H. Toxinas
H.3. Toxinas Citotoxinas ou Enterotoxinas
IV. RESULTADOS E DISCUSSÃO
4. Avaliação da citotoxicidade em células Vero
A citotoxicidade in vitro é uma propriedade importante nas espécies mesofílicas móveis de Aeromonas, como é o caso de A. hydrophila. A utilização das células VERO para este tipo de ensaios, em relação a outras linhas celulares, tem apresentado vantagens, nomeadamente por ser mais sensível aos extractos celulares microbianos de Aeromonas spp. (Ghatak et al., 2006).
Neste sentido, foi estabelecida a cultura e o crescimento celular foi permitido até atingir uma confluência de cerca de 80%. As células em cultura foram posteriormente expostas a diluições sucessivas (1:2) de sobrenadante filtrados de culturas frescas de Aeromonas hydrophila até 48 horas. Procedeu-se ao estudo das alterações morfológicas das culturas, por microscopia de transmissão. Na figura 14 é possível visualizar o efeito de destacamento das células da superfície de crescimento e a perda da forma característica das células desta linha celular.
Figura 14 – Aspecto morfológico de células Vero em cultura:
A) Controlo – células mantidas em meio DMEM; B) e C) Células Vero expostas a diluições sucessivas de A. hydrophila numa diluição de 1/2 e 1/64, respectivamente. Barra de escala=150µm.
Durante o tempo de exposição, foi possível verificar, progressivamente, que as células vão ficando redondas e de tamanho mais reduzido, acabando por se desprender da superfície de crescimento (característcas da perda de viabilidade). Com o aumento gradual da concentração dos produtos extracelulares de A. hydrophila, verificou-se claramente o decréscimo do número de células aderentes e o aumento do número de células em suspensão (Fig. 14). Paralelamente, a viabilidade foi avaliada pelo método da resazurina (DeWitte-Orr e Bols, 2005) e os resultados estão representados no gráfico da Fig. 15. Pode verificar-se uma diminuição da actividade metabólica das células que é proporcional ao aumento da concentração dos produtos extracelulares da A. hydrophila. Do mesmo modo, foi avaliado o efeito dos produtos de E. coli BL21 (DE3) sobre as células Vero e os resultados podem ser analisados no gráfico da Fig. 15.
Figura 15 – Viabilidade de células Vero expostas a sobrenadantes de culturas frescas de A. hydrophila (diluições 1/2 , 1/32 e 1/64) e E. coli BL21(DE3) (diluições 1/2 , 1/32 e 1/64).
As células foram incubadas com resazurina, tal como descrito no ponto 17 do Material e Métodos. Os resultados demonstraram que para além da análise da morfologia das culturas, a monitorização da viabilidade celular através de testes metabólicos constitui uma ferramenta fundamental para avaliar o efeito dos extractos das células transformadas ou mesmo para testar a citotoxicidade da colagenase recombinante, futuramente obtida.
V.
CONCLUSÕES
93 Os resultados obtidos com o desenvolvimento deste trabalho permitiram concluir:
1. A actividade colagenolítica de A. hydrophila CECT 839T, sugerida pelos estudos in silico, foi confirmada in vitro.
2. A abordagem utilizada permitiu a clonagem e expressão do gene AHA_0517. No entanto, o sistema de expressão utilizado não foi adequado para os objectivos propostos. Nas condições testadas, a proteína recombinante foi expressa em quantidades inferiores ao esperado e nem sempre foi detectada actividade.
3. Foram estabelecidas com sucesso as condições de cultura de células Vero para testar a citotoxicidade de extractos de A. hydrophila CECT 839T e E. coli
VI.
PERSPECTIVAS FUTURAS
Os resultados obtidos durante a execução deste trabalho permitem abrir algumas perspectivas para o trabalho futuro:
Proceder a nova clonagem do gene AHA_0517, tendo em conta a purificação da proteína recombinante;
Avaliar a citotoxicidade da proteína codificada pelo gene AHA_0517, de modo a verificar se esta poderá contribuir para a virulência A. hydrophila;
Aplicação do método estabelecido neste trabalho, na caracterização do potencial de virulência de outras colagenases microbianas em isolados clínicos ou ambientais.
Todas estas linhas de investigação permitirão um melhor conhecimento dos mecanismos de virulência de microrganismos do género Aeromonas, que podem, eventualmente, contribuir para a clarificação dos mecanismos de patogénese em geral.
VII.
BIBLIOGRAFIA
101 Abbas N., Ahmad A., Shakoori A.R. (2007). Overexpression and purification of preS region of hepatitis B virus antigenic surface protein adr subtype in Escherichia coli. Journal of Biochemistry and Molecular Biology. 40:1002-1008.
