• Nenhum resultado encontrado

Effects of ADMA upon gene expression: an insight into the pathophysiological significance of raised plasma ADMA.

N/A
N/A
Protected

Academic year: 2016

Share "Effects of ADMA upon gene expression: an insight into the pathophysiological significance of raised plasma ADMA."

Copied!
13
0
0

Texto

(1)

Effects of ADMA upon Gene Expression:

An Insight into the Pathophysiological

Significance of Raised Plasma ADMA

Caroline L. Smith*, Shelagh Anthony, Mike Hubank, James M. Leiper, Patrick Vallance Centre for Clinical Pharmacology and Therapeutics, Division of Medicine, University College London, London, United Kingdom

Competing Interests:University College London holds patents on DDAH as a drug target (not relevant to the present study).

Author Contributions:CLS, JML, and PV designed the study. CLS, SA, MH, JML, and PV analyzed the data. CLS, MH, JML, and PV contributed to writing the paper.

Academic Editor:Ivor Benjamin, University of Utah, United States of America

Citation:Smith CL, Anthony S, Hubank M, Leiper JM, Vallance P (2005) Effects of ADMA upon gene expression: An insight into the pathophysiological significance of raised plasma ADMA. PLoS Med 2(10): e264.

Received:January 1, 2005 Accepted:June 30, 2005 Published:October 4, 2005

DOI:

10.1371/journal.pmed.0020264

Copyright:Ó2005 Smith et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use,

distribution, and reproduction in any medium, provided the original work is properly cited.

Abbreviations:ADMA, asymmetric dimethylarginine; BMP, bone morphogenetic protein;BMPR1A, bone morphogenetic protein receptor 1A;BMP2K, bone morphogenetic protein 2 inducible kinase; DDAH, dimethylarginine dimethylaminohydrolase; HCAEC, human coronary artery endothelial cells; L-NIO,

L-N5-(1-Iminoethyl)ornithine;mb-actin, murineb-actin;mBMP2K, murine bone morphogenetic protein 2 inducible kinase;mPRMT3, murine protein arginine methyltransferase 3; NO, nitric oxide; NOS, nitric oxide synthase; PRMT, protein arginine methyltransferase; Q-PCR, quantitative PCR;RpL27, ribosomal protein L27;RpS11, ribosomal protein S11;SCAMP1, secretory carrier membrane protein 1; SDMA, symmetric dimethylarginine;Smad5, SMA-related protein 5

*To whom correspondence should be addressed. E-mail: c.l.smith@ucl. ac.uk

A B S T R A C T

Background

Asymmetric dimethylarginine (ADMA) is a naturally occurring inhibitor of nitric oxide synthesis that accumulates in a wide range of diseases associated with endothelial dysfunction and enhanced atherosclerosis. Clinical studies implicate plasma ADMA as a major novel cardiovascular risk factor, but the mechanisms by which low concentrations of ADMA produce adverse effects on the cardiovascular system are unclear.

Methods and Findings

We treated human coronary artery endothelial cells with pathophysiological concentrations of ADMA and assessed the effects on gene expression using U133A GeneChips (Affymetrix). Changes in several genes, including bone morphogenetic protein 2 inducible kinase(BMP2K), SMA-related protein 5(Smad5),bone morphogenetic protein receptor 1A, and protein arginine methyltransferase 3 (PRMT3;also known as HRMT1L3), were confirmed by Northern blotting, quantitative PCR, and in some instances Western blotting analysis to detect changes in protein expression. To determine whether these changes also occurred in vivo, tissue from gene deletion mice with raised ADMA levels was examined. More than 50 genes were significantly altered in endothelial cells after treatment with pathophysiological concentrations of ADMA (2 lM). We detected specific patterns of changes that identify pathways involved in processes relevant to cardiovascular risk and pulmonary hypertension. Changes in BMP2K and PRMT3 were confirmed at mRNA and protein levels, in vitro and in vivo.

Conclusion

(2)

Introduction

Asymmetric dimethylarginine (ADMA) is an endogenous inhibitor of all nitric oxide synthase (NOS) isoforms [1]. It is synthesised by the action of protein arginine methyltrans-ferases (PRMTs), and following proteolysis, free ADMA is released into the cell cytosol and thence into plasma. Circulating concentrations of ADMA are increased in patients with renal failure [1], pulmonary hypertension, heart failure, hypercholesterolemia or a wide range of other cardiovascular risk factors [2–6]. In patients with end-stage renal failure, the plasma levels of ADMA predict mortality and cardiovascular outcome [7], and in a cohort of otherwise healthy Finnish men, those with the highest levels of ADMA had an increased risk of acute coronary events [8]. Increased circulating ADMA in pregnant women predicts an increased risk of pre-eclampsia and intrauterine growth retardation [9]. Despite these clinical observations and the increasing excitement surrounding the use of ADMA as a risk marker

for vascular disease [3,7], it is still not clear whether ADMA has a causal role in pathophysiology. It has been argued that the concentration of ADMA in plasma is too low to be an effective inhibitor of NOS, and that the usual concentrations of arginine in cells should overcome any inhibitory effects of ADMA on NOS [10]. In order to determine how ADMA might exert effects on endothelial cells and produce pathology, we assessed the effects of ADMA on gene expression in human coronary endothelial cells.

Methods

Cell Culture

Human coronary artery endothelial cells (HCAEC) were purchased from Promocell and grown according to the manufacturer’s instructions. HCAEC in 75-cm2 flasks at 70% confluency (passage 3 or 4) were treated for 24 h with complete media supplemented with asymmetric dimethylar-ginine (NGNG-dimethyl-L-arginine; ADMA; 0, 2, or 100lM; Figure 1.Flow Diagram Summarising the Methods Used in This Manuscript

(3)

Merck Biosciences, United Kingdom). This was repeated on three separate occasions with different batches of cells. RNA from each study was used as described below for GeneChip (Affymetrix, Santa Clara, California, United States) analysis. Our strategy for the GeneChip and subsequent analysis is outlined in Figure 1.

