Top PDF Human and plant fungal pathogens: the role of secondary metabolites.

In conclusion, a few SM are essential for manifestation of an infection in animal or plant hosts. The two most important examples are melanins and siderophores, and the deletion of their key biosynthetic genes leads to attenuated and apathogenic strains, respectively. Other SM are, at least from the point of view of the pathogen, advantageous for the infection process and contribute in modulating the progress of a disease. Fungal SM act in different ways and increase the pathogen’s ability to counteract adverse conditions in the host environment, irrespective of whether it is an animal or plant host. Since filamentous fungi encode between 30 to 70 secondary metabolism gene clusters (the products of most of these clusters are unknown) and there even exists cross-talk between clusters, resulting in the formation of hybrid molecules, it can be expected that up to 100 SM are produced by a single filamentous fungus. All of these compounds have the potential to contribute to pathogenicity. Thus, it will be very important to elucidate the nature and impact of these compounds on pathogenicity.

aiming to test crude extracts produced by these bacterial strains in antibiotic, cytotoxic and “biochemical” assays. However, the authors did not discuss any aspect related to the importance of media used for the isolation or growth of the strains obtained, or even related to the activity of the extracts obtained. A single growth medium was used by Dharmaraj & Sumantha (2009) for the isolation of 94 streptomycetes strains from four species of marine sponges. More than 28% of the strains isolated produced extracts that displayed broad antibacterial activities. Antibacterial activity was observed for extracts of 58 of the strains isolated, while 63 of the strains isolated produced antifungal extracts. Zhang et al. (2009) reported the isolation of 43 fungal strains obtained from eight species of marine algae and three species of marine invertebrates using a single growth medium. Over 84% of the strains isolated displayed antibiotic activity against at least one human microbial pathogen, and over 23% inhibited at least four of such pathogenic strains. Sangnoi et al. (2009) also used a single medium for the isolation of 84 strains of marine gliding bacteria from bioilms, invertebrates and algae. Among the strains isolated, 27 were selected based on their morphological features for growth in four different media for the production of extracts. After growth, extracts obtained from these media were tested for cytotoxic activity against four cancer cell lines. The results obtained showed that strains grew faster in a casitone, malt extract plus yeast extract based medium than in a baker’s yeast paste medium, or in a peptone plus yeast extract based medium, or even in skim milk plus yeast extract based medium, and produced the largest number of cytotoxic extracts in the same medium as well.

In addition to the NLRP3 inflammasome, a NLR-independent caspase-8-dependent inflamma- some and other canonical caspase-1-dependent inflammasomes are activated when stimulated with fungi (Fig 1). Gringhuis et al. [29] found that human dendritic cells stimulated with cer- tain strains of C. albicans did not utilize caspase-1 to process IL-1β. This finding led to several experiments demonstrating a NLR-independent dectin-1/Syk-dependent inflammasome acti- vation route, with the assembly of the CBM scaffold and processing of IL-1β mediated by recruitment of MALT-1/caspase-8 and ASC into this complex. This route was also activated by other species of Candida and different A. fumigatus strains. Moreover, the dectin-1-mediated activity, in contrast to NLRP3 inflammasome priming, did not require phagocytosis, suggesting a direct extracellular sensing mechanism. Later, Ganesan et al. [30] demonstrated that caspase- 8, dectin-1, and CR3, another receptor implicated in β-glucan sensing, are necessary for IL-1β processing by murine dendritic cells infected with C. albicans. Interestingly, caspase-8 activa- tion in these studies raises questions about Candida-induced programmed cell death pathways, as caspase-8 also has a significant role in initiating apoptosis [31].

