• Nenhum resultado encontrado

[PDF] Top 20 Crystal structures of five 6-mercaptopurine derivatives

Has 10000 "Crystal structures of five 6-mercaptopurine derivatives" found on our website. Below are the top 20 most common "Crystal structures of five 6-mercaptopurine derivatives".

Crystal structures of five 6-mercaptopurine derivatives

Crystal structures of five 6-mercaptopurine derivatives

... treatment of rheumathologic disorders, cancer and prevention of rejection of organ ...with 6- mercaptopurine is the low bioavailability of the oral absorp- tion and the short ... See full document

27

Differential stability of the crystallographic interfaces of mu- and kappa-opioid receptors.

Differential stability of the crystallographic interfaces of mu- and kappa-opioid receptors.

... crystallographic structures have been solved in recent years, including those of opioid receptors ...majority of currently available crystal structures of GPCRs display single ... See full document

8

Crystal structures of two 6-(2-hydroxybenzoyl)-5H-thiazolo[3,2-a]pyrimidin-5-ones

Crystal structures of two 6-(2-hydroxybenzoyl)-5H-thiazolo[3,2-a]pyrimidin-5-ones

... Instead of the expected amidation, the unusual title thiazolopyrimidine-5-one derivatives were obtained serendipitously and a mechanism of formation is ... See full document

14

A comparison of the crystal structures of eukaryotic and bacterial SSU ribosomal RNAs reveals common structural features in the hypervariable regions.

A comparison of the crystal structures of eukaryotic and bacterial SSU ribosomal RNAs reveals common structural features in the hypervariable regions.

... several of the irregular helices ...part of the V4 region that had been unstructured in the Gutell lab’s eukaryotic comparative structure ...abundance of non- canonical base ...eukaryotic ... See full document

6

Structures of coxsackievirus, rhinovirus, and poliovirus polymerase elongation complexes solved by engineering RNA mediated crystal contacts.

Structures of coxsackievirus, rhinovirus, and poliovirus polymerase elongation complexes solved by engineering RNA mediated crystal contacts.

... Sequences of the five RNA constructs (r1–r5) used to generate the EC crystals cartooned as coaxially stacked pairs that reflect the dumbbell-type packing seen in all the ...addition of GTP and ATP ... See full document

14

Crystal structures of ethyl 6-(4-methylphenyl)-4-oxo-4H-chromene-2-carboxylate and ethyl 6-(4-fluorophenyl)-4-oxo-4H-chromene-2-carboxylate

Crystal structures of ethyl 6-(4-methylphenyl)-4-oxo-4H-chromene-2-carboxylate and ethyl 6-(4-fluorophenyl)-4-oxo-4H-chromene-2-carboxylate

... Benzopyran derivatives represent a large class of natural and synthetic heterocycles that are often linked to a broad array of biological activities, (Gaspar et ...class of compounds, the ... See full document

18

Crystal structures of three 3,4,5-trimethoxybenzamide-based derivatives

Crystal structures of three 3,4,5-trimethoxybenzamide-based derivatives

... synthesis of new molecules based on the benzoic acid ...and structures of three new benzamide derivatives, viz. N-(6-hydroxyhexyl)- 3,4,5-trimethoxybenzamide (1) ... See full document

24

Crystal structures of three 6-substituted coumarin-3-carboxamide derivatives

Crystal structures of three 6-substituted coumarin-3-carboxamide derivatives

... coumarin derivatives 1–3 were synthesized by a two-step ...amounts of piperidine were dissolved in ethanol (10 ml) and refluxed for 4 ...ethyl 6-methylcoumarin-3-carboxylate was ...ml of an ... See full document

20

J. Braz. Chem. Soc.  vol.24 número1

J. Braz. Chem. Soc. vol.24 número1

... 23. Frisch, M. J.; Trucks, G. W.; Schlegel, H. B.; Scuseria, G. E.; Robb, M. A.; Cheeseman, J. R.; Scalmani, G.; Barone, V.; Mennucci, B.; Petersson, G. A.; Nakatsuji, H.; Caricato, M.; Li, X.; Hratchian, H. P.; ... See full document

12

Structural bases of coronavirus attachment to host aminopeptidase N and its inhibition by neutralizing antibodies.