Abe T., Takahashi S., Fukuuchi Y. (2002). Reduction of alamar blue, a novel redox indicator, is dependent on both the glycolytic and oxidative metabolism of glucose in rat cultured neurons. Neuroscience Letters. 326:170-182.
Azevedo C. (2005). Matriz extracelular, p.77-79. In Biologia celular e molecular. 4ª edição. Lidel.
Baneyx F. (1999). Recombinant protein expression in Escherichia coli. Current Opinion in Biotechnology. 10:411-421.
Bi Z.X., Liu Y.J., Lu C.P. (2007). Contribution of AhyR to virulence of Aeromonas hydrophila J-1. Research in Veterinary Science. 83:150-156.
Boijink C.L. e Brandão D.A. (2001). Alterações histológicas e comportamentais provocadas pela inoculação de suspensão bacteriana (Aeromonas hydrophila) em juvenis de Jundiá (Rhambia quelen). Revista Ciência Rural. 31:687-690.
Bonomo J. e Gill R.T. (2004). Amino acid content of recombinant proteins influences the metabolic burden response. Biotechnology and Bioengineering. 90:116- 126.
Brock T., Madigan M., Martinko J., Parker J. (1994). Biology of microorganisms. 7ª edição. Prentice-Hall. London.
Butler M. e Dawson M. (1992). In: Cell culture LABFAX. Academic Press. San Diego.
Carnahan, A. e Joseph S. (2005). Aeromonadaceae. In Brenner D., Krieg N., Staley J., Garrity G. (eds.). The Proteobacteria, Part B, Bergey’s Manual of Systematic Bacteriology, 2ª edição, Volume 2, Springer-Verlag, New York.
Cascón A., Yugueros J., Temprano A., Sánchez M., Hernanz C., Luengo J.M., Naharro G. (2000). A major secreted elastase is essential for pathogenicity of Aeromonas hydrophila. Infection and Immunity. 68:3233-3241.
Chang T., Liu C., Chang M. (1997). Cloning and sequence analysis of the gene (eprA1) encoding an extracellular protease from Aeromonas hydrophila. Gene. 199:225-229
Cipriano R.C. (2001). Aeromonas hydrophila and motile aeromonad septicemias of fish. Fish Disease Leaflet. 68.
Costa A.B. (2003). Caracterização de bactérias do complexo Aeromonas isoladas de peixes de água doce e sua actividade patogénica. Universidade de Piricicaba. Estado de São Paulo. Brasil.
Colwell, R.R., MacDonnel, M.T. e De Ley, J. (1986). Proposal to recognize the family Aeromonadaceae fam.nov. International Journal of Systematic Bacteriology. 36:473.
DeWitte-Orr S.J. e Bols N.C. (2005). Gliotoxin-induced cytotoxicity in three salmonid cell lines: cell death by apoptosis and necrosis. Comparative Biochemistry and Physiology. 141:157-167.
Dong H., Nilsson L., Kurland C. (1995). Gratuitous overexpression of genes in Escherichia coli leads to growth inhibition and ribosome destruction. Journal of Bacteriology. 177:1497-1504.
Duarte, A.S. (2001). Utilização de uma enzima vegetal na prevenção de fibroses e aderências. Departamento de Biologia. Universidade de Aveiro.
Duarte A.S., Pereira A.O., Cabrita A.M., Moir A.J., Pires E.M., Barros M.M. (2005). The characterisation of the collagenolytic activity of cardosin A demonstrates its potencial application for extracellular matrix degradative processes. Current Drug Discovery Technologies. 2:37-44.
Dubendorff J. e Studier F. (1991). Controlling basal expression in an inducible T7 expression system by blocking the target T7 promoter with lac repressor. Journal Molecular Biology. 219:45-59
Edberg S., Browne F., Allen M. (2007). Issues for Microbial Regulation: Aeromonas as a Model. Critical Rewiews in Microbiology. 33: 89-100.
EPA (Health and Ecological Criteria Division Office of Science and Technology Office of Water United States Environmental Protection Agency) (2006). Aeromonas: human health criteria document. Washington. USA.
103 Fonseca M. (2005). Sobreexpressão e purificação da carbapenemase SFC-1 produzida por um isolado de Serratia fonticola. Departamento de Biologia. Universidade de Aveiro.
Gartner L.P. e Hiatt J.L. (1997). Color textbook of histology. W.B. Saunders Company.