Paracoccidioides is a fungal pathogen and the cause of paracoccidioidomycosis, a health-threatening human systemic mycosis endemic to Latin America. Infection by Paracoccidioides, a dimorphic fungus in the order Onygenales, is coupled with a thermally regulated transition from a soil-dwelling filamentous form to a yeast-like pathogenic form. To better understand the genetic basis of growth and pathogenicity in Paracoccidioides, we sequenced the genomes of two strains of Paracoccidioides brasiliensis (Pb03 and Pb18) and one strain of Paracoccidioides lutzii (Pb01). These genomes range in size from 29.1 Mb to 32.9 Mb and encode 7,610 to 8,130 genes. To enable genetic studies, we mapped 94% of the P. brasiliensis Pb18 assembly onto five chromosomes. We characterized gene family content across Onygenales and related fungi, and within Paracoccidioides we found expansions of the fungal-specific kinase family FunK1. Additionally, the Onygenales have lost many genes involved in carbohydrate metabolism and fewer genes involved in protein metabolism, resulting in a higher ratio of proteases to carbohydrate active enzymes in the Onygenales than their relatives. To determine if gene content correlated with growth on different substrates, we screened the non-pathogenic onygenale Uncinocarpus reesii, which has orthologs for 91% of Paracoccidioides metabolic genes, for growth on 190 carbon sources. U. reesii showed growth on a limited range of carbohydrates, primarily basic plant sugars and cell wall components; this suggests that Onygenales, including dimorphic fungi, can degrade cellulosic plant material in the soil. In addition, U. reesii grew on gelatin and a wide range of dipeptides and amino acids, indicating a preference for proteinaceous growth substrates over carbohydrates, which may enable these fungi to also degrade animal biomass. These capabilities for degrading plant and animal substrates suggest a duality in lifestyle that could enable pathogenic species of Onygenales to transfer from soil to animal hosts.

Given that the exoglycome extends beyond the cell wall, it plays a fundamental role in cell-cell recognition and in cell-molecule interactions, in discriminating self from non-self, in the warfare between host and pathogen before infection is established, and in certain diseases such as cancer. Protein-carbohydrate interactions control salient aspects of intra- and intercellular communication and trafficking, and are at the basis of a variety of essential biological phenomena. They are involved, for example, in adhesion of infectious agents to host cells, and cell adhesion in the immune system, malignancy and metastasis. For these reasons, and following nucleic acids and proteins, carbohydrates, or more specifically oligosaccharides, have been recently recognized as the third code/alphabet of life, with a coding capacity which far exceeds those of the other two polymers [1].

Anthracyclines, a class of antitumor drugs widely used for the treat- ment of solid and hematological malignancies, cause a cumulative dose-dependent cardiac toxicity whose biochemical basis is unclear. Recent studies of the role of the metabolites of anthracyclines, i.e., the alcohol metabolite doxorubicinol and aglycone metabolites, have suggested new hypotheses about the mechanisms of anthracycline cardiotoxicity. In the present study, human red blood cells were used as a cell model. Exposure (1 h at 37ºC) of intact human red blood cells to doxorubicinol (40 µM) and to aglycone derivatives of doxorubicin (40 µM) induced, compared with untreated red cells: i) a ~2-fold stimulation of the pentose phosphate pathway (PPP) and ii) a marked inhibition of the red cell antioxidant enzymes, glutathione peroxidase (~20%) and superoxide dismutase (~60%). In contrast to doxorubicin- derived metabolites, doxorubicin itself induced a slighter PPP stimu- lation (~35%) and this metabolic event was not associated with any alteration in glutathione reductase, glutathione peroxidase, catalase or superoxide dismutase activity. Furthermore, the interaction of hemo- globin with doxorubicin and its metabolites induced a significant increase (~22%) in oxygen affinity compared with hemoglobin incu- bated without drugs. On the basis of the results obtained in the present study, a new hypothesis, involving doxorubicinol and aglycone me- tabolites, has been proposed to clarify the mechanisms responsible for the doxorubicin-induced red blood cell toxicity.

granulomatous disease (CGD) get recurrent infections with a variety of bacterial and fungal pathogens as a consequence of phagocyte defects in production of antimicrobial reactive oxygen metabolites. Patients with CGD often present with clinical syndromes, such as pneumonia or lymphadenitis, for which no credible pathogen is identified, leading to empirical broad-spectrum antibacterial and antifungal therapy. The question beleaguering the clinician in this scenario is whether the patient is infected with a common microbe (e.g., Aspergillus fumigatus, Nocardia asteroides, Staphylococcus aureus) that has eluded detection, or a novel fastidious microbe.

