Extraction des protéines de levure : 25ml de cellules (DO660=0.6) sont récoltées par centrifugation à 4°C pendant 5 minutes à 5000rpm. Les protéines sont extraites selon la
-48-méthode TCA décrite par Clontech. 50p.g des protéines totales sont séparés sur un gel polyacrylamide 10% qui contient du sodium dodecyl sulphate comme décrit par Laemmli (Laemmli, 1970). Après migration sur gel et le transfert des protéines sur une membrane de nitrocellulose, les protéines spécifiques ont été détectées par des anticorps polyclonaux dirigés contre GST-ArgRII2-180. Ces anticorps ont été obtenus dans le laboratoire de Paul Jacobs après injection de cette protéine purifiée dans une souris. Après incubation avec l'anticorps anti-mouse immunoglobulin G-specific conjugué à la peroxydase, l'activité peroxydase est révélée par chemiluminescence utilisant le système Western blot fourni par Boehringer.
9. Gel retard
L'extrait protéique de levure a été préparé suivant la méthode décrite par Jarvis et al, 1989. Le test de liaison est réalisé comme décrit par Dubois et Messenguy (1991).
Pour les expériences de liaison, le fragment Alul-Alu\ de 160 bp contenant la région de contrôle du gène ARG5.6 a été utilisé. Les différents fragments d'ADN CARI ont été synthétisés par PCR à partir des plasmides pCV7 et pFV72 et en utilisant les oligonucléotides CAR1-DE08 et CAR1-DE09, générant les fragments d'ADN de 170 bp. Ces fragments ont été marqués à leur extrémité 5' avec du y-P^^^xP (Amersham) en utilisant la polynucléotide kinase par la méthode standard (Maniatis et al, 1982). Pour les expériences décrites dans la Figure R.5, les bandes ont été scannées avec un SharpJX330 scanner et quantifiées en analysant les images à l'aide d'un computer Macintosh (Bioimage IQ software version 2.1.1).
10. Identification in vitro d'interaction protéine-protéine
Les protéines GST-ArgRII2-180 et la GST ont été immobilisées indépendamment sur colonne contenant des billes de glutathion-sepharose-4B. Après être lavées, les billes ont été subdivisées en différentes portions pour les expériences de liaison. Des extraits de levure semi-purifiés (lOOpg) (Dubois et Messenguy, 1991), surexprimant les protéines ArgRI ou Mcml, ont été incubés toute la nuit à 4°C avec la protéine de fusion GST-ArgRII2-180 immobilisée sur les billes de glutathion-sepharose-4B. Après plusieurs lavage avec le tampon PB S froid, les billes sont bouillies dans un tampon SDS (sodium dodecyl sulphate), les échantillons sont séparés sur gel polyacrylamide SDS-
10%, puis les protéines sont transférées sur membrane de nitrocellulose et ensuite détectées par des expériences de Western blot utilisant des anticorps polyclonaux dirigés contre GST-Mcml, GST-ArgRI et le peptide C-terminal d'ArgRI (Dubois et Messenguy, 1991). L'activité peroxydase est révélée par le kit de chemiluminescence fourni par Boehringer.
Table M. 1: Oligonucleotides utilisés pour la mutagenèse m vi7ro dans les gènes j4/îC/?// ,CARI et GALA .
