml de leite, a mesma sensibilidade da metodologia convencional. Quando inoculada em leite cru integral com contaminação bacteriana, L. monocytogenes só foi detectada pela metodologia convencional, com uma sensibilidade de até 2 UFC/ml (leite com baixa contaminação). Foi possível reduzir o tempo de identificação de L. monocytogenes, substituindo os testes fenotípicos de identificação pela PCR padronizada, utilizando DNA bacteriano extraído pelo método de lise térmica, diretamente da colônia suspeita.
Mostrar mais

43 Ler mais

Detecção do gene de peroxidase em sementes de soja pela reação da polimerase em cadeia (PCR)

Detecção do gene de peroxidase em sementes de soja pela reação da polimerase em cadeia (PCR)

Devido ao aumento do número de cultivares de soja e com pouca diferença genética entre elas, fica cada vez mais difícil a verificação de contaminação varietal pelo método de peroxidase. As cultivares de soja são separadas em dois grupos com base na atividade, alta ou baixa, da peroxidase no tegumento. A alta atividade é resultado da presença de, pelo menos, um alelo dominante (EpEp ou Epep), enquanto que baixa atividade resulta da presença do par recessivo (epep). O auxílio de técnicas moleculares na identificação de contaminação varietal de soja utilizando a peroxidase é de grande importância, pois a tecnologia baseada na análise do DNA não sofre a ação de fatores externos (ambientais). Neste contexto, o objetivo geral do trabalho foi o de viabilizar a técnica de PCR convencional para verificar a presença de contaminação varietal em auxílio ao método colorimétrico da peroxidase. O estudo foi conduzido no Departamento de Produção Vegetal da Faculdade de Ciências Agronômicas/UNESP, Campus de Botucatu-SP. Foi realizado o teste colorimétrico tradicional e comparado com os resultados encontrados no PCR. Foram usadas 14 cultivares de importância, dessas, foram pré-selecionadas seis cultivares com reação positiva à peroxidase: BRS 320, BRS 284, BRS 232, BRS 7860RR, BRSMG 760SRR, BRS295RR, quatro cultivares negativas à peroxidase: BRS 326, BRS 8160RR, Nutrisoy, BRS Valiosa RR e quatro cultivares com reação positiva e negativa: BRSGO 8060, BRS 270RR, FTS Campo Mourão e BRS 239. Em paralelo ao teste colorimétrico, o DNA foi extraído das sementes inteiras, primers foram desenhados, seguido da reação de PCR e eletroforese em gel de agarose. A utilização de kit comercial de extração de DNA, juntamente com a utilização da técnica de PCR foi eficiente na detecção de amostras de sementes com reação negativa e positiva. No entanto, quando os lotes de sementes com reação positiva foi propositadamente contaminado lotes de sementes com reação negativa na proporção de 1, 2, 3, 4 e 5%, a técnica de PCR não foi suficientemente sensível para detectar a contaminação.
Mostrar mais

59 Ler mais

Aplicabilidade da metodologia de reação de polimerase em cadeia em tempo real na determinação do percentual de organismos geneticamente modificados em alimentos.

Aplicabilidade da metodologia de reação de polimerase em cadeia em tempo real na determinação do percentual de organismos geneticamente modificados em alimentos.

A detecção de organismos geneticamente modificados na cadeia alimentar é um aspecto importante para todos os assuntos envolvidos no controle de matéria-prima, na indústria de alimentos e na distribuição. A rotulagem e a rastreabilidade de organismos geneticamente modificados são questões atuais que são consideradas para o comércio e a regulamentação. Atualmente, a rotulagem de alimentos processados contendo material transgênico detectável é exigida pela legislação brasileira. O governo brasileiro publicou Decret o nº 4.680 em abril de 2003, que exige rotulagem para todos os alimentos ou ingredientes de alimento, com o limite para rotulagem de 1% . Embora a tecnologia de reação em cadeia da polimerase tenha algumas limitações, a alta sensibilidade e especificidade explicam sua escolha por parte dos laboratórios interessados em realizar análises de detecção de organismos geneticamente modificados e seus derivados. Entre os métodos atualmente disponíveis, aqueles baseados na reação em cadeia da polimerase geralmente são aceitos, considerando a sensibilidade e a confiabilidade na detecção de material geneticamente modificado-derivado em análises de rotina. Neste artigo, apresenta-se uma revisão de métodos atualmente disponíveis baseados na reação em cadeia da polimerase para detecção, identificação e quantificação de organismos geneticamente modificados e seus derivados, discutindo sua aplicabilidade e suas limitações.
Mostrar mais

8 Ler mais

Avaliação da carga viral plasmática do HTLV-1 em indivíduos assintomáticos e desenvolvendo...

