Células humanas: os dados foram expressos como média ± desvio padrão. Primeiramente, testamos a normalidade dos dados com os testes Kolmogorov-Smirnov, D'Agostino & Pearson omnibus e Shapiro-Wilk. De acordo com o obtido, analisamos as diferenças entre controle e paciente e entre mioblastos e miotubos ou com o teste de Mann- Whitney ou teste t não pareado, utilizando o software GraphPad Prism. Um p-valor <0,01 foi considerado significante.
Camundongos: os dados foram expressos como média ± desvio padrão. Primeiramente, testamos a normalidade dos dados com os testes Kolmogorov-Smirnov, D'Agostino & Pearson omnibus e Shapiro-Wilk. De acordo com o obtido, analisamos as diferenças entre cada linhagem e o selvagem com o teste de Mann-Whitney, utilizando o software GraphPad Prism. Um p-valor <0,05 foi considerado significante.
Capítulo 3
Autophagy is not altered during in vitro muscle differentiation in XMEA
Stephanie A. Fernandes1, Anne Bigot2, Vincent Mouly2 and Mariz Vainzof1. 1
Human Genome and Stem-cell Research Center, Biosciences Institute, University of São Paulo, São Paulo, Brazil.
2
Sorbonne Universités, UPMC Univ Paris 06, INSERM UMRS974, CNRS FRE3617, Center for Research in Myology, Paris, France.
Abstract
X-linked myopathy with excessive autophagy (XMEA) is a disease that affects only males and is related to weakness of proximal muscles of lower extremities. It is caused by mutations in the VMA21 gene, a chaperone that functions in the assembly of the vacuolar ATPase (v-ATPase). Lower content of assembled v-ATPases lead to an increase in lysosomal pH, culminating in a partial blockage of the final step of macroautophagy, with further accumulation of vacuoles of undigested content. Here, we evaluated the autophagy pathway in XMEA muscle differentiation in vitro. Both control and patient cells showed similar pattern of protein and gene expression of p62, BNIP3, BECLIN1, VPS34, ATG12, LC3 and mTOR targets in undifferentiated myoblasts and differentiated myotubes. This fact suggests that autophagic deregulation and vacuole formation might arise in later stages of disease, in a pattern observed in disorders with protein accumulation. On the other hand, analysing the different stages of muscle differentiation in XMEA patient-derived cells, we observed that these cells have an enhanced capacity of myoblast fusion and myotube formation. However, this was not related to differences in mRNA expression of genes involved in myogenesis, suggesting no alteration in the myogenic programme. We could speculate if other consequences of the primary defect, such as deficiency in the vacuolar ATPase, could interfere with the process of muscle differentiation and fusion. Further studies should be performed aiming to understand the time course in which autophagy alterations arise with muscle formation, and which player is responsible for the myogenic alterations in XMEA.
This comprehension will be essential for defining the time point in which therapeutic interventions could be successful.
Resumo
A miopatia ligada ao X com autofagia excessiva (XMEA) é uma doença que afeta apenas meninos e leva à fraqueza dos músculos proximais das extremidades inferiores. A doença é causada por mutações no gene VMA21, que codifica uma chaperona responsável pela correta montagem da ATPase vacuolar (v-ATPase). Menor quantidade de v-ATPases leva ao aumento do pH lisossomal, culminando no bloqueio parcial da etapa final da macroautofagia, com acúmulo de vacúolos de conteúdo não digerido. Nesse estudo, nós avaliamos a via da autofagia na diferenciação muscular in vitro em XMEA. Em células controle e derivadas de paciente XMEA, identificamos um padrão similar de expressão das proteínas e genes p62, BNIP3, BECLIN1, VPS34, ATG12, LC3 e de alvos de mTOR, tanto em mioblastos indiferenciados como miotubos diferenciados. Estes resultados sugerem que a desregulação da autofagia e formação de vacúolos pode acontecer em estágios mais tardios da doença, conforme padrão observado em doenças de acúmulo lisossomal. Por outro lado, uma capacidade aumentada de fusão de mioblastos e formação de miotubos foi observada na diferenciação muscular de células XMEA, porém não relacionada a alterações na expressão de genes envolvidos na miogênese. Nós especulamos se outras consequências decorrentes do defeito primário, como a deficiência da ATPase vacuolar, poderiam interferir no processo de diferenciação e fusão muscular. Identificar a fase crítica para a ocorrência de alterações na via da autofagia durante a formação do músculo tem implicações importantes na definição de alvos para intervenções terapêuticas.