Ghatak S., Agarwal R., Bhilegaonkar K. (2006). Comparative study of cytotoxicity of Aeromonas spp. on four different cell lines. Comparative Immunology, Microbiology & Infectious Diseases. 29:232-240.
Gonzales T. e Robert-Baudouy J. (1996). Bacterial aminopeptidases: properties and functions. FEMS Microbiology Reviews 18:319-344.
González-Serrano C., Santos J., García-López M., Otero A. (2002). Virulence markers in Aeromonas hydrophila and Aeromonas veronii biovar sobria from freshwater fish and from a diarrhoea case. Journal of Applied Microbiology. 93: 414- 419.
Harrington D.J. (1996). Bacterial collagenases and collagen-degrading enzymes and their potential role in human disease. Infection and Immunity. 64:1885-1891. Han H.J., Taki T., Kondo H., Hirono I., Aoki T. (2008). Pathogenic potential of a collagenase gene from Aeromonas veronii. Canadian Journal of Microbiology. 54:1- 10
Jackson R.J., Dao M.L., Lim D.V. (1995). Modified FALGPA assay for cell- associated collagenolytic activity. Journal of Microbiological Methods. 21:209-215. Jackson R.J., Lim D.V., Dao M.L. (1997). Identification and analysis of a collagenolytic activity in Streptococcus mutans. Current Microbiology. 34:49-54. Janda J. e Abbott S. (1998). Evolving concepts regarding the genus Aeromonas: an expanding panorama of species, disease presentations, and unanswered questions. Clinical Infectious Diseases 27:332-344.
Janda J. (2002). Aeromonas and Plesiomonas p.1237-1270. In Sussman, M. (ed.) Molecular Medical Microbiology. Academic Press. San Diego.
Jeppesen C. (1995). Media for Aeromonas sp., Plesiomonas shigelloides, and Pseudomonas spp. from food and environment. International Journal of Food Microbiology. 26:15-41.
Jonasson P., Liljeqvist S., Nygren P., Stahl S. (2002). Genetic design for facilitated production and recovery of recombinant proteins in Escherichia coli. Biotechnology and Applied Biochemistry. 35:91-105.
Khushiramani R., Girisha S., Karunasagar I., Karunasagar I (2007). Cloning and expression of an outer membrane protein ompTS of Aeromonas hydrophila and study of immunogenicity in fish. Protein Expression and Purification. 51:303-307. Kim S., Yang J., Cha J. ( 2002). Cloning and sequence analysis of a novel mettaloprotease gene from Vibrio parahaemolyticus 04. Gene. 283:277-286.
Kirov S., Ardestani E., Hayward L. (1993). The growth and expression of virulence factors at refrigeration temperature by Aeromonas strains isolated from foods. International Journal of Food Microbiology 20:159-168.
Kirov S., Tassell B., Semmler A., Donovan L., Rabaan A., Shaw J. (2002). Lateral flagella and swarming motility in Aeromonas species. Journal of Bacteriology 184:547-555.
Laemmli U.K. (1970). Cleveage of structural proteins during the assembly of the head of bacteriophage T4. Nature. 227: 680-685.
Leber T.M. e Balkwill F. (1997). Zymographic: a single-step staining method for quantitation of proteolytic activity on substrate gels. Analytical Biochemistry. 249:24-28.
Lodish H., Berk A., Zipurshy S., Matsudaira P., Baltimore D., Darnell J. (2000). Integrating cells into tissues, p.979-985. In Molecular cell biology. 4ª edição. W.H. Freeman and Company.
Liu Y. e Bi Z. (2007). Potencial use a transposon Tn916-generated mutant of Aeromonas hydrophila J-1 defective in some exoproducts as a live attenuated vaccine. Preventive Veterinary Medicine. 78:79-84.
MacLennan J., Mandl I., Howers E. (1953). Bacterial digeston of collagen. The Journal of Clinical Investigation. 32:1317-1322.
105 Madetoja J., Pylkko P., Pohjanvirta T., Schildt L., Pelkonen S. (2003). Putative virulence factores of atypical Aeromonas salmonicida isolated from Arctic charr, Salvelinus alpinus (L.), and European grayling, Thymallus thymallus (L.). Journal of Fish Diseases. 26: 349-359.
Makowski G., Ramsby M. (2003). Zymographic analysis of latent and activated forms of matrix metalloproteinase-2 and -9 in synovial fluid: correlation to polymorphonuclear leukocyte infiltration and in response to infection. Clinica Chimica Acta. 329:77-81.
Mather J. e Roberts P. (1999) Introduction to Cell Culture - Theory and Technique, Plenum Press.