Oligomers Length Séquences
Oligo R1I38 27mer Oligo R1139 30mer Oligo R1IS8 30mer Oligo R11I03 37 mer Oligo RII78 21 mer Oligo RII40 30mer Oligo RII61 27mer Oligo RI179 21 mer Oligo R1180 21 mer Oligo RI181 27mer Oligo R1I82 24mcr Oligo R1183 24mcr Oligo R1I89 30mer Oligo RII71 36mer Oligo R1I72 30mer Oligo RII73 45mer Oligo R1I52 30mer Oligo RII09 30mer Oligo R1I16 28mer Oligo RI164 27mer Oligo RII08 27mer Oligo RII 10 30mer Oligo RH 11 33mer Oligo RII93 27mer Oligo R1I94 27mer Oligo RIII4 27mcr Oligo RII 15 30mer Oligo CAR 199 39mer Oligo CAR 1100 39mer Oligo CARI DE 08 30mer Oligo CARI DE 09 30mer CCCGCXXîATCCAGATATAATGGGAATT œCAAAll'lCi'I'iATGAGGATCCACTAGTT CCGGCGGCCGCTAGTTGAAGAAGATGGTAA GCCGGATCCTCTTCTtriGTACCTCTTTAATG AAAGTTAAGTTAGATCTTCGG CATCCCCACTTACAACGATrAGAAAAGTCT GATCTTCGGCAnTACACTGCCAACGA GATGAACCAGCATACCAACGA CGGAACATCGCTTTTGTGCGC GTGCGCTATGCTGCAGCATACGTGTAT GTGTATCATGCAGCTATGGATGAT GAAGATATGGCTGCTGAGCTAACA GCCAAGTGAAGAAAATGTTAATTACAAACC GTTATnTGCCAGCTCAACAAGATGATAATTACAAA ctgaagttaattgaaaatagcactxx:gttg AGCACTGCGTTGAATAAAGTCAGGGCAAAGCAAATTGTTATnTG AAGTTGCAGATAGGATCCGAAnTTCAGCA GCCGGGATCCTAAGTTGAAGAAGATGGTAA GCCGCCGGGATCXTTAATCATTGGCACTGGC GCCGGGATCCCTATGCAATTTGACCCG GCCGGGATCCAACGACGGAACATCGAT GCCGGGATCCATATTATACCCAAAACAG GCCGGG ATCCT ATTTTTGT AGTTTGT AGTTCCT GCCGGGATCCACAAACTACAAAAATAC GCCGGGATCCTAAAATTTTCGGGGTAC GCCGGGATCCCTGTACCCCGAAAATTT GCCGGGATCCTTATGATAGCATCAGATT CAAGCACCGTGTTTCCTAATrAGGAAATCAACAGCGC GCGCTGTTGATTrCCTAATTAGGAAACACGGTGCnTG CCGCTCGAGCGCCGCGAAAATATCGGCTAG CCGCTCGAGTGATAGAAAGTGGGCCGCAAG Aminoacid changes
Création of a HI site at position -7 Création of a site at position -f410 Création of a Notl site at position +542 Création of a Bam HI site at position +901 Replacement of aa C3iL
Replacement of aa C38L.C41L Replacement of aa P36L Replacement of aa Q89A Replacement of aa D96A
Replacement of aa DlOl A.E)02A,El03A Replacement of aa El08AJ)109A Replacement of aa DiiiA,Dli2A Replacement of aa D584N.D585V Replacement of aa S58IA,ES82Q£S83Q Replacement of aa QS63E4>S64N Replacement of aa D569N.E575Q Création of a Bam HI site at position +1 Création of a Bam HI site at position +542 Création of a Bam HI site at position +901 Création of a Bam HI site at position +179 Création of a Bam HI site at position +272 Création of a Bam HI site al position +1139 Création of a fiam HI site at position +1412 Création of a Bam HI site at position +1397 Création of a Bam HI site at position +2146 Création of a Bam HI site at position +2129 Création of a Bam HI site at position +2641 Replacement of Arginine Box B by PP AL Replacement of Arginine Box B by PP AL Primer logenerate CARI fragment Primer to generate CARI fragment
11. Constructions réalisées au cours de ce travail
11. 1. Construction des plasmides portant différentes portions N-terminales d'ArgRII exprimées sous la dépendance du promoteur GALIO ou du promoteur
à'ARGRII
Afin de surexprimer les 128, 180 ou 302 premiers acides aminés d'ArgRII, le plasmide pME52 contenant le gène ARGRII sauvage a été utilisé pour synthétiser par PCR des fragments d'ADN BanûW-Notl en utilisant les oligonucléotides RII38(fiamHI)-
RII39(Aod), RII38-RII58(AorI) et RII38-RII77(A^orI), respectivement (voir Table M.l).
Ces fragments sont insérés dans les sites BartïHl et Notl du vecteur pYeF2 (pUC19,2/x,(//M3, promoteur GALIO) (5) pour former les plasmides pNA44
{GALIO-ArgRIIl-128), pNA53 (GAL70-ArgRIIl-180) et pNA59 (GAL70-ArgRIIl-302).