GeneChip Experiments

ADMA-treated HCAEC from T75 flasks were harvested in 7.5 ml of TRIzol (Invitrogen, Carlsbad, California, United States), and total RNA was extracted; cDNA and subsequent cRNA synthesis were prepared as previously described [11]. The quality of the biotin-labelled cRNA transcripts was determined using a Bioanalyser 2100 (Agilent Technologies, Palo Alto, California, United States). Purified cRNA (15lg) was fragmented and hybridised to human U133A GeneChips according to Affymetrix standard protocols (http://www. affymetrix.com). Labelled GeneChips were scanned, using a confocal argon ion laser (Agilent Technologies).

GeneChip Data Analysis

The U133A GeneChip contains oligonucleotides derived from approximately 22,000 human transcripts and includes control bacterial genesbioB, bioC, bioD,andcre.GeneChip data files scaled to 100 and normalised to the median prior to analysis with GeneSpring 7.2 software (Agilent; Figure 1). Genes were excluded if the signal strength did not signifi-cantly exceed background values and if expression did not reach a threshold value for reliable detection (based on the relaxed Affymetrix MAS 5.0 probability of detection (p0.1; [12]) in each of the three separate studies. Finally, genes were excluded if the level of expression did not vary by more than 1.7-fold between ADMA-treated (2 or 100lM) compared with untreated control HCAEC. The remaining genes were subjected to nonparametric Welch t-tests and are reported with their respective fold changes andp-values. The data have been submitted in a MIAME-compliant format to ArrayEx-press at EBI (http://www.ebi.ac.uk/arrayexArrayEx-press/).

Determination of ADMA Levels

HCAEC cells were grown in 75-cm2 flasks as described above for 24 h. Methylated arginines in the conditioned medium were quantitated by HPLC as previously described [1,13].

Cell Growth Assay

Cells were seeded into a 96-well microtitre plate at a density of 500 cells per well and grown in complete EC medium in the presence of 0, 2, or 100 lM ADMA. Cell growth was assayed (in triplicate) over a 4-d period using the CellTiter 96 Aqueous One Solution Cell Proliferation Assay (Promega, Madison, Wisconsin, United States).

Confirmation of Gene Changes

For genes of interest selected on the initial GeneChip analysis, further experiments were undertaken, with different batches of cells, to verify changes detected by global expression profiling and using different approaches to assess mRNA or protein.

RT-PCR

For RT-PCR cDNA was synthesised from the total RNA (approximately 1 lg) using Ready-To-Go You-Prime First-Strand Beads (Amersham Biosciences, Little Chalfont, United Kingdom) and supplemented with the 39 gene-specific primers with b-actin as a control. RT-PCR used the primer sequences (Table 1) withb-actinas a control.

The PCR products were separated in 1% agarose gel, and the intensity of the bands was measured; each sample was corrected for b-actin. PCR products used for Northern blotting were excised and purified from agarose gel using Qiaex II (Qiagen, Valencia, California, United States).

Quantitative-PCR

Quantitative PCR (Q-PCR) was carried out using a Light-Cycler (Roche, Alameda, California, United States) and LightCycler software version 3, LightCycler run 4.24. All reagents required for PCR (excluding cDNA and primers) were included in the LightCycler FastStart DNA Master SYBR Green 1 kit (Roche). Reverse transcription was performed as described above for RT-PCR. The PCR cycle settings were 95

8C for 5 min, followed by 45 cycles of 958C for 5 s, 588C for 10 s (608C forb-actin), 728C for 40 s, and 778C (828C forb-actin), where fluorescence was measured at the end of each cycle and is gene-specific. Standard curves were constructed forPRMT3

as described by the manufacturer’s instructions and com-pared to the reference geneb-actin.

Northern Blotting

HCAEC were grown to 70% confluency in 6-well plates and treated with 0, 2, and 100 lM ADMA, 100 lM L-N5 -(1-Iminoethyl)ornithine (L-NIO), or 100 lM symmetric dime-thylarginine (SDMA) for 24 h; total RNA was extracted using

Table 1.Primer Sequences for Q-PCR and RT-PCR

Probe 39Oligo 59Oligo

BMP2K TGTTGCTGCTGTGTTGCATGA TATTGGGTCAGGGACCTCCTCA

SMAD5 CACCTCTCCACCAACATAGTAC ATAATTCCCAGCCTATGGATAC

BMPR1A TAGTTCGCTGAACCAATAAAGG GTCAGAAAATGGAGTAACCTTA

PRMT3a CTTCGCCCCAGCTTTA TACGGGCATTATGGGAT

b-actina AAATCCTGAGTCAAGCCAAAAA CCACGAAACTACCTTCAACTCC

mBMP2K CTTCAGATCCCGGTGGATTA ACACACCCGACCTCAACATT

mPRMT3 GACCCTGTTGTTGGCAATTCT CTTCCTGTGGAAAAGGTGGA

mb-actin CATGATCTGGGTCATCTTTTCA CATGATCTGGGTCATCTTTTCA

aPrimers were designed for use on the LightCycler (Roche).

DOI: 10.1371/journal.pmed.0020264.t001

Table 2.Oligonucleotide Sequences for 59-End-Labelling Northern Blotting Experiments

Gene 59Oligo

RpS11 AATAGCCTCCTTGGGTGTCTTGAA

Calreticulin AGAGCAGATGAAATCTCAGGCCTGT

SCAMP1 AGACAGGTGCATTTAGGGATTCAAG

RpL27 GGTGCCATCATCAATGTTCTTCACG

(4)

TRIzol, and RNA was separated by gel electrophoresis and blotted onto Hybond Nþ

(Amersham Biosciences). The ribosomal protein S11 (RpS11), ribosomal protein L-27 (RpL-27), Calreticulin, and secretory carrier membrane protein 1(SCAMP1)probes were generated by end-labelling 59oligonucleotides (Table 2) using T4 polynucleotide kinase. The PCR products from RT-PCR reaction for b-actin, Smad5,bone morphogenetic protein receptor 1A(BMPR1A),

and murineb-actin (mb-actin); murine bone morphogenetic protein 2 inducible kinase (mBMP2K), and murine protein arginine methyltransferase 3 (mPRMT3) were purified and labelled with Redivue deoxycytidine 59-[a-32P]-triphosphate (Amersham Biosciences), using a random primed DNA labelling kit (Roche).