Martins L., Catani C., Falcón R., Carbonell G., Azzoni A., Yano T. (2007). Induction of apoptosis in Vero cells by Aeromonas veronii biovar sobria vacuolating cytotoxic factor. FEMS Immunology Medical Microbiology. 49: 197-204.
Matsushita O., Yoshihara K., Katayama S., Minami J., Okabe A. (1994). Purification and characterization of a Clostridium perfringens 120-kilodalton collagenase and nucleotide sequence of the corresponding gene. Journal of Bacteriology.176:149-156.
Matsushita O., Jung C-M., Katayama S., Minami J., Takahashi Y., Okabe A. (1999). Gene duplication and multiplicity of collagenases in Clostridium histolyticum. Journal of Bacteriology.183:923-933.
Merino S., Aguilar A., Rubires X., Simon-Pujol D., Congregado F., Tomas J. (1996). The role of the capsular polysaccharide of Aeromonas salmonicida in the adherence and invasion of fish cell lines. FEMS Microbiology Letters 142:185-189. Miller E. e Gay S. (1987). The collagens: An overview and update. Methods Enzymology.144:3-41.
Miyoshi S. e Shinoda S. (1997). Bacterial metalloprotease as the toxic factor in infection. Journal Toxicology – Toxin Reviews.16:177-194.
Nakayama G.R., Caton M.C., Nova M.P. e Parandoosh Z. (1997). Assessment of the alamar blue assay for cellular growth and viability in vitro. Journal of Immunology Methods. 204:205-208.
Nishikawa Y., Hase A., Ogawasara J., Scotland S., Smith H., Kimura T. (1994). Adhesion to and invasion of human colon carcinoma Caco-2 cells by Aeromonas strains. Journal of Medical Microbiology. 40:55-61.
Novagen (2006). pET system manual. Madison, Wi :Novagen.
O’Brien J., Wilson I., Orton T., Pognan F. (2000). Investigation of the alamar blue (resazurin) fluoresecent dye for the assessment of mammalian cell cytotoxicity. European Journal of Biochemistry. 267:5421-5426.
Palumbo, S. (1996). The Aeromonas hydrophila group in food, p.39-76. In: Austin B., Altwegg M., Gosling P., Joseph S. (eds.). The Genus Aeromonas. John Wiley & Sons. New York.
Paniagua C., Rivero O., Anguita J., Naharro G. (1990). Pathogenicity factors and virulence for rainbow trout (Salmo gairdneri) of motile Aeromonas spp. isolated from a river. Journal of Clinical Microbiology. 28:350-355.
Parks D., Bryan V., Oi V., Herzenberg, L. (1979). Antigen-specific identification and cloning of hybridomas with a fluorescence-activated cell sorter. Procedings National Academy Sciences USA. 76:1962–1966.
Pemberton J., Kidd S., Schmidt R. (1997). Secreted enzymes of Aeromonas. FEMS Microbiology Letters. 152: 1-10.
Peterkofsky B. (1982). Bacterial collagenase. Methods Enzymology. 83: 453-471. Prockop D.J. e Kivirikko K.I. (1995). Collagens: molecular biology, diseases and potentials for therapy. Annual Reviews of Biochemistry. 64:403-434.
Rainbow L., Wilikinson M.C., Sargent P.J., Hart C.A., Winstanley C. (2004). Identification and expression of a Burkholderia pseudomallei collagenase in Escherichia coli. Current Microbiology. 48:300-304.
Ravanti L. e Kahari V.M. (2000). Matrix metalloproteases in wound repair. International Journal of Molecular Medicine. 6:391-407.
Robertis E.De e Robertis Jr.E.M.De (1996). O citoesqueleto e a mobilidade cellular, p. 272-274. In Biologia celular e molecular. Serviço de Educação Fundação Calouste Gulbenkian. Lisboa.
107 Sambrook J., Fritsch E., Maniatis T. (1990). Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory Press. Cold Spring Harbor, New York. Sasagawa Y., Izaki K., Matsubara Y., Suzuki K., Hojima H., Kamio Y. (1995). Molecular cloning and sequence analysis of the gene encoding the collagenase from Cytophaga sp. L43-1 strain. Biosciences Biotechnology and Biochemistry. 59:2068-2073.
Seshadri R., Joseph S., Chopra A., Sha J., Shaw J., Graf J., Half D., Wu M., Ren Q., Rosovitz M., Madupu R., Tallon L., Kim M., Jin S., Vuong H., Stine O., Ali A., Horneman A., Heidelberg J. (2006). Genome sequence of Aeromonas hydrophila ATCC 7966T: Jack of all trades. Journal of Bacteriology. 188: 8272-8282.