Pour exprimer les 302 premiers acides aminés d'ArgRII à partir du promoteur ARGRII,
nous avons synthétisé par PCR un fragment d'ADN BamYH-BamVll en utilisant l'ADN génomique comme matrice et les oligonucléotides RII 103 (localisé à la position -700 à partir de l'ATG) et RII 16. Ce fragment est inséré dans le site de restriction BamUl de pFL38 {vUCI9, CEN6, ARS, URA3) et pFL44L {pGCl9,2^1, U RAS ) (Bonneaud et al, 1991) générant les plasmides pNA133 (pFL38-ArgRII 1-302) et pNA134 (pFL44L- ArgRIIl-302).
Pour fusionner le domaine d'activation de Gal4 (GAD) aux 180 premiers résidus d'ArgRII, nous avons synthétisé par PCR un fragment d'ADN Notl codant pour les acides aminés 768 à 881 de Gal4 à partir du plasmide pCLl (Fields et Song, 1989) en utilisant les oligonucléotides OADl et OAD2. Ce fragment est inséré dans le site Notl
du plasmide pNA53, produisant la protéine de fusion ArgRIIl-180-GAD (pNA54). Tous ces gènes sont séquencés pour vérifier qu'aucune mutation n'est introduite durant la procédure de PCR.
11. 2. Création de mutations dans le gène ARGRII.
Différents oligonucléotides (liste dans Table M.l) sont utilisés pour créer des substitutions par mutagenèse in vitro dans le gène ARGRII. Le simple brin d'ADN est préparé à partir du plasmide pME52 (pGem7-ARGRII) ou pNA84 (pALTERl- ARGRII) contenant le gène ARGRII exprimé sous son propre promoteur. Les plasmides résultants sont: pNA31 (pGem7-argRIIC3lL), pNA56 (pGem7- argRIIC38L,C41L), pWSl (pALTER 1-argRIlP36L), pNA88(pALTER 1- argRIlD101A,E102A,E103A), pN A89(p ALTER 1-argRIlE108A,D109A), pNAl 19(pALTERl-argRIlQ89A,D96A,Dl 11 A,D112A), pNA120(pALTERl-argRIlD96A,D 111 A,D 112A), pNA123(pALTER 1 -argRIlD 101 A,E 102A,E 103A,E 108A,D109A),
Matériel et Méthodes
pNA124(pALTERl-argRIlD101A,E102A,El03A,DlllA,D112A), pNA131(pALTERl- argRIlQ89A,E 108A,D 109A), pNA132(pALTER1 -argRIlD96A,E 108A,D109A),
pN A147(p ALTER 1 argRIlD584N,D585V),pN A148(p ALTER 1
-argRIIS581A,E582Q,E583Q), pNA 149(pALTERl-argRIlQ563E,D564N) , et pNA155(pALTERl-argRIlD569N,E575Q). Les fragments d'ADN BarrMi-BamYil (3,4 kb) sauvage et mutés sont insérés dans un vecteur monocopie pFL38 (pf/C79, CEN6, ARS, URA3) produisant les plasmides: pNA109 (sauvage), pNA36 (C31L), pNAllO (C38L,C41L), pWS4 (P36L), pNA114 (DlOlA,E102A,E103A), pNAllS (E108A.D109A), pNA125 (Q89A,D96A,D111A,D112A), pNA126 (D96A,D111 A,D112A), pNA129 (D101A,E102A,E103A,E108A,D109A), pNA130 (D101A,E102A,E103A,D111A,D112A), pNA139 (Q89A,E108A,D109A), pNA140 (D96A,E108A,D109A), pNAlSl (D584N.D585V), pNA152 (S581A,E582Q,E583Q), pNA153 (Q563E.D564N) et pNA154 (D569N,E575Q), respectivement. Nous avons aussi recréé in vitro les trois mutations localisées dans la partie N-terminale d'ArgRII lesquelles correspondent à des mutations isolées par sélection in vivo, conduisant aux changements suivants: D32N, G50D et R99P. Après mutagenèse les fragments d'ADN BamHl-Bamlil de 3,4 kb sont insérés dans le vecteur pFL38, créant les plasmides pBJ250, pBJ202 et pBJ211.