Western Blotting

HCAEC were treated with either 0, 2, or 100lM ADMA for 24 h in 6-well plates and harvested in lysis buffer as described

previously [11], the protein concentrations of the lysates were determined by protein assay (Bio-Rad, Hercules, California, United States), and cell lysates were resolved by 12% SDS polyacryamide gel electrophoresis with equal amounts of protein loaded into each lane. Anti-PRMT3 (Upstate Bio-technology, Charlottesville, Virginia, United States) and Anti-BMP2K (Orbigen, San Diego, California, United States) were used with anti-rabbit secondary antibody coupled to horse-radish peroxidase and detected with the ECLþ detection system (Amersham Pharmacia, Piscataway, New Jersey, United States). Densitometry of the bands was determined, and results are shown as the mean densitometry, wheren¼4 with inset of a typical Western blot.

Pathway Mapping and Gene Ontology Analysis

In order to determine whether ADMA had affected expression of genes in pathways related to the genes identified on the initial analysis, lists of genes that were changed more than 1.7-fold compared to control (irrespec-tive of p-value) were examined using Gene Ontology (Affymetrix) data mining for biological process (at level 3), and Expression Analysis Systematic Explorer (EASE) bio-logical theme analysis were conducted online at http://david. niaid.nih.gov using DAVID [14]. DAVID-EASE [15] generates an EASE score predicting the likelihood of genes mapping to specific biological processes (determined by Gene Ontology consortium) from a given list of changed genes, therefore enabling global themes in gene expression following ADMA treatment to be identified [15].

Dimethylarginine Dimethylaminohydrolase 1 Gene Deletion Mice

ADMA is metabolised to citrulline and dimethylamine by the action of dimethylarginine dimethylaminohydrolase (DDAH). We have created knockout mice that lack DDAH1. DDAH1 heterozygous knockout mice (details to be published elsewhere) have approximately 2-fold higher plasma ADMA levels compared to wild-type litter-mates and thus provide an excellent model to test the effects of moderately raised ADMA levels in vivo. Northern blotting was carried out using RNA extracted from the brain, heart, and kidney of 12–14-wk-old DDAH1 heterozygous knockout and wild-type litter-mates with probes formBMP2KandmPRMT3,and results are expressed relative tomb-actin.

Statistical Analyses

Q-PCR, Northern blot, and Western blot densitometry data for the treated HCAEC was analysed by one-way analysis of variance (ANOVA) coupled to Bonferroni posttest, and the Bonferroni posttest p-values are reported. The Northern blots from the DDAH1 gene deletion mice were compared with unpairedt-test and thep-values are reported.

Results

Changes in HCAEC Gene Expression in Response to ADMA on U133A GeneChips

A total of 979 genes changed in expression between ADMA-treated and control cells. Following the Welch t-test with a cutoff ofp,0.05, 56 genes were identified as having shown a statistically significant change between the untreated and 2-lM ADMA-treated cells, and 86 genes changed between Figure 2.Endothelial Gene Expression Changes in Response to ADMA

(A) Changes in HCAEC gene expression in response to ADMA. Hierarchical clustering of 131 genes significantly up- or downregulated (p,0.05, Welcht-test) by greater than 1.7-fold on the U133A GeneChips in response to 2lM ADMA (56 genes) or 100 lM ADMA (86 genes) compared with untreated cells with 11 genes changing with both concentrations of ADMA. Individual arrays are shown for each treatment group with blue representing low expression, and red high expression on the scale bar.

(B) Treatment of HCAEC with either 2 lM or 100 lM ADMA had no significant effect on cell viability;n¼6.

(5)

the untreated and 100-lM ADMA greater than 1.7-fold; 11 genes showed statistically significant changes at both concen-trations of ADMA compared to untreated cells (Figure 2A; Tables 3 and 4).

Effects of ADMA upon HCAEC Viability

Basal levels of ADMA and SDMA in HCAEC media were 0.17 6 0.01 lM and 0.22 6 0.02 lM, respectively, and arginine levels exceeded 300lM. No changes were observed

Table 3.Genes That Changed by More Than 1.7-Fold in 2lM ADMA Treated HCAEC Compared to Untreated

Affymetrix ID Gene Title Gene Symbol Fold Change p-Value

213350_at aRibosomal protein S11

RpS11 8.065 0.0334

222364_at EST — 5.780 0.0168

213642_at aRibosomal protein L27 RpL27 4.386 0.0481

216859_x_at Golgi-specific brefeldin A resistance factor 1 GBF1 3.968 0.00706

212952_at aCalreticulin CALR 2.959 0.0472

204569_at Intestinal cell (MAK-like) kinase ICK 2.778 0.0491

203294_s_at Lectin, mannose-binding, 1 LMAN1 2.740 0.0433

210407_at Protein phosphatase 1A (formerly 2C), Magnesium-dependent,a-isoform PPM1A 2.674 0.036

205636_at SH3GL3 protein SH3GL3 2.404 0.00324

38290_at Regulator of G-protein signalling 14 RGS14 2.347 0.0235

208995_s_at Peptidyl-prolyl isomerase G (cyclophilin G) PPIG 2.315 0.0146

214716_at aBMP2 inducible kinase BMP2K 2.304 0.00128

213610_s_at Hypothetical protein MGC2610 MGC2610 2.299 0.0435

212209_at Thyroid hormone receptor associated protein 2 THRAP2 2.137 0.00562

214697_s_at ROD1 regulator of differentiation 1(Schizosaccharomyces pombe) ROD1 2.132 0.02