Singh, D. e Sanyal S. (1992). Enterotoxicity of clinical and environmental isolates of Aeromonas spp. Journal of Medical Microbiology. 36:269-272.
Springman E., Angleton E., Birkedal-Hansen H, Van Wart H. (1990). Multiple modes of activation of latent human fibroblast collagenase: evidence for the role of a Cys73 active-site zinc complex in latency and a "cysteine switch" mechanism for activation. Procedings of National Academy of Sciences U S A. 87:364-8.
Sorensen H.P. e Mortensen K.K. (2005). Advanced genetic strategies for recombinant protein expression in Escherichia coli. Journal of Biotecnhology. 115:113- 128.
Southern E. (1975). Detection of specific sequences among DNA fragments separated by gel-electrophoresis. Journal Molecular Biology. 98:503-517.
Snyder L. e Campness W. (2003). Molecular genetics of bacteria . 2ª edição. ASM Press. Washington, D.C.
Spehr V., Frahm D. e Meyer T.F. (2000). Improvement of the T7 expression system by use of T7 lysozyme. Gene. 257:259-267.
Studier, F.W. e Moffatt B.A. (1986). Use the bacteriophage T7 RNA polymerase to direct selective hight-level expression of cloned genes. Journal of Molecular Biology. 189:113-130.
Studier, F.W., Rosenberg A.H., Dunn J.J., Dubendorf J.W. (1990). Use of T7 RNA polymerase to direction expression of cloned genes. Methods Enzymology. 185:60- 89.
Swartz J.R. (2001). Advances in Escherichia coli production of therapeutic proteins. Current Opinion in Biotechnology. 12:195-201.
Tacão M. (2003). Caracterização molecular de estirpes de Aeromonas spp. resistentes a antibióticos beta-lactâmicos. Departamento de Biologia. Universidade de Aveiro.
Teich A., Lin H., Andersson L., Meyer S., Neubauer P. (1998). Amplification of ColE1 related plasmids in recombinant cultures of Escherichia coli after induction. Journal of Biotechnology. 64:197-210.
Trower C., Abo S., Majeed K., Itzstein M. (2000). Production of an enterotoxin by a gastro-enteritis-associated Aeromonas strain. Journal of Medical Microbiology 49:121-126.
Tsai G-J., Tsai F-C., Kong Z-L. (1997). Effects of temperature, medium composition, pH, salt and dissolved oxygen on haemolysin and cytotoxin production by Aeromonas hydrophila isolated from oyster. International Journal of Food Microbiology. 38:111-116.
Tso M. e Dooley J. (1995). Temperature-dependent protein and lipopolysaccharide expression in clinical Aeromonas isolates. Journal of Medical Microbiology. 42:32-38.
Tsuruoka N., Nakayama T., Ashida M., Hemmi H., Nakao M., Minakata H., Oyama H., Oda K., Nishino T. (2003). Collagenolytic serine-carboxyl proteinase from Alicylobacillus sendaiensis strain NTAP-1: purification, characterization, gene cloning and heterologous expression. Applied and Environmental Microbiology. 69:162-169.
Videira A. (2001). Vectores de clonagem, p.39-46. In Videira A. Engenharia genética princípios e aplicações. Lidel. Lisboa.
Yaron S., Kolling G., Simon L., Mattews K. (2000). Vesicle-mediated transfer of virulence genes from Escherichia coli 0157:H7 to other enteric bacteria. Applied and Environment Microbiology. 66:4414-4420.
Yokoyama S. (2003). Protein expression systems for structural genomics and proteomics. Current Opinion. 7:39-43.
109 Yu M. e Lee C. (1999). Expression and characterization of the prtV gene encoding a collagenase from Vibrio parahaemolyticus in Escherichia coli. Microbiology. 145:143-150.
Zhu D., Li A., Wang J., Li M., Cai T. (2007). Cloning, expression and characterization of aerolysin from Aeromonas hydrophila in Escherichia coli. Indian
VIII.