11. 3. Création de mutations dans la région N-terminale d'ArgRII (1-180 aa)
Pour surexprimer les régions N-terminales sauvage et mutées d'ArgRII, les plasmides suivants: pNA84, pNA31, pNA56, pBJ250, pWSl, pBJ202, pBJ211, pNA123 et pNA124 (décrits avant) ont été utilisés pour synthétiser des fragments d'ADN BamRl-Notl par PCR, en utilisant les oligonucléotides RI138 et RII58 qui contiennent respectivement les sites de restriction BamHl et Notl (Table M.l). Après amplification par PCR, ces différents fragments sont digérés par BamHl et Notl et insérés dans les sites BamHl et Notl du vecteur pYeF2 (pUC19,2/x,f/RA3, promoteur GALIO ) (Cullin et Minvielle-Sebastia, 1993) générant les plasmides pNA53 (GALlO-ArgRIIl- 180),pNA63 (GALi0-argRIIl-180C31L), pNA64 (GALi 0-argRIIl-180C38L,C41L), pNA78 (GAL70-argRIIl-180D32N), pNA79 (GAL7 0-argRIIl-180P36L), pNA77 (GAL70-argRIIl-180G50D), pNA76 (GAL79-argRIIl-180R99P), pNA137
(GALIO-argRIIl-180D101A,El02A,El03A,El08A,Dl09A), pNA138(G A L 1 0-argRIIl- 180D101A,E102A,E103A,D1 11 A,D112A).
Tous ces gènes sont séquencés pour vérifier qu'aucune mutation n'est introduite durant la procédure de PCR.
11.4. Construction des fusions GAD-ARGRII et GBD-ARGRII
GBD correspond au domaine de liaison à l'ADN de l'activateur Gal4, Gal4( 1-147) et GAD à son domaine d'activation, Gal4(768-881). GBD et G A D (en italique) correspondent aux séquences d'ADN codant pour ces domaines. Les fusions
-ARGRI et GBD-MCMl sont construites comme décrit par EL Bakkoury et al (2000) et les fusions GAD-ARGRII et GBD-ARGRII sont construites dans le vecteur pACTII et pAS2 (Durfee et al. 1993) respectivement; les transformants portant ces vecteurs sont sélectionnés sur un milieu de culture dépourvu de leucine et de trypthophane.
a. fusions GAD-ARGRII et GBD-ARGRII.
Dans ce cas, nous avons utilisé l'oligonucléotide RII52 pour créer par mutagenèse dirigée un site de restriction BamYil au niveau du codon d'initiation du gène ARGRII
exprimé dans le plasmide pME52 (le gène ARGRII correspond à un fragment d'ADN de 3,4kb), le plasmide résultant est pME8. Le fragment d'ADN de 3,2kb BamRl-BamHl à partir du plasmide pME8 est inséré dans le site BamHl des vecteurs pACTII et pAS2, créant les plasmides pME9 (GAD-ARGRII) et pNA33 (GBD-ARGRII)- La fusion en phase entre le GAD ou GBD et le gène ARGRII a été vérifiée par séquençage de la zone de jonction.