Structural bases of coronavirus attachment to host aminopeptidase N and its inhibition by neutralizing antibodies.

... tion of the receptor-binding loops (b1–b2 and b3–b4) at the b- barrel tip (Figure ...RBD of TGEV and IBV (Gammacoronavirus) or the Bulbul-CoV (tentative Deltacoronavirus) are relatively large (,25%), and ... See full document

12

Crystal Structures of Putative Sugar Kinases from Synechococcus Elongatus PCC 7942 and Arabidopsis Thaliana.

Crystal Structures of Putative Sugar Kinases from Synechococcus Elongatus PCC 7942 and Arabidopsis Thaliana.

... Nco I restriction site (underlined) and reverse primer 5' CCGCTCGAGGGTTCTCTTTAA CCCCGCCG 3' including an internal Xho I restriction site (underlined) from Synechococcus elongatus PCC 7942 genomic DNA. The amplified PCR ... See full document

15

Structure-based druggability assessment of the mammalian structural proteome with inclusion of light protein flexibility.

Structure-based druggability assessment of the mammalian structural proteome with inclusion of light protein flexibility.

... co-crystal structures shown in the top half of the table, and corresponding protein-ligand co-crystal structures shown in the bottom ...units of A ˚ 3 ...Several of the ... See full document

13

Quím. Nova  vol.40 número1

Quím. Nova vol.40 número1

... diffractometer of X’pert Company with mono chromatized Cu Kα radiation (λ = ...morphology of products was visualized by SEM (LEO ...potential of 70 ...analysis of X-ray (EDX, Kevex, Delta ... See full document

7

Pullulan-based nanoparticles as carriers for transmucosal protein delivery

Pullulan-based nanoparticles as carriers for transmucosal protein delivery

... many of the limitations posed by the physicochemical characteristics of these macromolecules, which are very susceptible to degradation and undergo difficult absorption due to their size and, usually, ... See full document

54

Ana Rita Castro Otrelo Cardoso

Ana Rita Castro Otrelo Cardoso

... alignment of the FAD domain of 16 bacterial members of the molybdenum hydroxylase family ...representation of the insertion segment of the [4Fe-4S] center domain for PaoABC (green) and ... See full document

195

Braz. J. Pharm. Sci.  vol.47 número1

Braz. J. Pharm. Sci. vol.47 número1

... cooperation of academics, specialists in the main areas of investigation on bioinformatics methods, a n d a p p l i c a t i o n s i n clinical research from centers and universities of Europe such as ... See full document

2

Braz. J. Pharm. Sci.  vol.47 número1

Braz. J. Pharm. Sci. vol.47 número1

... n of “Polymorphism in Pharmaceutical Solids” covers the major topics related to polymorphism in ...content of the present edition provides up- to-date information on recent developments a n d m e t h o d s ... See full document

1

High resolution crystal structures of piscine transthyretin reveal different binding modes for triiodothyronine and thyroxine

High resolution crystal structures of piscine transthyretin reveal different binding modes for triiodothyronine and thyroxine

... Structure of Piscine Transthyretin—The structure of sea bream TTR was solved using molecular replacement methods with a truncated poly(alanine) model of human TTR (PDB accession code 1F41, ...quality ... See full document

7

J. Braz. Chem. Soc.  vol.17 número8

J. Braz. Chem. Soc. vol.17 número8

... solution of 1.3 mmol of TeX 3 (C 6 H 5 ), trihalo- phenyltellurium(IV), in 20 mL of methanol cooled to 0 ºC, ...mmol of TeX(C 6 H 5 )(CH 3 ) 2 , halodimethylphenyl- ... See full document

9

Quím. Nova  vol.31 número5

Quím. Nova vol.31 número5

... that of the molecular ion. Loss of one of the ligands is in agreement with a peak at m/z=617, also ...that of the molecular ion once the water molecule has been removed, probably weakly bound ... See full document

8

Show all 10000 documents...