Introduction
X-linked myopathy with excessive autophagy (XMEA) is a muscle disorder that affects only males, with a commonly childhood onset. In those patients, there is weakness of proximal muscles of lower extremities that progresses to other muscles until loss of ambulation occurs around 50-years-old (Kalimo et al., 1988; Chabrol et al., 2001). Nonetheless, late onset forms of the disease have also been described (Crockett et al., 2014). Although cardiac involvement is not a classic feature (Kalimo et al., 1988; Saraste et al., 2015), it has been recently reported that vacuolation of cardiac muscle can also be a feature in more severe cases (Munteanu et al., 2017). In muscle biopsies, membrane-bound sarcoplasmic vacuoles can be observed (Kalimo et al., 1988). Recently, the first Brazilian XMEA family was identified in the Human Genome and Stem Cell Research Center (HUG- CELL).
XMEA is a disease caused by hypomorphic alleles of the VMA21 gene. The protein encoded by this gene is a chaperone that is involved in the correct assembly of the vacuolar ATPase (v-ATPase), which is the proton pump involved in lysosomal acidification. In XMEA, there is a decrease in assembled v-ATPases, leading to a slightly increased lysosomal pH, which in turn culminates in a partial blockage of the degradative step of macroautophagy. As a consequence, a feedback mechanism is activated with higher levels of macroautophagic induction, leading to accumulation of vesicles with undigested content inside muscle fibers (Ramachandran et al., 2013).
Macroautophagy, hereafter referred as autophagy, is a recycling process of proteins and damaged organelles via lysosome. It occurs through the formation of double-membraned structures called autophagosomes, which engulf the cargo and fuse with the lysosome for degradation. This pathway has been increasingly described as essential for muscle function and structure (Mammucari et al., 2007; Zhao et al., 2007; Masiero et al., 2009). In last years, autophagy has been also strongly implicated in differentiation of progenitor muscle cells (myoblasts) into myotubes, which are the cells that will undergo maturation to form adult muscle fibers. Studies investigating the differentiation of immortalized mouse myoblasts (C2C12 cells) showed that autophagy has its levels increased during myotube formation. This increase was essential to protect those cells against apoptosis-mediated cell death (Mcmillan e Quadrilatero, 2014). Later, the autophagy pathway has been implicated in the mitochondrial degradation that needs to occur in myoblasts to allow posterior mitochondrial biogenesis for
the appropriate metabolism of myotubes (Sin et al., 2016). Those results were corroborated by studies with satellite cells, which are muscle stem cells, in which autophagy played an essential role in myotube formation (Fortini et al., 2016).
Here, we aimed to understand how autophagy is regulated in XMEA muscle progenitor cells. Intriguingly, no changes could be observed in the basal levels of the autophagic pathway in the studied time points, implying that alterations in this pathway by disease may arise in more advanced stages of muscle formation. Our findings also indicate that differentiation in XMEA is altered, with increased myotube formation being observed in XMEA cells. Nonetheless, there were no variations in the expression of myogenic factors, suggesting that differentiation may be affected by other players. Our findings may have implications for therapy development in establishing the time points in which interventions could be successful.
Materials and Methods 1. Muscle biopsy and histology
A muscle biopsy from the biceps was obtained from a 5-years-old patient, for diagnostic purpose. The muscle sample acquired was divided for obtaining myoblasts in cell culture or immediately frozen in liquid nitrogen after removal and stored at -70oC. Histological sections were made from this frozen biopsy using a cryostat (Microm HM 505E) and hematoxylin/eosin staining was performed. The stained slides were observed by light microscopy (Zeiss).
XMEA diagnosis was established through next generation sequencing molecular analysis, identifying a small deletion in the noncoding region of the VMA21 gene.
All studies were performed in the Human Genome and Stem Cell Research Center (HUG-CELL) after obtaining a consent form from his parents.
2. Cell culture
Myoblasts from the XMEA patient were isolated from his muscle biopsy. Control myoblasts were isolated from the quadriceps of a normal individual, and were generously
provided by Dr. Vincent Mouly (Institut de Myologie, France). All cells were immortalized at the Institut de Myologie by a previously established protocol (Mamchaoui et al., 2011). Importantly, the maintenance of the proliferative and differentiation capacities from the original cell lines was assessed and confirmed.