ANEXOS
Tabela 2: Genoespécies e Fenoespécies Actuais do género Aeromonas Grupo de
Hibridação de DNA (HG)
Estirpe tipo Genoespecies Fenoespécies Observações
1 ATCC 7966 A. hydrophila A. hydrophila Isolado a partir de
uma lata de leite estragado 1 BCCM/LMG 19562 A. hydrophila subsp. dhakensis A. hydrophila subsp. dhakensis Isolado a partir de amostras clinicas 1 BCCM/LMG 19707 A. hydrophila subsp. ranae A. hydrophila subsp. ranae Patogéncio de sapos
2 ATCC 14715 A. bestiarum A. hydrophila-like Isolado a partir de amostras clinicas
3 ATCC 33658 A. salmonicida A. salmonicida
subsp. salmonicida
Patogénico imóvel de peixe
3 ATCC 33659 A. salmonicida A. salmonicida
subsp. achromogenes
Patogénico imóvel de peixe
3 ATCC 27013 A. salmonicida A. salmonicida
subsp. masoucida
Patogénico imóvel de peixe
3 ATCC 49393 A. salmonicida A. salmonicida
subsp. smithia
Patogénico imóvel de peixe
3 CDC 0434-84, Popoff
C316
unnamed A. hydrophila-like Isolados a partir de amostras clínicas
4 ATCC 15468 A. caviae A. caviae Isolados a partir de
amostras clínicas
5A CDC 0862-83 A. media A. caviae-like Isolados a partir de
amostras clínicas
5B CDC 0435-84 A. media A. media
6 ATCC 23309 A. eucrenophila A. eucrenophila
7 CIP 7433, NCMB
12065
A. sobria A. sobria
8X CDC 0437-84 A. veronii A. sobria
8Y ATCC 9071 A. veronii A. veronii biovar
sobria
Isolados a partir de amostras clínicas
9 ATCC 49568 A. jandaei A. jandaei Isolados a partir de
amostras clínicas
10 ATCC 35624 A. veronii biovar
veronii A. veronii biovar veronii Isolados a partir de amostras clínicas ornitina decarboxilase positiva
11 ATCC 35941 unnamed Aeromonas spp.
amostras clínicas
13 ATCC 43946 Aeromonas Group
501
A. schubertii-like Isolados a partir de amostras clínicas
14 ATCC 49657 A. trota A. trota Isolados de
amostras clínicas, susceptíveis a ampicilina 15 ATCC 51208, CECT 4199 A. allosaccharophila A. allosaccharophila
16 ATCC 51020, A. encheleia A. encheleia Patogéncio de
enguias
17 BCCM/LMG 1754 A. popoffii A. popoffii
Unassegned MTCC 3249, NCIM 5147
A. culicicola A. culicicola Isolado a partir de mosquitos
ATCC- Colecção Americana de Culturas Tipo, Rockford, MD; BCCM/LGM – Colecção Bactéria, Ghent University, Belgium; CDC- Centro de Prevenção e Controlo de Doenças; CIP – Colecção do Instituto Pasteur, Paris, França; NCMB – Colecção Nacional de Bactérias Marinhas, Aberdeen, Escócia; CECT – Colecção Espanhola de Culturas Tipo, Universidade de Valencia, Valencia, Espanha; CCUG – Colecção Cultura, Universidade de Gotenborg, Gotenborg, Suécia; MTCC – Colecção Microbiológica de Culturas Tipo , Instituto de Tecnologia Microbiológica, Chandigarh, Índia; NCIM – Laboratório Químico Nacional, Pune, Índia
Tabela 3: Factores de Virulência de espécies de Aeromonas spp.
Factores de Virulência estruturais Factores de Virulência extracelulares
Pili (fimbrías) Hemolisinas
Flagelos Enterotoxinas
Proteínas membranares externas (OMP) Citotoxinas
Camada A ou S Proteases
Lipopolissacarídeos Glicerofosfolipido colesterol acetiltransferase (GCAT)
Cápsula Outras enzimas hidrolíticas
Tabela 4 :Enzimas Extracelulares secretadas por Aeromonas spp.