213732_at Transcription factor 3 TCF3 2.119 0.0462

220112_at Hypothetical protein FLJ11795 FLJ11795 2.114 0.00623

219785_s_at F-box protein 31 FBXO31 2.079 0.00429

206928_at Zinc finger protein 124 (HZF-16) ZNF124 2.045 0.0274

221903_s_at Cylindromatosis (turban tumor syndrome) CYLD 2.024 0.0221

204662_at CP110 protein CP110 2.012 0.0165

212746_s_at KARP-1-binding protein KAB 1.980 0.0379

217540_at Transcribed locus, moderately similar to NP_055301.1 neuronal thread protein AD7c-NTP(Homo sapiens)

— 1.946 0.00294

202364_at MAX interactor 1 MXI1 1.919 0.0268

204285_s_at Phorbol-12-myristate-13-acetate-induced protein 1 PMAIP1 1.916 0.0443

204010_s_at v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog KRAS 1.905 0.046

202305_s_at Fasciculation and elongation protein zeta 2 (zygin II) FEZ2 1.862 0.028

201242_s_at ATPase, Naþ/Kþtransporting,b-1 polypeptide ATP1B1 1.845 0.0391

205416_s_at Ataxin 3 ATXN3 1.845 0.00666

218096_at 1-Acylglycerol-3-phosphateO-acyltransferase 5 (lysophosphatidic acid acyltransfer-ase,e)

AGPAT5 1.838 0.00518

218930_s_at Hypothetical protein FLJ11273 FLJ11273 1.828 0.0495

214700_x_at RAP1 interacting factor homolog (yeast) RIF1 1.818 0.00974

215203_at Golgi autoantigen, golgin subfamily a, 4 GOLGA4 1.812 0.0128

202225_at V-crk sarcoma virus CT10 oncogene homolog (avian) CRK 1.805 0.0429

209318_x_at Pleiomorphic adenoma gene-like 1 PLAGL1 1.805 0.0433

202906_s_at Nijmegen breakage syndrome 1 (nibrin) NBS1 1.773 0.0492

215948_x_at Zinc finger protein 237 ZNF237 1.761 0.042

203202_at HIV-1 rev binding protein 2 HRB2 1.718 0.0449

215412_x_at Postmeiotic segregation increased 2-like 2 PMS2L2 1.706 0.0483

219021_at Ring finger protein 121 RNF121 0.588 0.0311

208704_x_at Amyloidb(A4) precursor-like protein 2 APLP2 0.582 0.0433

211590_x_at Thromboxane A2 receptor TBXA2R 0.579 0.0256

211385_x_at Sulfotransferase family, cytosolic, 1A, phenol-preferring, member 2 SULT1A2 0.567 0.0237

217347_at EST — 0.563 0.0285

203873_at Possible global transcription activator SNF2L1 (SWI/SNF related matrix associated actin-dependent regulator of chromatin subfamily A member 1).

SMARCA1 0.557 0.00757

222280_at EST — 0.551 0.0493

212699_at Secretory carrier membrane protein 5 SCAMP5 0.547 0.0427

213484_at Clone 23700 mRNA sequence — 0.543 0.0464

209998_at Phosphatidylinositol glycan, class O PIGO 0.499 0.0408

216421_at EST — 0.481 0.0194

209093_s_at Glucosidase,b; acid (includes glucosylceramidase) GBA 0.468 0.0117

207740_s_at Nucleoporin 62 kDa NUP62 0.428 0.0404

217142_at asubunit of the elongation factor-1 complex EEF1A 0.416 0.0266

212822_at HEG homolog HEG 0.412 0.0221

205777_at Dual specificity phosphatase 9 DUSP9 0.399 0.0055

208353_x_at Ankyrin 1, erythrocytic ANK1 0.205 0.0433

Fold changes andp-values of genes that changed by more than 1.7-fold in 2lM ADMA treated HCAEC compared to untreated (p,0.05 by Welcht-tests).

aGenes that were used for reanalysis in subsequent experiments.

(6)

Table 4.Genes that Changed by More than 1.7-Fold in 100lM ADMA-Treated HCAEC Compared to Untreated

Affymetrix ID Gene Title Gene Symbol Fold Change p-Value

222364_at EST — 11.06 0.00597

216859_x_at Golgi-specific brefeldin A resistance factor 1 GBF1 6.757 0.00045

204397_at Echinoderm microtubule-associated protein-like EMAP2 4.016 0.0201

212417_at aSecretory carrier membrane protein 1 SCAMP1 3.165 0.0307

213734_at Replication factor C (activator 1) 5, 36.5kDa RFC5 2.740 0.0259

214716_at aBMP2 inducible kinase

BMP2K 2.695 0.00049

214078_at P21 (CDKN1A)-activated kinase 3 PAK3 2.500 0.0228

204142_at Enolase superfamily member 1 ENOSF1 2.488 0.00326

221765_at UDP-glucose ceramide glucosyltransferase UGCG 2.392 0.00264

215218_s_at Chromosome 19 open reading frame 14 C19orf14 2.336 0.0406

213732_at Transcription factor 3 TCF3 2.315 0.0141

213610_s_at Hypothetical protein MGC2610 MGC2610 2.309 0.0316

201424_s_at Cullin 4A CUL4A 2.278 0.0356

205636_at SH3GL3 protein SH3GL3 2.242 0.0395

217951_s_at PHD finger protein 3 PHF3 2.183 0.0174

220112_at Hypothetical protein FLJ11795 FLJ11795 2.128 0.00597

218297_at Chromosome 10 open reading frame 97 C10orf97 2.020 0.0376

217540_at Similar to NP_055301.1 neuronal thread protein AD7c-NTP — 2.020 0.00341