The immortalized cell lines were seeded in a density of 2,5x105 cells per 75cm2 and grown in proliferation medium - Skeletal Muscle Cell Growth Medium (PromoCell) with 20% of fetal bovine serum (Gibco). When cells reached 100% confluence, they were switched to differentiation medium, which is composed by DMEM GlutaMAX™ (Invitrogen), 50μg/ml of gentamycin (Invitrogen) and 10μg/ml of insulin (Sigma).
Proliferating and differentiated cells for three and six days were collected after incubation with Trypsin (Gibco) and centrifuged at 300g for 10 minutes at 4oC. The cell pellets were washed with 1X PBS (Gibco) and centrifuged once more. The resulting pellets were frozen in -70oC before proceeding to RNA and protein analysis. Cells were obtained from three independent experiments.
3. Immunofluorescence
Frozen muscle biopsy sections from the XMEA patient and the control were fixed with 100% methanol for 15 minutes at -20oC, permeabilized with 0,1% Triton™-X100 for 5 minutes and blocked for one hour in a solution of 1X PBS (Gibco), 5% goat serum (Sigma- Aldrich) and 0,3% Triton™X-100 (Sigma-Aldrich). The histological sections were then incubated overnight at 4oC with the primary antibody for Lc3 (3868, Cell Signaling) in a solution of 1x PBS (Gibco), 1% bovine serum albumin (Sigma-Aldrich) and 0,3% Triton™X- 100 (Sigma-Aldrich). Slides were washed three times in 1X PBS (Gibco), incubated with an anti-rabbit secondary antibody conjugated to AlexaFluor 594 (11012, Invitrogen)for one hour at room temperature and washed again. Slides were mounted with Vectashield® Mounting Media (Vector) with DAPI. Images were obtained in a Zeiss LSM-800 confocal system with a Plan-Apochromat 63X/1.4 NA oil objective.
Patient and control myoblasts were plated at 105 cells per well in 6-well plates on glass coverslips. Cells were grown in proliferation medium until 70-80% confluence, when they were fixed and processed as above for Lc3 immunostaining. Another set of plates was allowed to reach 100% confluence, when they were switched to differentiation medium for
six days. Afterwards, cells were also fixed and processed as described for muscle biopsy sections. The images obtained from two independent experiments were analysed with ImageJ software to determine the intensity of Lc3 positive puncta per area.
4. Drug treatments
Control myoblasts were treated with 1µM of Rapamycin (Sigma-Aldrich) diluted in proliferation medium for 24 hours, cells were then detached with Trypsin (Gibco) and centrifuged at 300g for 10 minutes at 4oC. The cell pellets were washed with 1X PBS (Gibco) and centrifuged once more. The resulting cell pellet was used for protein extraction. These cells were used as a positive control for the expression of autophagic proteins.
Control and patient myoblasts and myotubes were incubated with 60µM of Chloroquine (Abcam) diluted in proliferation or differentiation medium for 24 hours. Cells were collected as described above and the cell pellet was processed for protein extraction.
5. RNA analysis
The obtained cell pellets were used for total RNA extraction using the TRIzol protocol (Invitrogen). The obtained RNA was solubilized in RNase-free water (Ambion™) and quantified in a Nanodrop spectrophotometer (Thermo Fisher Scientific). cDNA synthesis was performed using 1µg of total RNA according to the M-MLV protocol (Invitrogen). Specific sets of primers were used for the analyses of autophagic and myogenic genes and TBP was used as an endogenous control (Table 1). Real-time PCR was performed in duplicates using the FastStart Universal SYBR Green Master Rox (Roche) on a thermocycler 7500 Fast (Applied Biosystems). The fold-change was obtained by the 2-ΔΔCT method, with TBP and the control myoblasts as normalizers for autophagic genes, and the respective undifferentiated samples for myogenic genes.