Phytochemicals demonstrate diverse responses against pathogens, insects, pests, human diseases and predators. They are phytotoxic in nature and repellent to herbivores; moreover, many of them are also involved in the defense against abiotic stress (Hadacek et al., 1994). Natural compounds are a source of new class of plant based secondary metabolites, as well as ecologically and toxicologically safer molecules than many synthetic chemical compounds. Coumarins are a class of lactone molecules which have a benzene ring fused to á-pyrone ring, and essentially possess a conjugated system with electron-rich and good charge-transport properties (Murray, 1997). Coumarins have been reported to exhibit several biological activities with a wide range of applications (Matos et al., 2012; Zheng et al., 2013). Coumarins are reported to be present in various cosmetics and industrial additives, and their derivatives have been used as aroma enhancers in tobacco and certain alcoholic drinks (Fais et al., 2009; Matos et al., 2013). More than 1300 coumarins isolated from plants, bacteria, and fungi have been identified as secondary metabolites (Iranshahi et al., 2009). In 1822, Vogel isolated and purified coumarin from tonka bean (Dipteryx odorata). Several coumarin compounds have been reported in Rutaceae and Apiaceae families (Hadacek et al., 1994; Ganzera et al., 1997). Because of their wide biological activities, several coumarin compounds are reported to be health-promoting constituents of herbal and medicinal plant preparations. Several reviews have summarized and highlighted new frontiers in the application of coumarins, especially concerning their antioxidant (Thuong et al., 2010), antimycobacterial (Schinkovitz et al., 2003), anticoagulant, antitumoral, antiviral, antifungal, and antiinflammatory activities (Garcia-Argaez et al., 2000; Epifano et al., 2010; Riveiro et al., 2010).

The results of studies about interactions between microorganisms involving at least one plant pathogen are of interest to the areas of ethiology and control in Plant Pathology. Various aspects of these interactions have been studied over the years but the toxicity of volatile organic compounds (VOCs) has been emphasized only recently, developing techniques and procedures, and producing additional knowledge to those already obtained with water-soluble substances. This new facet of these interactions based on VOCs is discussed in this review involving mainly fungi, bacteria and nematodes pathogenic to plants. Also discussed is the role of VOCs produced by microorganisms, especially fungi and bacteria, in soil fungistasis and the effect of VOCs on fungal agents used in the control of plant parasitic nematodes. The evidence of VOCs broadens the research studies about these interactions. However, the scarcity of the research results in this area show up gaps which need to be filled and some research proposals are discussed. The present and future accumulated VOC knowledge will perhaps be beneficial to farmers, especially aspects related to increasing soil suppressiveness to plant disease and to the finding of analog molecules of VOCs highly effective against plant pathogens.

It is well known from several studies that chitosan and CHOS have anti-microbial properties, and it is also known that the degree of acetylation of chitosan is an important factor affecting antifungal activity [22–23]. It has been proposed that the positive charge of the free amino groups of the glucosamine moieties in chitosan modulates interactions with the negatively charged cell surface, which under certain conditions may result in membrane destabilization and pore formation [22–23]. In the present study, we have focused on the effects of chain length, the particular role of the sugar moiety at the reducing end, and, first of all, on synergistic effects between chitosan or CHOS and synthetic fungicides.

A search of the SUCEST database, using the basic lo- cal alignment search tool (BLAST) (Altschul et al., 1990), with proteins previously isolated from other plant species led us to identify DNA sequences with high homology to catalytic proteins of the isoprenoid and phenylpropanoid metabolism pathway. These clones were sequenced and when the putative products were compared to the published amino acid sequences for the corresponding enzymes the best percentages of similarity ranged from 65% to 93%. Multiple alignment, using the Clustal X program of Jeanmougin et al. (1998), of full length sequence of sugar- cane with similar proteins showed the transcripts which are closely related to the protein structure of each key enzyme of the main branches of the isoprenoid and phenylpro- panoid pathways in plants.