222335_at EST — 2.016 0.00276

212936_at Hypothetical protein DKFZp564D172 DKFZP564D172 1.949 0.0423

221649_s_at Peter Pan homolog(Drosophila) PPAN 1.898 0.0189

213320_at aProtein arginine N-methyltransferase 3 PRMT3 1.883 0.0339

212209_at Thyroid hormone receptor associated protein 2 THRAP2 1.883 0.0353

204237_at GULP, engulfment adaptor PTB domain containing 1 GULP1 1.880 0.0299

205191_at Retinitis pigmentosa 2 (X-linked recessive) RP2 1.880 0.0324

202663_at Wiskott-Aldrich syndrome protein interacting protein WASPIP 1.869 0.023

212855_at KIAA0276 protein KIAA0276 1.862 0.0192

220255_at Fanconi anemia, complementation group E FANCE 1.821 0.0339

205296_at Retinoblastoma-like 1 (p107) RBL1 1.792 0.0458

206102_at KIAA0186 gene product KIAA0186 1.786 0.047

200605_s_at Protein kinase, cAMP-dependent, regulatory, type I,a PRKAR1A 1.767 0.0491

218256_s_at Nucleoporin 54 kDa NUP54 1.754 0.0223

221222_s_at Hypothetical protein FLJ20519 FLJ20519 1.742 0.0163

221634_at Similar to RPL23AP7 protein MGC70863 1.736 0.0164

210148_at Homeodomain interacting protein kinase 3 HIPK3 1.727 0.037

202419_at Follicular lymphoma variant translocation 1 FVT1 1.721 0.0482

217542_at Carboxypeptidase M CPM 1.701 0.0122

209831_x_at Deoxyribonuclease II, lysosomal DNASE2 0.586 0.0186

200678_x_at Granulin GRN 0.579 0.0491

213829_x_at Tumor necrosis factor receptor superfamily, member 6b, decoy TNFRSF6B 0.577 0.0121

216041_x_at Granulin GRN 0.574 0.049

201434_at Tetratricopeptide repeat domain 1 TTC1 0.573 0.0294

203778_at Mannosidase,aA, lysosomal MANBA 0.566 0.0395

207239_s_at PCTAIRE protein kinase 1 PCTK1 0.565 0.0454

200913_at Protein phosphatase 1G (formerly 2C), PPM1G 0.564 0.0417

204473_s_at Zinc finger protein 592 ZNF592 0.564 0.00276

218797_s_at Sirtuin (silent mating type information regulation 2 homolog) 7(Saccharomyces cerevisiae)

SIRT7 0.561 0.0219

200643_at High-density lipoprotein binding protein (vigilin) HDLBP 0.560 0.0398

211941_s_at Prostatic binding protein PBP 0.556 0.0387

207559_s_at Zinc finger protein 261 ZNF261 0.552 0.0363

214035_x_at LOC399491 protein LOC399491 0.551 0.0113

216885_s_at WD repeat domain 42A WDR42A 0.551 0.0276

210589_s_at Glucosidase,b; acid (includes glucosylceramidase) GBA 0.550 0.014

203524_s_at Mercaptopyruvate sulfurtransferase MPST 0.550 0.0234

222217_s_at Solute carrier family 27 (fatty acid transporter), member 3 SLC27A3 0.548 0.045

209140_x_at Major histocompatibility complex, class I, B HLA-B 0.544 0.0451

205851_at Protein expressed in nonmetastatic cells 6, (nucleoside-diphosphate kinase) NME6 0.543 0.00934

211471_s_at RAB36, member RAS oncogene family RAB36 0.541 0.0235

221757_at HGFL gene MGC17330 0.539 0.016

215533_s_at Ubiquitination factor E4B (UFD2 homolog, yeast) UBE4B 0.538 0.0229

215178_x_at EST — 0.534 0.0116

204248_at Guanine nucleotide binding protein,a-11 (Gq class) GNA11 0.532 0.00662

212744_at Bardet-Biedl syndrome 4 BBS4 0.528 0.0119

208829_at TAP binding protein (tapasin) TAPBP 0.526 0.0292

209002_s_at KIAA1536 protein KIAA1536 0.522 0.0492

212040_at Trans-Golgi network protein 2 TGOLN2 0.519 0.0129

216283_s_at Poliovirus receptor PVR 0.519 0.0351

(7)

in HCAEC viability over 72 h in the presence of either 2 or 100lM ADMA (Figure 2B).

Confirming Transcriptional Changes

To determine the reliability of changes identified by GeneChip analysis, four genes were selected from those that showed a statistically significant change in either the 2 or 100 lM sample compared to control (Figure 3A). These were

SCAMP1, Calreticulin, (RpL27) and RpS11. In studies on a different batch of HCAEC, Northern blotting confirmed that expression of these genes changed in response to ADMA (Figure 3B).

In order to elucidate the mechanism of ADMA action, HCAEC were also treated with the potent NOS inhibitor L-NIO and SDMA, which is not a NOS inhibitor or DDAH substrate, but is a naturally occurring methylarginine that competes with arginine for the cationic amino acid trans-porter [10,16]. Interestingly neither SDMA nor L-NIO elicited significant changes in the expression of RpS11, RpL27, SCAMP1,orCalreticulin(Figure 3B).

Genes of Specific Interest Identified by GeneChip

Protein arginine methyltransferase.PRMT3was selected as a gene of interest, because of its involvement in ADMA synthesis [17]. It changed 1.8-fold on the GeneChip untreated versus 100lM groups (p¼0.0339; Figure 4A). In a separate series of follow-up studies, HCAEC were treated with ADMA, and PRMT3 gene expression was determined by Q-PCR.