Avaliação da carga viral plasmática do HTLV-1 em indivíduos assintomáticos e desenvolvendo...

Do ponto de vista patológico, existe o comprometimento da medula torácica, com espessamento leptomeníngeo e atrofia medular em diferentes graus. Os achados histopatológicos incluem infiltração linfocitária perivascular, desmielinização, degeneração axonial e gliose. A intensidade da reação inflamatória está relacionada com a duração da doença (GESSAIN et al., 1992; IWASAKI et al., 1993). Progressivamente, ocorre uma degeneração da substância branca, particularmente do trato córtico-espinhal lateral, com pouco envolvimento da substância cinzenta. Segundo Iwasaki et al. (1993) e Yoshioka et al.(1993), os casos mais avançados são de longa duração e o processo de degeneração predomina sobre a inflamação. Há grande discussão no que se refere ao acometimento neuro- degenerativo, principalmente na região lombar, uma possível explicação para este fato é que há uma grande perivascularização, propiciando um intenso processo de fluxo de células do sistema imune nessa área da coluna vertebral (JOHNSON et al., 2001).
Mostrar mais

32 Ler mais

Detecção do provírus da Imunodeficiência Felina em gatos domésticos pela técnica de Reação em Cadeia da Polimerase.

Detecção do provírus da Imunodeficiência Felina em gatos domésticos pela técnica de Reação em Cadeia da Polimerase.

A técnica de reação em cadeia da polimerase, PCR, tem de- monstrado ser sensível e específica na detecção de animais infectados por FIV (Rimstad & Ueland 1992, Dandekar et al. 1992). O número de amostras positivas, 15 num total de 40 analisadas, corresponde a um percentual de 37,5%. Este valor é próximo ao descrito por Ishida et al. (1989), de 43,9% em gatos clinicamente doentes. Embora as amostras tenham sido coletadas de animais com suspeita clínica de imunodeficiên- cia, é importante salientar que outros fatores podem desen- cadear alterações no sistema imunológico. Entre as causas de origem viral, pode-se destacar o vírus da leucose felina (FeLV). Esse vírus era o único agente viral associado à imunodeficiência felina, até o isolamento do FIV em gatos domésticos. Alguns autores salientam que a co-infecção pe- los dois retrovírus poderia ser favorável ao desenvolvimento de sintomatologia clínica mais precocemente (Pedersen et al. 1989).
Mostrar mais

6 Ler mais

Detecção simultânea de fatores de resistência à murcha de fusário do tomateiro por meio de PCR multiplex.

Detecção simultânea de fatores de resistência à murcha de fusário do tomateiro por meio de PCR multiplex.

Resumo – O objetivo deste trabalho foi elaborar e validar um protocolo de detecção simultânea, via reação em cadeia da polimerase multiplex (PCR multiplex), de regiões genômicas do tomateiro (Solanum lycopersicum) associadas a fatores de resistência às três raças fisiológicas de Fusarium oxysporum f. sp. lycopersici (FOL). Os pares de iniciadores empregados foram SSR-67 (específico para o gene I‑1), TFusrr (específico para o gene I‑2 ) e SSRD (específico para o gene I‑3). Os resultados de genotipagem com marcadores moleculares foram comparados aos resultados de fenotipagem de uma coleção de germoplasma de tomateiro, em bioensaios de inoculação de isolados das três raças de FOL em plântulas, pelo método de imersão das raízes. A resistência ou a suscetibilidade foi confirmada por PCR, por meio de visualização dos âmplicons específicos para as regiões-alvo ligadas aos fatores de resistência às distintas raças de FOL. O protocolo elaborado para o uso conjunto dos marcadores moleculares, em PCR multiplex, permite a seleção de acessos de tomateiro resistentes às raças 1, 2, e 3 de F. oxysporum f. sp. lycopersici de maneira similar à realizada com a utilização de cada um separadamente. O PCR multiplex representa uma ferramenta viável para monitorar a incorporação desses fatores de resistência em linhagens de tomateiro.
Mostrar mais

8 Ler mais

Otimização da reação de polimerase em cadeia para detecção de Toxoplasma gondii em sangue venoso e placenta de gestantes.

Otimização da reação de polimerase em cadeia para detecção de Toxoplasma gondii em sangue venoso e placenta de gestantes.