SECONDARY METABOLITES OF PROTIUM HEPTAPHYLLUM MARCH. Phytochemical investigation of the resin, fruits, leaves, and trunk of Protium heptaphyllum led to the isolation of the monoterpene p-menth-3-ene-1,2,8-triol, α and β amyrin, quercetin, brein, quercetin-3-O-rhamnosyl, (-) catechin and scopoletin. Their structures were established by 1D and 2D NMR spectroscopy and comparison with published data.

The cultivating, through different social policies, especially through the ideologization of the values , of the contempt for the real, productive work represents a major problem. Only one country in the world set the objective – within the constitution – to not spend more

Considering mechanism of modification of these precipitations one should take into account that effect of modification of hypereutectic silumins depends on earlier transition to liquid phase of sparingly soluble crystals of primary silicon [1-3]. Tests performed by authors of the studies [4-10] enable utilization of modification treatments together with making use of a various micro additives in order to improve properties of hypereutectoid alloys.

Paulownia witches’-broom is a potentially lethal disease that ruins the quality of timber from the empress tree (Paulownia tomentosa [Thunb.] Sieb. & Zucc. ex Steud.) and other Paulownia spp. throughout East Asia. The causal agent, one of the earliest identified phytoplasmas, is transmitted by the brown marmorated stink bug, Halyomorpha halys Stål (= H. mista Uhler), in Japan, Korea, and China (Hiruki 1999). Sieve tube cells and phloem parenchyma of infected roots and young shoots contain the pathogens (Doi & Asuyama 1981). Bugs became infective after 10 days acquisition access followed by 30 days incubation, and electron microscopy indicated the presence of phytoplasmas in the salivary glands (Hiruki 1999, and references therein). Nymphs and adults are able to transmit from infected Paulownia to periwinkle (Okuda et al. 1998). H. halys is also listed as a vector of jujube witches’-broom (Phytoplasma-vectors.com 2004); however, transmission of this phytoplasma in China is generally attributed to the leafhopper Hishimonas chinensis Anufrive ( Koizumi 1995). Lace bugs (Tingidae) transmit root wilt, a non-lethal but economically damaging disease of coconut palms in India (Mathen et al. 1990). Infective phytoplasmas were observed in salivary glands of adult Stephanitis typica (Distant) following a five day acquisition access period and 13-18 days incubation. Inoculation experiments using large numbers of adults were conducted in field cages and resulted in infection of coconut seedlings; conclusions were based on serological testing, electron microscopy, and eventual appearance of disease symptoms. Studies of feeding on coconut by this lace bug showed initial entry through stomata on the underside of the leaflet, and termination of the stylets in the phloem. However, the bug does not exclusively feed on phloem; it also ruptures cell walls in the mesophyll, drains the contents of palisade cells, and leaves feeding and damage marks visible on the surface of the leaflet opposite from entry (Mathen et al. 1988). Tingid feeding typically produces only stipple marks (caused by damage to palisade parenchyma); thus, these insects are generally considered unlikely, even questionable, disease vectors (Neal & Schaefer 2000).

and 18S (NS) were carried out in 30 µL reactions containing 15 µL Qiagen Taq PCR Master Mix kit, 12 µL of H 2 O, 1 µL of each primer (10 pmol), and 1 µL of genomic DNA at 10 ng/µL. The internal transcribed spacer was amplified using primers ITS1 (TCCGTAGGTGAACCTGCGG) and ITS4 (TCCTCCGCTTATTGATATGC), with the reaction conditions as: 2 min at 95 °C, followed by 35 cycles of 1 min denaturation at 95 °C, 1 min of primer annealing at 50 °C, 1 min of extension at 72 °C, with a final elongation of 7 min at 72 °C. The NS was amplified using NS1 (GTAGTCATATGCTTGTCTC) and NS6 (GCATCACAGACCTGTTATTGCCTC) primers, and the reaction conditions were as follows: 1 min for initial denaturation at 94 °C, followed by 35 cycles of 35 s denaturation at 94 °C, 50 s of primer annealing at 55 °C, 2 min of extension at 72 °C, with a final elongation of 6 min at 72 °C. Amplifications were performed in a Programmable Thermal Controller-100, (MJ Research, Inc) thermocycler.