Enzima Actividade Abreviatura Tamanho (kDa) Fonte
Aminopeptidase Prolil Pap 48 A .veronii br sobria
α-amilase AmyA 49 A. hydrophila
α-amilase AmyA 48 A. hydrophila
Amilase
α-amilase AmyB 72 A. hydrophila
metalo-β- lactamase CphA 28 A. hydrophila
metalo-β- lactamase CphA2 28 A. hydrophila
metalo-β- lactamase ImiS 28 A. veronii br sobria
Cefalosporinase CepS 38 A. veronii br sobria
β-lactamase
Penicilinase AmpS 27 A. veronii br sobria
Toxina celular prolongada
70 A. hydrophila
Grupo A ChiA 94 A. caviae
Grupo B ChiIII 53 A. hydrophila
Grupo B ORF-3 57 10S-24
Quitinase
Grupo C ChiIII 5 10S-24
Citolitica Ahh1 52 A.hydrophila
Enterotoxina
Citotonica 35 A.hydrophila
α-hemolisina Ahh5 54 A. hydrophila
α-hemolisina Asa1 54 A. veronii br sobria
Aerolisina AerA 57 A. hydrophila
Aerolisina Ahh3 54 A. hydrophila
Aerolisina 54 A. salmonicida
Aerolisina 62 A. salmonicida
Hemolisina
Aerolisina 65 A. salmonicida
acetilcoline esterase 15-5 A. hydrophila
Glicerofosfolipido colesterol acetiltransferase GCAT 31 A. hydrophila Glicerofosfolipido colesterol acetiltransferase GCAT 26 A. salmonicida Lipase H3 72 A. hydrophila Lípase
Fosfolipase Apl1 73 A. hydrophila
DNAse Dns 25 A. hydrophila
DNAse Nuch 110 A. hydrophila
Nuclease
RNAse RNAse A 24 A. hydrophila
Carbohidrate reactivo CROMP 40 A. hydrophila Carbohidrate reactivo CROMP 43 A. hydrophila
Maltoporina LamB 49 A. salmonicida
Porina 28 A. salmonicida
Porina OmpA1 36 A. salmonicida
proteína I 47 A. hydrophila
Porina
proteína IV 27 A. hydrophila Protease
fibrinolitica
87,5 A. salmonicida
metalo caseinase AsaP1 20 A. salmonicida
metalo proteases P2 20 A. salmonicida
protease serínica P1 70 A. salmonicida
protease serinica AspA 67 A. salmonicida
Protease
protease de zinco Ahp 19 A. hydrophila
Receptor siderosforo
Siderosforo férrico FstA 86 A. salmonicida
Ferro 50 A. salmonicida
Superóxido
dismutase Magnésio 46 A. salmonicida
xilanase I XynA 23 A. caviae
Xilanase
xilanase II 41 A. caviae
Marcadores de Peso Molecular para DNA
Na figura seguinte apresenta-se o tamanho correspondente a cada uma das bandas existentes nos marcadores de peso molecular para DNA utilizados neste trabalho.
ANEXO 5:
Sequência nucleotídica completa do gene AHA_0517 de A. hydrophila ATCC, depositada no NCBI (NC_008570), com a respectiva sequência peptídica.
atgaacaatctgggtaccaggttgctgctgctggcagcaccgggcctgtttgccacttcg M N N L G T R L L L L A A P G L F A T S gcgctggccaactactccccctccgactggcaacagtatcaactcaaaggtgaatccagc A L A N Y S P S D W Q Q Y Q L K G E S S cgtcagctgggagatcgtctcaccgaagtgacctacgagctgagcgcccgcagcggcggc R Q L G D R L T E V T Y E L S A R S G G gccccctatcagcagctgagggtgtatcgccgcttcgactggagcgatgccaacctggct A P Y Q Q L R V Y R R F D W S D A N L A gcgctggcagaacagcagtgcggcgagccgcagctcaagatcgagctgggctggcagatc A L A E Q Q C G E P Q L K I E L G W Q I cgctacctcagctgtgaagaggtggtgccggctggcaaggccgttccggccagcagctat R Y L S C E E V V P A G K A V P A S S Y gactatggctacggcatgaagcagggccgctgggagccactggcaggcaccccgaccgcg D Y G Y G M K Q G R W E P L A G T P T A ccgcgtcaggatcgtctgccgctggcggagcgggtcatcctgggtcacagcgagcaggaa P R Q D R L P L A E R V I L G H S E Q E ctggatcgctgcgagctcaacgccgaaggccgctgcgccgagcaggcatggcagtaccag L D R C E L N A E G R C A E Q A W Q Y Q ccgcaaaactggcagcagttgaaggtgctggaagagacccccaatgaacgggatggccgc P Q N W Q Q L K V L E E T P N E R D G R ctcgagcagatcttcttccgcctgcagcccatcgtgggcagccaggccgccaagcaggtg L E Q I F F R L Q P I V G S Q A A K Q V