PRMT3mRNA levels increased following either low- or high-dose ADMA treatment (Figure 4B untreated versus 2lM,p,

0.05; and untreated versus 100lM,p,0.01,n¼6). PRMT3 protein expression also increased in response to ADMA treatment (Figure 4C; untreated versus 2lM; and untreated versus 100lM,p,0.05,n¼4). When HCAEC were treated for 24 h with 2 lM SDMA or L-NIO, neither treatment significantly affected PRMT3 expression, whereas 100 lM

SDMA or L-NIO caused a small increase in PRMT3

expression (Figure 4B;n¼6).

Bone morphogenetic protein 2 inducible kinase. We identified that bone morphogenetic protein 2 inducible kinase (BMP2K) changed on the GeneChip in response to ADMA (2 lM and 100 lM ADMA increased expression by 2.304-fold [p¼0.00128] and 2.695-fold [p, 0.001], respec-tively; Figure 5A). In a separate series of experiments on a different batch of HCAEC this increase inBMP2Kexpression was confirmed by RT-PCR (data not shown). Western blotting also revealed that BMP2K protein levels were increased in response to ADMA (Figure 5B); densitometry of these blots indicated that there was a significant increase (untreated versus 2lM,p,0.05; and untreated versus 100lM,p,0.01,

n¼4).

Identification of Genes Involved in Bone Morphogenetic Protein Signalling

Having confirmed changes inBMP2Kexpression, the total list of 765 genes that changed greater than 1.7-fold in response to 100 lM ADMA, was reexamined to identify additional genes in the bone morphogenetic protein (BMP) signalling pathway affected by ADMA. This analysis identified

Smad5 and BMPR1A (Figures 6 and 7). In a separate set of studies Northern blotting confirmed that mRNA was in-creased in HCAEC after 24 h by either 2 or 100lM ADMA for

Smad5 and BMPR1A (Smad5 untreated versus 2 lM and untreated versus 100 lM; p, 0.05, n¼4; Figure 6A; and

BMPR1A untreated versus 2 lM, p , 0.05 and untreated versus 100lM;p,0.01,n¼4; Figure 6B).

Identification of Global Changes in Gene Expression All genes that changed by more than 1.7-fold (irrespective ofp-value) were entered into DAVID-EASE. EASE probability scores were generated based upon the number of genes for each biological process altered in response to ADMA (Tables 5 and 6), where these biological processes were defined by

Table 4.Continued

Affymetrix ID Gene Title Gene Symbol Fold Change p-Value

202556_s_at Microspherule protein 1 MCRS1 0.502 0.00625

218216_x_at ADP-ribosylation-like factor 6 interacting protein 4 ARL6IP4 0.498 0.00504

211241_at Lipocortin 2 pseudogene LIP2 0.486 0.00553

202640_s_at RAN binding protein 3 RANBP3 0.484 0.0406

210378_s_at Sjogren’s syndrome nuclear autoantigen 1 SSNA1 0.480 0.0381

209093_s_at Glucosidase,b; acid (includes glucosylceramidase) GBA 0.467 0.0216

211160_x_at Actinin,a-1 ACTN1 0.463 0.018

217331_at SCC-112 protein SCC-112 0.463 0.0235

211911_x_at Major histocompatibility complex, class I, B HLA-B 0.444 0.0186

212822_at HEG homolog HEG 0.429 0.0275

208729_x_at Major histocompatibility complex, class I, B HLA-B 0.429 0.0301

210042_s_at Cathepsin Z CTSZ 0.401 0.0324

211230_s_at Phosphoinositide-3-kinase, catalytic,dpolypeptide PIK3CD 0.396 0.0428

203273_s_at Tumor suppressor candidate 2 TUSC2 0.376 0.00316

218425_at TRIAD3 protein TRIAD3 0.360 0.0426

203143_s_at KIAA0040 gene product KIAA0040 0.354 0.0485

216180_s_at Synaptojanin 2 SYNJ2 0.346 0.0329

206031_s_at Ubiquitin-specific protease 5 (isopeptidase T) USP5 0.209 0.0292

Fold changes andp-values of genes that changed by more than 1.7-fold in 100lM ADMA-treated HCAEC compared to untreated (p,0.05 by Welcht-tests).

aGenes that were used for reanalysis in subsequent experiments.

(8)

enriched Gene Ontology categories. These gene lists indi-cated that ADMA affects genes involved in metabolism, RNA splicing, transcription, and cell cycle regulation.

Gene Deletion Mice

To examine whether the effects observed in the cell culture model were relevant to the in vivo situation, we determined the expression level of certain genes in DDAH heterozygous knockout mice that have 2-fold elevation in plasma ADMA levels. Total RNA from DDAH1 heterozygous knockout was probed formBMP2KandmPRMT3by Northern blotting and corrected for mb-actin expression (Figure 8). Levels of

mBMP2Kfor brain, heart, and kidney, respectively, were 42

6 13.8% (p ¼ 0.047), 33.3 6 18.6% (p ¼ 0.038), 74.0 6

21.4% (p¼0.007), higher in DDAH1 heterozygous mice (n¼9) compared with wild-type litter-mates (n¼5). A similar trend was seen for the expression ofmPRMT3(data not shown).

Discussion

ADMA is an endogenous inhibitor of NOSs [1] and there is an association between increased plasma levels of ADMA and renal disease [1], pulmonary hypertension [5], preeclampsia [9], and the progression of atherosclerosis [18,19]. Whilst the concentration of ADMA in plasma of healthy adults varies between 0.4 and 1lM, it may increase to 1.45–4.0lM with certain diseases, and this increase is thought to be causally involved in pathophysiology [1,6,7,9,20]. In the present study we detected substantial changes in gene expression in HCAEC after 24 h of exposure to concentrations of ADMA similar to those reported in pathophysiological states. Furthermore, we identified specific pathways of gene activa-tion that give insight into the mechanisms by which ADMA may contribute to disease. Surprisingly, some of these changes appear to be independent of blockade of the L-arginine:nitric oxide (NO) pathway.