Customer value begins to emerge in the 1990s as an issue of growing interest to business, in particular to marketing at both academic and practitioner levels. This concept is considered to be one of the most significant factors in the success of an organisation and an important element of online shopping (Burke 1999; Pulliam 1999; Klein 1998; Hoffman and Novak 1996). It has been envisioned as a critical strategic weapon in attracting and retaining customers (Lee and Overby, 2004). In this sense, the study in hand focuses on three consequences of the perceived value of the site which are site preference, future patronage intent and e-loyalty. Besides, previous researches (Parasuraman, 1997; Holbrook, 1999) have demonstrated the multi-dimensional and highly context-dependent nature of the perceived value. In the online retailing setting, not only the product itself, but also the web site contributes value to customer. Two fundamental variables are taken in consideration to describe the site quality namely telepresence and flow state.

The research model is designed to examine the impact of customers’ perception of e- commerce security, and national environmental factors on their acceptance of Internet banking in Malaysia and Singapore. Several models have been used to explain factors determining consumer acceptance of Internet banking (Straub et. al., 1997; Liao et. al., 1999; Sathye, 1999; Tan & Teo, 2000; Pavlou, 2003; Suh & Han, 2003; Brown et. al., 2003; Venkatesh et. al., 2003). For example: technology acceptance model (TAM) devices by Davis (1986) was used by Suh and Han (2003). According to Suh and Han (2003), one of the most widely used models for explaining the factors that affects user acceptance of information systems or information technology is TAM. Another model is Fishbein and Ajzen’s (1989) theory of reasoned action (TRA), which is based on Davis’s (1986) technology acceptance model (TAM). TRA model asserts that attitude towards a behavior is determined by relevant beliefs (Davis et. al., 1989). Other theories are the theory of planned behavior (TPB), the decomposed theory of planned behavior (DTPB) by Taylor and Todd (1995) and the diffusion of innovation theory, Rogers (1983). The decomposed TPB model, according to Tan and Teo (2000), uses constructs from the innovation literature such as relative advantage, compatibility, subjective norms, and perceived behavioral control by decomposing them into more specific dimensions. While, Venkatesh et. al.’s (2003) unified theory of acceptance and use of technology (UTAUT) on the other hand posits four core determinants (performance expectancy, effort expectancy, social influence and facilitating condition) and four moderators (gender, age, experience and voluntariness of use) of the key relationships of intention and usage of information technology.

quality of alternatives with regard to price within a category (Jin & Suh, 2005). Organic vegetable products have advantages and technologies related of environmental friendly. Perceived quality is not the actual quality of the brands or products. Rather, it is the consumers’ judgment about an entity’s or a service’s overall excellence or superiority (Aaker, 1991). Sometimes is directly related to the reputation of the firm that manufactures the product (Davis et al. 2003), and viewed as the degree and direction of discrepancy between consumers’ perceptions and expectations (Chen & Chang, 2005). Perceived quality and perception of quality had closer theoretical, perception defined is the mental process that persons go through in selecting, organizing and interpreting information into meaningful patterns (Truong & Yap, 2010:532). It can be interpreted that perception of quality is overall judgment of superior quality of organic products as result from selecting, organizing and interpreting form the alternative product. Measurement of customer perception of quality on organic products is divide on several things, included guarantee (origin, brand, label, variety), organoleptic characteristic (firmness, color, flavor, aroma), and external factors (damage, size, price) (Carrasco et al., 2012:1422). In other side on organic product it measured with environmental concern, environmental consideration, environmental performance, environmental image, and environmental reputation (Chen & Chang, 2013:71).

Abstract: 4-Chlorobenzoic acid (1), quercitrin (2), astilbin (3), along with ȕ-si- tosterol, Ȗ-sitosterol, friedelin and ȕ-amyrin were isolated from the aerial parts of Hypericum monogynum. Whereas compound 1 was isolated for the first time from natural sources, flavanonol 3 was not found before in these species. Keywords: Hypericum monogynum; Clusiaceae; 4-chlorobenzoic acid; querci- trin; astilbin.