agcgagctgcacgtctggcgccagtacacctggttgctggaacaagccaagacccagcaa S E L H V W R Q Y T W L L E Q A K T Q Q gagtgcgatgaaccccagacccgtcaggaaggggacaagaccatcagctaccgggtgtgc E C D E P Q T R Q E G D K T I S Y R V C cgccagaccctgcccgccggcagcgaagtgcaggtggtcttgaaggacaccggctatcaa R Q T L P A G S E V Q V V L K D T G Y Q tacccggtggggggcagcgaatggcagaccctgccggaaacaaccgagtggcaggagagc Y P V G G S E W Q T L P E T T E W Q E S cgggtgctcaaccaccccatcgtgctggccagcaaggaagagcagctcgactgtcgccgt R V L N H P I V L A S K E E Q L D C R R gccgacggccgcgcctgttccgagccagatctgccgggcaccgagctgctggacgccgaa A D G R A C S E P D L P G T E L L D A E gcggccaagatagtgcaggatgccagtggccagcctgcgccggtctggcaggagaactat A A K I V Q D A S G Q P A P V W Q E N Y ggtcacgatgacaccaagctgctggccgtgtcgcgcggcatccagagcctgctggcggcc G H D D T K L L A V S R G I Q S L L A A aatcagccggcccatccagccatgaagctgctgctggaatacgtgcgtgcccacaactac N Q P A H P A M K L L L E Y V R A H N Y cacaactacggcaagcacaaggaagacggcccggccgccgccgaggcgctggccgaggcg H N Y G K H K E D G P A A A E A L A E A ttgacggcgctgggcgcccatccgctgctcttcccggagcaggccagcgacgaggttggt L T A L G A H P L L F P E Q A S D E V G gcagtcatgggtgcctggagcatcgccctgcacggtcagttcaagagcccagcagtgcag A V M G A W S I A L H G Q F K S P A V Q agccgctttggcaccctgctcggcgagttcaaccagatgctggcctacagcacccgccat S R F G T L L G E F N Q M L A Y S T R H gccagcgagatcaacggtcagcacgcctgggcaaccggcctgttcgatctgctcaacttc A S E I N G Q H A W A T G L F D L L N F ctcgacttcgccagcgactacagcgaccccttcgccaacgacttccgccaacaggacggt L D F A S D Y S D P F A N D F R Q Q D G
E L R K Q L H A L G M S E L A L W K G R gatggcgccgatctgttcctgctcaacaacgtgctggatgcctacacccgcctctaccgg D G A D L F L L N N V L D A Y T R L Y R gtcgcccgctatacccgcccggacgagctcgacggctatcgcaaactgttggatgactcc V A R Y T R P D E L D G Y R K L L D D S gtcatcgcactggttcgccaccacaacctgatccccggtggccagcagagtcaggatctg V I A L V R H H N L I P G G Q Q S Q D L ctggaagacatgtcactgaccctctccacctactacctgacctacacggaccgcaccagc L E D M S L T L S T Y Y L T Y T D R T S gaggcctgcatcagcggtgacttcgccgggctctgcacccctgtccgggtggaggacgtg E A C I S G D F A G L C T P V R V E D V ctgccgttcgagcacacctgctcgccgaccctgcgcctgcgggcccaggacctgaccatg L P F E H T C S P T L R L R A Q D L T M gatcaggccgaagggatctgccgtgaactgggtgccgaagagcagcagttccatcaacag D Q A E G I C R E L G A E E Q Q F H Q Q atggagaccggctggcagccggtggcggacgatcacaacgaggcgctggaactggtggtc M E T G W Q P V A D D H N E A L E L V V ttcaactcctccgccgactggaaacgctatggcagtgctctgttcggcggcgtctccacc F N S S A D W K R Y G S A L F G G V S T gacaacggcggcatctacctcgaaggggatccggctcgccccggcaaccaggcccgcttc D N G G I Y L E G D P A R P G N Q A R F ttcgcctacgaggcggagtggaagcgcccagcgttccaggtgtggaacctgcgccacgag F A Y E A E W K R P A F Q V W N L R H E tatgtgcactacctggacggccgcttcaaccagtacggcagcttcggccactacccgctc Y V H Y L D G R F N Q Y G S F G H Y P L aaccgcaccacctggtggtcggaagggctggcggagttcatcgcccacggccagtgcttc N R T T W W S E G L A E F I A H G Q C F gcccgcggtctggacaacgtcgccggccgtcctgccagtgatcgtccggccttggccgac A R G L D N V A G R P A S D R P A L A D atcctgcacctggattacgacaagggtggcgagatggtctactcctggtcctacacggtg I L H L D Y D K G G E M V Y S W S Y T V caccgcttcctgaacgaaaccggtcgcggcgccagctggctggccatggcccaggccctg H R F L N E T G R G A S W L A M A Q A L cgcaacccggatcagcagcaggccatgagcaccttcgaagccgagctggaccagctgatt R N P D Q Q Q A M S T F E A E L D Q L I gccaatgacagcgaggcctaccagcagtggctcggccgcgagctgctgccctggtgggaa A N D S E A Y Q Q W L G R E L L P W W E gccaacaaggactccgacgagtgcaaggccaacgactcctcccactga A N K D S D E C K A N D S S H -