Table 1 – Primer sequences
Gene Forward sequence Reverse sequence Reference
TBP TGCACAGGAGCCAAGAGTGAA CACATCACAGCTCCCCACCA (Masilamani
et al., 2014)
BNIP3 GCCCACCTCGCTCGCAGACAC CAATCCGATGGCCAGCAAATGAGA (Zeng e
Kinsella, 2010)
LC3B GAACGATACAAGGGTGAGAAGC AGAAGGCCTGATTAGCATTGAG (Rothe et
al., 2014)
VPS34 AAGCAGTGCCTGTAGGAGGA TGTCGATGAGCTTTGGTGAG (Itakura et
al., 2008)
ATG12 TTGTGGCCTCAGAACAGTTG CCATCACTGCCAAAACACTC (Rothe et
al., 2014)
BECLIN1 TGTCACCATCCAGGAACTCA CTGTTGGCACTTTCTGTGGA (Itakura et
al., 2008)
MYF5 CTCAGCAGGATGGACGTGAT TATGCAGGAGCCGTCGTA
MYOD TGCCACAACGGACGACTTC CGGGTCCAGGTCTTCGAA
MYOG CAGTGCCATCCAGTACATCG AGGTTGTGGGCATCTGTAGG
6. Protein analysis
Cell pellets were homogenized in RIPA buffer (Sigma-Aldrich) supplemented with 1% of protease and phosphatase inhibitors (Sigma-Aldrich). Samples were kept on ice for 30 minutes and afterwards centrifuged at 16.000g for 20 minutes at 4°C, followed by protein quantification by the bicinchoninic acid assay (Pierce, Thermo Fisher Scientific). Homogenized samples were separated by SDS-PAGE, and transferred to nitrocellulose membranes (Amersham Pharmacia). The obtained membranes were probed using the antibodies: 4E-BP1 (9644), phospho-4E-BP1 (2855), S6 (2317), phospho-S6 (2215), p62 (5114), Lc3 (3868), all from Cell Signaling Technology, Beclin1 (sc-11427, Santa Cruz Biotechnology) and α-tubulin (T5168, Sigma-Aldrich). Each protein was analysed in a separate membrane, with the exception of p62 and Lc3-II, which were studied in the same one. The membranes were then incubated with the appropriated secondary horseradish peroxidase-conjugated anti-rabbit or anti-mouse antibodies (Thermo Fisher Scientific) and revealed using the Novex™ ECL Chemiluminescent Substrate Reagent kit (Invitrogen). For the reaction with the endogenous control, membranes were stripped with a stripping buffer (Thermo Fisher Scientific) and reprobed for α-tubulin analysis. Bands were quantified by densitometry using the software ImageJ.
7. Flow cytometry analysis
Myoblasts from both control and patient were seeded in a density of 2,5x105 cells per 75cm2 and grown in proliferation medium until they reach 70-80% confluence. Cells were detached using Trypsin (Gibco) and 106 cells from each line were stained by incubating cells at 37oC with 250nM MitoTracker Red FM (M22425, Invitrogen) or 50nM LysoTracker Red DND-99 (L7528, Invitrogen), accordingly to manufacturer’s instructions. Cells were then analysed by a flow cytometer Aria (BD Biosciences) in three independent experiments. For mean fluorescence intensity determination, the software FlowJo was used.
8. Fusion index
Myoblasts from the XMEA patient and control were plated at 105 cells per well in 6- well plates on glass coverslips. Cells were grown in proliferation medium until they reached 100% confluence, when they were switched to differentiation medium for three or six days. Myotubes were fixed with 2% paraformaldehyde for 20 minutes, followed by permeabilization with 1x TBS with 0,1% Triton™X-100 (Sigma-Aldrich) for 30 minutes and blocking in 1x TBS with 1% fetal bovine serum (Gibco) and 0,1% Triton™X-100 (Sigma- Aldrich) for 30 minutes at room temperature. Cells were then incubated with an antibody for myosin heavy chain (MF-20, Developmental Studies Hybridoma Bank) overnight at 4oC, followed by three washes with with 1x TBS with 0,1% Triton™X-100 (Sigma-Aldrich) and incubation with a secondary mouse antibody conjugated to AlexaFluor 488 (11001, Invitrogen) and washed again. Slides were mounted with Vectashield® Mounting Media (Vector) with DAPI. Images were obtained in a Zeiss LSM-800 confocal system with a EC- Plan Neofluar 20X/0.5.
The fusion index was calculated as the number of nuclei inside myotubes/total number of nuclei, as measured from five fields at 20x magnification. Three independent experiments were quantified for patient-derived and control myotubes, in both three and six days after switch to differentiation medium.
9. Statistical analysis
Data were expressed as mean value ± S.D. Differences between each control and patient and between myoblasts and myotubes were assessed by either Mann-Whitney test or Unpaired t-test using the software GraphPad Prism. A p-value <0.01 was considered significant.