A detecção de Toxoplasma gondii no sangue venoso e na placenta de gestantes pela reação de polimerase em cadeia pode facilitar o diagnóstico pré-natal da toxoplasmose congênita. Foram avaliadas gestantes IgM-reagentes e os seus filhos. Além das dosagens de IgG, IgM, IgA e reação de avidez de IgG (MEIA), foram realizadas a técnica de imunoperoxidase e a inoculação em camundongos. De cada amostra foi efetuada amplificação gênica com primers do gene B1 e novos primers do gene TGR (chamados ABGTg7 C1 e N1). É preciso observar que o tratamento poderia ser responsável por uma diminuição da infecção. Desta forma, o diagnóstico negativo confirmaria a eficiência do tratamento preventivo na replicação parasitária no útero. A reação de polimerase em cadeia mostrou-se sensível e específica; evidenciou a presença de um a dez taquizoítas; pode ser utilizada com segurança e confiabilidade, além de tornar rápido o diagnóstico da toxoplasmose congênita, sendo, assim, ferramenta importante na avaliação pré-natal.
Mostrar mais

6 Ler mais

Trypanosoma vivax nos tecidos testicular e epididimário de ovinos experimentalmente infectados.

Trypanosoma vivax nos tecidos testicular e epididimário de ovinos experimentalmente infectados.

A PCR foi usada para amplificar uma região de 177 pb (pares de bases) no domínio catalítico do gene da Catepsina L, específica para T. vivax e conservada entre diferentes amostras do parasita, através dos primers Tvi2 (forward: 5' GCC ATC GCC AAG TAC CTC GCC GA 3') e DTO156 (reverse: 5' TTAGAATTCCCAGGAGTTCTTGATGATCCAGTA 3'). As PCRs foram realizadas com um volume final de 50ml contendo 2.5 U de Taq DNA polimerase, 0.2mM de cada dNTP, 100ng de cada primer, 1,5mM MgCL 2 . Os parâmetros estabelecidos para os ciclos foram: uma desnaturação a 94ºC por 3 minutos segui- dos de 39 ciclos de amplificação com fases de: desnaturação (94 o C por 1min.), anelamento (62 o C por 1min.), e extensão
Mostrar mais

8 Ler mais

PREVALÊNCIA DE Toxoplasma gondii E Neospora spp E ANÁLISE DOS FATORES DE RISCO EM EQUÍDEOS DO SUDESTE DO BRASIL Patricia Magalhães de Oliveira Médica Veterinária

PREVALÊNCIA DE Toxoplasma gondii E Neospora spp E ANÁLISE DOS FATORES DE RISCO EM EQUÍDEOS DO SUDESTE DO BRASIL Patricia Magalhães de Oliveira Médica Veterinária

RESUMO - Este estudo avaliou a prevalência e análise dos fatores de risco do Toxoplasma gondii em equídeos (cavalos, mulas e pôneis), dentro de áreas rurais e urbanas do Município de Uberlândia, Minas Gerais. Amostras de soro de 257 equídeos foram avaliadas para a presença de anticorpos contra T. gondii por meio do teste de Reação de Imunofluorescência indireta (RIFI) e diagnóstico molecular pelo método de Reação em cadeia da Polimerase (PCR). Além disso, um inquérito epidemiológico foi realizado para avaliar os possíveis fatores de risco (grupo genético, idade, gênero, utilização/atividade exercida, ECC e contato com animais domésticos e silvestres). Das 257 amostras, 9,7% (25/257) resultaram em positivas na RIFI para T. gondii, sendo que 11% (16/145) no meio rural e de 8% (9/112) no meio urbano. Já na PCR foram 10,9% (28/257) de amostras positivas, com prevalências de 17,2% (25/145) e 2,7% (3/112), respectivamente, na zona rural e urbana. Houve diferença na prevalência avaliada através da PCR entre as zonas rural e urbana. O gênero e a idade foram considerados fatores de risco na RIFI. Os machos foram considerados menos susceptíveis quando comparados às fêmeas e os animais maiores que cinco anos apresentaram maior susceptibilidade do que os mais jovens. Na técnica da PCR, o único fator de risco significativo foi o grupo genético, pôneis apresentaram maior prevalência em relação aos cavalos e mulas. Concluiu-se que há a presença de Toxoplasma gondii distribuído em todo o município de Uberlândia e sua prevalência depende de ser zona rural ou urbana; os grupo genético, idade e gênero foram considerados fatores de risco para a doença na zona rural.
Mostrar mais

76 Ler mais

Show all 10000 documents...

temas relacionados