b. Fusions GAD-argRII contenant les différentes délétions dans le gène ARGRII
Pour fusionner les différentes portions du gène ARGRII aux GAD ou GBD nous avons amplifié par PCR différents fragments d'ADN, utilisant comme matrice le gène ARGRII
présent dans le plasmide pME52, et comme amorce des oligonucléotides synthétiques contenant un site de restriction BamWl. Les oligonucléotides RII52-RII09, RII52-RII16, RII52-RII39, RII64-RII09, RII08-RII09, RII08-RII16, RIIlO-RIIll, RII93-RII94 et RII14-RII15 (Table 1) permettent l'amplification des régions comprises entre les acides aminés 2-180(534bp), 2-302(900bp), 2-128(378bp), 60-180(360bp), 91-180(267bp), 91-302(633bp), 381-470(267bp), 467-715(744bp) et 710-881(513bp), respectivement. Les différents fragments d'ADN BamY{\-BamY{\ sont insérés dans le site BarrMl des vecteurs pACTII et pAS2, menant aux plasmides suivants: pNA47 (GAD-ArgRII2- 180), pNA58 (GAD-ArgRII2-302), pNA43 (GAD-ArgRII2-128), pNA48 (GAD- ArgRII60-180), pNA23 (GAD-ArgRII91-180), pNA27 (GAD-ArgRII91-302), pNA46 (GAD-ArgRII381-470), pNAlSO (GAD-ArgRII470-710) et pNA25 (GAD-ArgRII710- 880) dans le vecteur pACTII et pNA49 (GBD-ArgRII2-180), pNA142 (GBD-ArgRII2- 302), pNA42 (GBD-ArgRII2-128), pNASO (GBD-ArgRII60-180), pNA28 (GBD- ArgRII91-180), pNA41 (GBD-ArgRII91-302), pNA24 (GBD-ArgRII381-470), pNA145 (GBD-ArgRII470-710) et pNA26 (GBD-ArgRII710-880) dans le vecteur pAS2. Les gènes ont été séquencés pour vérifier qu'aucune mutation n'a été introduite durant la procédure de PCR et que la fusion entre le GAD ou GBD et le gène ARGRII
Matériel et Méthodes
c. Fusions GAD-argRII2-180 contenant les différentes mutations dans le gène
ARGRII
Les plasmides suivants pNA31, pNA56, pBJ250, pWSl, pBJ202, pNA86, pBJ211, pNA87, pNA88, pNA89, pNA90, pNA123 et pNA124 (décrits précédemment) ont servi de matrice pour synthétiser, par PCR les fragments d'ADN Ba/nHI-Ba/nHI de 540bp en utilisant les oligonucléotides RII52-RII09 (Table M.l). Ces fragments sont insérés dans le site de restriction BamYil du plasmide pACTII (GAD) pour générer les plasmides pNA65 (GAD-argRII2-180C31L), pNA66 (GAD-argRII2-180C38L,C41L), pNA74 (GAD-argRII2-180D32N), pNA75 (GAD-argRII2-180P36L), pNA73 (GAD-argRII2- 180G50D), pNA72 (GAD-argRII2-180R99P), pNA146 (GAD-argRII2-180 D101A,E102A,E103A,E108A,D109A), pNA161 (GAD-argRII2-180 D101A,E102A,E103A,D111A,D112A). Tous ces gènes ont été séquencés pour vérifier que la fusion est en phase et qu'aucune mutation n'a été introduite durant la procédure de PCR.
11.5. Construction et purifîcation des protéines de fusion avec la GST
Pour produire les protéines purifiées ArgRI, ArgRII et Mcml, nous avons exprimé celles-ci sous forme de fusion avec la GST dans E.coli. Pour construire GST-ArgRI, nous avons inséré un fragment BamHl de l,7kb isolé à partir du plasmide pYM3 (El Bakkoury et al, 2000) qui contient le gène ARGRI dans lequel un site de restriction
BamHl est introduit dans le codon initiateur afin de permettre la fusion en phase avec la GST. Ce fragment est inséré dans le site BamHl du plasmide pGEX-5X-3 (Pharmacia), générant le plasmide pME53. Pour construire GST-Mcml, nous avons inséré le fragment BamHl de 0,9kb isolé à partir du plasmide pMElS (El Bakkoury et al, 2000) contenant le gène MCMl dans lequel un site de restriction BamHl est introduit dans le codon initiateur pour permettre la fusion en phase avec la GST. Ce fragment est inséré dans le site BamHl du plasmide pGEX-5X-3, produisant le plasmide pME58. Pour construire les fusions entre la GST et la portion N-terminale (180aa) sauvage et mutée d'ArgRII, nous avons synthétisé par PCR des fragments BamHl-Notl en utilisant les oligonucléotides RII52-RII58 et les plasmides pME52 (ArgRII sauvage), ou pNA123 (argRIlDl0lA,El02A,El03A,El08A,Dl09A). Ces fragments sont insérés dans les sites
BamHl-Notl du plasmide pGEX-5X-3, générant les plasmides pME106 et pNA162 respectivement. La fusion en phase entre la GST et ces protéines a été vérifiée par séquençage de la zone de jonction.