Figure 3.Confirmation of Gene Expression Changed by GeneChip Analysis

(A)SCAMP1; Calreticulin,ribosomal protein L-27(RpL27),andRpS11signal-to-noise ratios derived from U133A GeneChip analysis wheren¼3 (untreated versus 100lM:SCAMP1changed 3.16-fold,p¼0.031; and untreated versus 2lM:Calreticulinchanged 2.96-fold,p¼0.047;RpS11,8.065-fold,p¼0.033; RpL27,4.39-fold,p¼0.048).

(B)SCAMP1; Calreticulin, RpL27, andRpS11mRNA levels are elevated by ADMA (2 and 100lM; *p,0.05 and **p,0.01). SDMA (100lM) and L-NIO (100

(9)

Low Concentrations of ADMA Alter Gene Expression Acute administration of ADMA to healthy individuals elicits a transient fall in heart rate and cardiac output and increases blood pressure [2], but little is known of the potential longer-term effects of raised ADMA. Zoccali et al. reported that a 1-lM increment in ADMA above the upper limits for healthy individuals was associated with increased risk of cardiovascular mortality [7], and levels around 2lM seem to be associated with a number of diverse cardiovascular pathologies [3,8]. In the current study, HCAEC were treated with 2 or 100lM ADMA. We repeated GeneChip analysis in

three separate studies and observed reproducible changes in the expression of a subset of genes in response to low- and high -dose ADMA. Because there is always a possibility of false positives being identified on arrays, we tested the reprodu-cibility of the GeneChip approach by selecting four genes significantly upregulated by ADMA treatment. In a separate series of studies we confirmed an increase in mRNA levels by Northern blotting at both concentrations of ADMA. Thus it is clear that pathophysiological concentrations of ADMA (2lM) affect endothelial cell gene expression even in the presence of very high arginine concentrations (.300 lM). Endogenous ADMA is metabolised by DDAH, and DDAH activity is the major determinant of plasma ADMA concentrations [2]. To determine whether the effects we saw in vitro would be reproduced in vivo we examined DDAH1 knockout mice. At least one of the gene changes we saw in vitro also occurs in vivo since DDAH1 heterozygous knockout mice have in-creased concentrations of ADMA in plasma and showed upregulation ofBMP2Kin several tissues.

ADMA inhibits NOSs with an IC50 of about 5 lM, the precise potency depending on the prevailing concentration Figure 4.ADMA Alters PRMT3 Gene Expression and Protein Levels

(A)PRMT3levels are changed by ADMA on U133A GeneChips wheren¼

3 (untreated versus 100lM: 1.88-fold increase,p¼0.034).

(B)PRMT3mRNA is changed in HCAEC following 24-h exposure to ADMA (2 and 100lM) but not SDMA (100lM) or L-NIO (100lM), measured by Q-PCR (*p,0.05 and **p,0.01, wheren¼8).

(C) PRMT3 protein levels are increased in HCAEC following 24-h treatment with ADMA (2 and 100 lM) as determined by Western blotting, using a commercially available PRMT3 antibody (Upstate Biotechnology), where equal amounts of protein were loaded in each lane. Densitometry of the PRMT3 was carried for each of the blots from four separate experiments. ADMA (2 and 100lM) treatment for 24 h significantly increased the levels of PRMT3 (*p,0.05). The inset blot is a representative from four separate experiments.

DOI: 10.1371/journal.pmed.0020264.g004

Figure 5.ADMA Alters BMP2K Gene Expression and Protein Levels (A)BMP2Kis increased more than 2-fold in HCAEC following 24-h ADMA treatment (2lM and 100lM ADMA increased expression by 2.304-fold [p¼0.00128] and 2.695-fold [p,0.001] respectively).

(B) BMP2K protein levels are increased in HCAEC following 24-h treatment with ADMA (2 and 100 lM) as determined by Western blotting, using a commercially available BMP2K antibody (Orbigen). Densitometry of the BMP2K band was carried for each of the blots from four separate experiments (untreated versus 2 lM: p , 0.05; and untreated versus 100lM:p,0.01,n¼4). The inset blot is representative of four separate experiments, where equal amounts of protein were loaded in each lane.

(10)

of arginine [21]. It is known that adding endogenous NO to endothelial cells alters gene expression [22,23] and that inhibitors of endogenous NO generation can alter expression of specific genes, at least under conditions of endothelial cell activation with cytokines. To determine whether the effects we observed could be accounted for by inhibition of NOS, we treated cells with a highly potent NOS inhibitor (L-NIO) and with SDMA, an endogenous dimethylarginine that has no effect on NOS but which can block arginine transport [10,16]. Neither SDMA nor L-NIO replicated the effects of ADMA on gene expression. We have not undertaken a full GeneChip analysis of responses to L-NIO, so we do not know how much overlap there would be between the effects of L-NIO and ADMA, but of those genes examined we saw a discordance between responses to the two inhibitors. This raises the intriguing possibility that some of the actions of ADMA may be independent of effects of NO, possibly due to other actions such as the ability of ADMA to increase superoxide generation [24,25]. Other authors have reported differences in efficacy of ADMA in cell culture systems compared to other NOS inhibitors that have more potent effects on isolated NOS [26], and further studies will be required to identify to what extent NO-independent effects contribute to the overall action of ADMA. Interestingly, a NOS-independ-ent effect of ADMA on angiotensin-converting enzyme has recently been suggested [25]. NOS-independent effects of ADMA may explain why, in some situations where ADMA concentrations are raised, L-arginine does not restore normal endothelial function [27] and why ADMA can exert effects, even in the presence of high endogenous arginine concen-trations.

Patterns of Gene Change

Mapping genes changed by ADMA to identify global changes in biological processes [15], indicated that ADMA treatment may have significant effects on genes involved in cell cycle regulation, cell proliferation, DNA repair, tran-scriptional regulation, and metabolism. The full biological significance of the range of genes affected is not yet known, but our data demonstrate the potential for elevated ADMA to affect endothelial (and likely other cellular) function in disease. In the present study, we focussed on two pathways of potential importance—BMP pathways and PRMTs.