Results
Muscle biopsy from the XMEA patient: Vacuolation and Lc3-positive puncta are prominent in histological analysis
To assess if the obtained muscle biopsy from the first Brazilian patient diagnosed with XMEA is compatible with the pathology of the disease, we firstly looked into sections stained with hematoxylin-eosin (HE). It is notable the presence of vacuoles inside muscle fibers, as observed by the darker spots with a particularly large vacuole in Figure 1. In the HE staining, it is also possible to observe variation of fiber calibres, which is indicative of muscle pathology. Those vacuoles were confirmed as being autophagic by immunostaining for Lc3 protein, which is present in the membranes of autophagosomes. In this case, accumulation of Lc3-positive puncta is observed in the XMEA muscle biopsy but not in the control biopsy (Figure 2).
Figure 1 Hematoxylin-eosin staining of a muscle biopsy section of a XMEA patient in which vacuoles
can be observed inside muscle fibers. In the white arrow, a particularly large vacuole is highlighted. Magnification of 20x, light microscopy.
Figure 2 Lc3 immunostaining in a muscle biopsy of (A) control and (B) XMEA patient, with a
remarkable accumulation of Lc3-positive puncta in the patient muscle. Magnification of 63x, confocal microscopy.
Progenitor muscle cells with mutation in the XMEA gene: Preservation of proliferation and differentiation capacities
Since the patient has indeed the characteristic pathology of XMEA, we isolated progenitor muscle cells from his biopsy. Myoblasts were successfully obtained, and to generate a cellular model for this disease we immortalized those cells. The immortalization was successful and the cells retained their ability to proliferate and to form myotubes (Figure 3).
Figure 3 Representative images of control and patient cells in day 0 – undifferentiated and in day 3
Lc3 protein levels tends to be higher in myoblasts than myotubes and the opposite is found for its gene expression
We firstly investigated whether the expected alterations in autophagy with the disease were present in the initial steps of muscle formation. We found that there is a tendency of increased number of Lc3-positive puncta in myoblasts than myotubes after six days of differentiation. However, no distinctions could be observed between control and patient cells (Figure 4).
Figure 4 Increased number of Lc3-positive puncta in myoblasts. (A) Representative images of control and patient myoblasts and myotubes immunostained for Lc3. (B) A tendency is observed of higher Lc3-postive puncta in myoblasts than myotubes after six days of differentiation, however, no statistical significance was found. Magnification of 63x, confocal microscopy. Red – Lc3, blue – DAPI.
The same results were observed in the analysis of Lc3-II, the membrane-bound form of Lc3 protein by Western blotting. A trend to increased levels of this protein was observed in myoblasts when compared to myotubes, both in control and patient cells (Figure 5).
Interestingly, after chloroquine treatment, which blocks later stages of lysosomal degradation, the levels of Lc3-II were further increased in myotubes, also in both cell lines (Figure 5). This fact demonstrates that myotubes might have an increased autophagic flux, which is more evident after lysosomal degradation inhibiton, resulting in accumulation and higher levels of the Lc3-II protein
Figure 5 Increased levels of Lc3-II protein in myoblasts. (A) Representative images of Western
Blotting, (B) Densitometric quantification showed a tendency of higher Lc3-II levels in myoblasts. After treatment with chloroquine, there is further accumulation in myotubes but not myoblasts.
When analysing LC3 gene expression, we could find an inverse situation, with a trend to an increase in its expression with differentiation, in both control and patient’s cells, which would be compatible with the results after chloroquine inhibition (Figure 6).
Figure 6 A trend to an increased LC3 gene expression with differentiation was found in both control
and patient cells.
Lysosomal and mitochondrial number are not altered in XMEA cells
Since our previous results showed an increased Lc3-II expression in XMEA myoblasts before chloroquine treatment, which could be related to a change in autophagic levels, we looked into lysosomes and mitochondria, considering that those organelles are the final site in autophagy and a substrate for degradation, respectively. In this sense, no distinctions were observed between control and XMEA myoblasts (Figure 7).
Figure 7 No alterations were found in lysosomal and mitochondrial content in XMEA cells. (A) Flow
cytometry analysis of cells marked with Lysotracker, (B) Mean Fluorescence Intensity analysis show a similar number of lysosomes stained with Lysotracker in both control and patient, (C) Flow cytometry analysis of cells marked with Mitotracker, (D) Mean Fluorescence Intensity analysis show a similar number of mitochondria stained with Mitotracker in both control and patient.