11. 6. Remplacement des "arginine boxes" du promoteur CARI par la séquence PPAL
Par mutagenèse dirigée (comme décrit par Stratagene), les nucléotides de -211 à -199 du promoteur CARI ont été remplacés par la séquence suivante:
-5'TTTCCTAATTAGGAAA3' en utilisant le plasmide pCV7 (pFL38-CARl) (Dubois et Messenguy, 1997) et les oligonucléotides CAR 1-99 et CAR 1-100 (Table 1) générant le
Références
REFERENCES
Althoefer, H., Schleiffer, A., Wassmann, K., Nordheim, A., and Ammerer, G. (1995). Mcml is required to coordinate G2-specific transcription in saccharomyces cerevisiae. Mol.Cell.Biol. 15 : 5917- 5928.
Anderson, S. F., Steber, C. M., Esposito, R. E., and Coleman, J. E. (1995). UME6, a négative regulator of meiosis in Saccharomyces cerevisiae, contains a C-terminal ZN2C6 binuclear cluster that binds the URSl DNA sequence in a zinc-dependent manner. Protein Sci. 4: 1832-1843.
André, B. (1990). The UGA3 gene regulationg the GABA catabolic pathway in Saccharomyces
cerevisiae codes for a putative zinc finger protein acting on RNA amount. Mol. Gen. Genet. 220: 269- 276.
Axelrod, J.D., Majors, J., and Bradriss, M.C. (1991). Proline-independent binding of PUT3 transcriptional activator protin detected by footprinting in vivo. Mol. Cell. Biol. 11: 564-567.
Bai, Y., and Kohlhaw, G. B. (1991). Manipulation of de "zinc cluster" région of transcriptional activator LEU3 by site directed mutagenesis. Nucleic Acids Res. 19: 5991-5997.
Baleja, J. D., Marmorstein, R., Harrison, S. C., and Wagner, G. (1992). Solution structure of the DNA-binding domain of Cd2- GAL4 from Saccharomyces cerevisiae. Nature 356: 450-453.
Baum, J. A., Geever, R., and Giles, N, H. (1987) Expression of qa-IF activator protein: Identification of upstream binding sites in the qa gene cluster and localization of the DNA-binding domain. Mol. Cell. Biol. 7: 1256-1266.
Beacham, I. R., Schweizer, B. W., Warrick, H. M., and carbon, J. (1984). The nucléotide sequence of the yeast ARG 4 gene. Gene. 29 : 271-279.
Béchet, J., Grenson, M., and Wiame, J. M. (1970). Mutations affecting the repressibility of arginine biosynthetic enzymes in Saccharomyces cerevisiae . Eur. J. biochem. 12: 31-39.
Becker, B., Feller, A., El Alami, M., Dubois, E., and Piérard, A. (1998). A nonameric core sequence is required upstream of the LYS genes of Saccharomyces cerevisiae for Lysl4p-mediated activation and apparent repression by lysine. Mol. Micobiol. 29: 151-163.
Bender, A., and Sprague, Jr. G.F. (1987). MATal protein, a yeast transcription activator, binds synergistically with a second protein to a set of cell-type-specific genes. Cell. 50 : 681-691.
Bercy, J. Dubois, E., and Messenguy, F. (1987). Régulation of arginine metabolism in saccharomyces cerevisiae: expression of the three ARGR regulatory genes and cellular localization of their products. Genes. 55 : 277-285.
Bowdish, K, S., YuBirnboïm, H.C., and Doiy, J. (1979). A rapid alcaline extraction procedure for screening recombinant plasmid DNA. Nuclei.Acids.Res. 7 : 1513-1523.
Blinder D, Coschigano PW, Magasanik B. (1996). Interaction of the GATA factor Gln3p with the nitrogen regulator Ure2p in Saccharomyces cerevisiae. J Bacteriol. 178: 4734-6.
Bonneaud, N., Ozier-Kalogeropoulos, O., Li, G. Y., Labouesse, M., Minvielle-Sebastia, L., and Lacroute, F. (1991). A family of low and high copy réplicative, intégrative and single-standed
Saccharomyces cerevisiae/E.coli shuttle vectors. Yeast 7:609-615.
Boonchird, C., Messenguy, F., and Dubois, E. (1991). Characterization of the yeast ARG5, 6 gene : détermination of its nucléotide sequence, localization of the functional domains and analysis of the control région. Mol. Gen. Genet. 226 : 154-166.
-55-Bowdish, K. S., Yuan, H. E., and Mitchel, A. P. (1995). Positive control of yeast meiotic genes by the négative regulator UME6. Mol. Cell. Biol. 15: 2955-2961.
Bornaes, C., Ignjatovic, M.W., Schjerling, P., Kielland-Brandt, M.C., and Holmberg, S. (1993). A regulatory element in the CHAI promoter which confers inducibility by serine and threonine on
Saccharomyces cerevisiae. genes. Mol. Cell. Biol. 13: 7604-7611.
Birnboïm, H.C., and Doly, J. (1979). A rapid alcaline extraction procedure for screening recombinant plasmid DNA. Nuclei.Acids.Res. 7 : 1513-1523.
Bram, R.J.,and Kornbreg, R.D. (1985). Spécifie protein binding to far upstream activating sequences in polymerasell promoters. Proc. Natl. Acad. Sci. USA 82: 43-47.
Brandriss MC, Magasanik B. (1980). Proline: an essential intermediate in arginine dégradation in Saccharomyces cerevisiae. J Bacteriol. 143:1403-10.
Brandriss MC, Magasanik B. (1981). Subcellular compartmentation in control of converging pathways for proline and arginine metabolism in Saccharomyces cerevisiae. J Bacteriol. 145: 1359-64.
Brisco, P. R., and Kohlhaw, G. B. (1990). Régulation of yeast LEU2. Total délétion of regulatory gene L£f/i unmasks GCN4-dependent basal level expression of L£f/2. J. Biol. Chem. 265: 11667-11675 Bruhn, L., and Spraguejr, G.F. (1994). MCMl point mutants déficient inexpression of a-specific genes: residues important for interaction with al. Mol.Cell.Biol. 14 : 2534-2544.
Bruhn, L., Hwang-Shum, J.J., and Sprague, Jr, G.F. (1992). The N-terminal 96 residues of MCMl, a regulator of cell-type-specific genes in Saccharomyces cerevisiae, are sifficient for DNA binding, transcription avtivation, and interaction with al. Mol.Cell.Biol.. 12 : 3563-3572.
Buckingham, M. (1994). Molecular hiology of muscle development. Cell 78: 15-21.
Burke, M., A.F. Merican and D.J. Sheratt. (1994). Mutant Escherichia coli arginine repressor proteins that fail to bind L-arginine, yet retain the ability to bind their normal DNA-binding sites. Mol. Microbiol. 13: 609-618
Carey, M., Kakidani, H., Leatherwood, J., Mostashari, F., and Ptashne, M. (1989). An amino terminal fragment of GAL4 binds DNA as a dimer. J. Mol. Biol. 209: 423-432.
Chang, P.-K., Ehrlich, K., Yu, J., Bhatnagar, D., and Cieveland, T. E. (1995). Increased expression of
Aspergillus parasiticus aflR, encoding a sequence-specific DNA-binding protein, relieves nitrate inhibition of aflatixin biosynthesis. Appl. Env. Microbiol. 61: 2372-2377.
Chien, C.-T., P. L. Bartel, R. Stern glans, and S. Fields. (1991). The two-hybrid sustem: a method to identify and clone genes for proteins that interact with a protein of interest. Proc. Natl. Acad. Sci. USA. 88 :9578-9582.
Christ, C., and Tye, B. K. (1991). Functional domains of the yeast transcription / réplication factor MCMl. Genes. Dev. 5 : 751-763.
Coffman, J. A., Rai, R., Loprete, D. M.., Cunningham, T., Svetlov, V. and Cooper, T. G. (1997). Cross régulation of four GATA factors that control nitrogen catabolic gene expression in Saccharomyces cerevisiae . J. Bacteriol. 179: 3416-3429.
Cohen, C., and Parry, D. A. D. (1990). a-helical coiled coils and bundles: how to design an a-helical protein. Proteins 7: 1-15.
Cooper, T. G. (1982). Nitrogen Metabolism in Saccharomyces cerevisiae , p. 39-99. In J. N. Strathem, E. W. Jones, and J. R. Broach (ed.), The molecular biology of the yeast Saccharomyces cerevisiae . Cold Sping Harbor Laboratory Press, Cold Sping Harbor, New York.
Références
Courchesne, W. E., and Magasanik, B. (1988). Régulation of nitrogen assimilation in Saccharomyces cerevisiae : rôles of the URE2 and GLN3 genes. J. Bacteriol. 170: 708-713.
Corton, J. C., and Johnston, S. A. (1989). Altering DNA-binding specificity of GAL4 requires sequences adjacent to the zinc finger. Nature 340: 724-727.
Crabeel, M., De Rijcke, M., Seneca, S., Heimberg, H., Pleiffer, I., and Matisova, A. (1995). Further définition of the sequence au position requirements of the arginine control élément that médiates repression and induction by arginine in Saccharomyces cerevisiae. Yeast. 11: 1367-1380.
Crabeel, M., Huygen, R., Verschueren, K., Messenguy, F., Tinel, K., Cunin, R., and Glansdorf, N. (1985). General amino acid control and spécifie arginine repression in saccharomyces cerevisiae : physical study of the bifunctional regulatory région of the ARG3 gene. Mol. Cell. Biol. 5 : 3139-3148. Crabeel, M., Lavallé, R., and GlansdorfT, N. (1990). Arginine spécifie repression in saccharomyces cerevisiae : Kinetic data on ARGl and ARG3 mRNA transcription and stability support a transcriptional control mechanism. Mol. Cell. Biol. 10 : 1226-1233.
Crabeel, M., Seneca, S., Devos, K., and Glansdorff, N. (1988). Arginine repression of the saccharomyces cerevisiae ARGl gene : comparaison of the ARGl and ARG3 control régions. Cuir. Genet. 13; 113-124.
Creuset, F., Verdière, J., Gaisne, M., and Slonimski, P. P. (1988). CYPl (HAPl) regulator of oxygen dépendent gene expression in yeast. I. Overall organization of the protein sequence displays several novel structural domains. J. Mol. Biol. 204: 263-276.
Cullin C. and L.Minvielle-Sebastia (1993). Multipurpose vectors designed for the fast génération of N- or C-terminal epitope-tagged protein. Yeast 10: 105-112
Cullin, C., and Minvielle-Sebastia, L. (1994). Multipurpose vectors designed for the fast génération of N- or C-terminal epitope-tagged proteins. Yeast. 10 : 105-112.
Cunin, R., Dubois, E., Vanthienen, G., Tinel, K., Jacobs, A., and Crabeel, M. (1986). Positive and négative régulation of CARI expression in Saccharomyces cerevisiae. Mol.Gen.Genet. 205 : 170-175. Daignan-Fornier B, Fink GR. (1992). Coregulation of purine and histidine biosynthesis by the transcriptional activators BAS 1 and B AS2. Proc Natl Acad Sci USA. 89: 6746-50.
DeDecken, R. (1962). Biochem. Biophvs. Res. commun. 8: 462-466.
De Rijcke, M., Seneca, S., Punyammalee, B., Glansdorff, N., and Crabeel, M. (1992). Chracterization of the DNA target site for the yeast ARGR regulatory complex, a sequence able to médiate repression or induction by arginine. Mol. Cell. Biol. 12: 68-81.
Defranoux, N., Gaisne, M., and Verdière, J. (1994). Functional analysis of the zinc cluster domain of the CYPl (HAPl) complex regulator in heme-sufficient and heme déficient cells. Mol. Gen. Genet. 242: 699-707.
Delahodde, A., Delaveau, T., and Jacq, C. (1995). Positive autoregulation of the yeast transcription