BMP Pathways and ADMA

Analysis of the U133A GeneChips revealed thatBMP2Kwas induced more than 2-fold in response to either 2 or 100lM ADMA. The increase in gene expression was mirrored by an increase in BMP2K protein, and the effect was also seen in our high-ADMA mouse model. By relaxing parameters (to exclude false negatives) a search for other genes involved in BMP signalling revealed thatSmad5 andBMPR1A were also amongst the transcripts increased by GeneChip analysis, and these changes were confirmed by Northern blotting. The finding of changes in the BMP signalling pathway is important since the ADMA/DDAH pathway seems to be involved in animal models of pulmonary hypertension [28,29], and mutations in the BMP receptor 2 (BMPR2) are associated with familial pulmonary hypertension in humans [30].

The changes in BMP pathways may also be important in understanding some of the effects of renal failure. ADMA accumulates in renal failure and fulfils many of the criteria of a uraemic toxin [1,18]. In addition to effects on cardiovas-Figure 6.Genes Involved in BMP Signalling are Altered by ADMA

Smad5 (A) and BMPR1A (B) are elevated in HCAEC following 24-h treatment with ADMA (2 and 100lM), as shown by Northern blotting where mRNA was corrected for differences inb-actinmRNA expression (*p,0.05; **p,0.01, wheren¼4).

DOI: 10.1371/journal.pmed.0020264.g006

Figure 7.Involvement of ADMA-Affected Genes in the BMP Signalling Pathway

Squares in yellow show genes that increased significantly on the GeneChip, whilst squares in blue show genes decreased by ADMA compared to untreated HCAEC, and ‘‘?’’ represents an unknown mechanism of action.

(11)

cular risk, ADMA may contribute to renal osteodystrophy, a process in which BMPs have been implicated [31]. Indeed an earlier study that showed that ADMA reduces osteoblast differentiation and decreases osteocalcin expression [32]. The present study confirms osteocalcin as a gene downregulated by ADMA, and since activation of BMP2K attenuates osteocalcin expression and reduces osteoblast differentiation [33], it is possible that the effects of ADMA on osteocalcin may be secondary to induction of BMP2K (Figure 7). Whatever the mechanisms, identification of a link between ADMA and BMP pathways may be relevant to the increased vascular calcification seen in renal disease [31].

ADMA and Arginine Methylation

We observed that PRMT3 gene expression was elevated following exposure to ADMA; this was confirmed by Q-PCR, and PRMT3 protein expression also increased. This is the first report that ADMA may alter the expression of enzymes involved in its own synthesis. There are presently five known PRMTs that asymmetrically methylate arginine residues and two (PRMT5 and PRMT7) that symmetrically methylate arginine residues. PRMT3 has a wide tissue distribution, is expressed in highly vascular tissues, including heart and lung [17], and expression may be increased by oxidised-LDL [34]. Our observations indicate that ADMA can induce a similar increase in PRMT3 expression.

The roles of methylation of arginine residues in proteins are not yet well defined, but studies of PRMT3 in fission yeast have shown that it associates with proteins involved in the translational machinery and that the S2 ribosomal protein, a component of the yeast 40S ribosome, is a specific substrate for PRMT3 [35]. PRMT3 is the only PRMT known to interact with the translational machinery, and it is interesting that we

have found several genes, including ribosomal proteinsRpS11

and RpL27,involved in translational control, that were also altered in response to ADMA treatment. Amongst the genes changed greater than 1.7-fold in response to ADMA was methionine adenosyltransferase II a, which catalyses the production of S-adenosylmethionine, the methyl donor for the PRMT reaction [36]. The role of ADMA in regulating arginine methylation in protein deserves further study.

Summary

Increased circulating concentrations of ADMA have been reported in cardiovascular and other disorders, and intra-cellular concentrations may vary independently of circulating levels. In the present study we have demonstrated that relatively small changes in the concentration of ADMA affect gene expression in endothelial cells. Identification of path-ways regulated by ADMA may aid our understanding of how ADMA contributes to a wide range of pathologies. Two pathways of specific interest have been identified—BMP signalling and enzymes involved in arginine methylation. The effects on BMP signalling may be particularly important in renal disease and in the link between raised ADMA and pulmonary hypertension.

Supporting Information

Accession Numbers

The microarray data have been loaded into the EBI MIAMExpress database (http://www.ebi.ac.uk/miamexpress/) and have been assigned the accession number E-MEXP-377.

Table 5.Identification of Global Changes in Gene Expression in HCAEC Following Treatment with 2lM ADMA

Biological Process Number of Genes Mapped to Process

EASE Score

Metabolism 161 0.0252

Nucleobase, nucleoside, nucleotide, and nucleic acid metabolism

77 0.0305

RNA splicing 8 0.0324

Antigen presentation, endogenous antigen

3 0.0337

Antigen processing,

endogenous antigen via MHC class I

3 0.0337

Chromatin modification 6 0.0371

Antigen processing 4 0.0389

Regulation of transcription 50 0.0398

Protein metabolism 67 0.0407

Antigen presentation 4 0.0434

Cell organization and biogenesis 22 0.0441

Cell growth and/or maintenance 96 0.0462

Double-strand break repair 3 0.0493

Transcription 52 0.0506

Genes that changed by more than 1.7-fold in 2lM treated compared to untreated HCAEC (465) were analysed by DAVID-EASE [15] software (National Institutes of Health) to determine biological processes, based on gene ontology, likely to have been affected by ADMA treatment.

MHC, major histocompatibility complex. DOI: 10.1371/journal.pmed.0020264.t005

Table 6.Identification of Global Changes in Gene Expression in HCAEC Following Treatment with 100lM ADMA

Biological Process Number of Genes Mapped to Process

EASE Score

Cell growth and/or maintenance 183 0.0000126

Cytoplasm organization and biogenesis 29 0.000463

Cellular physiological process 199 0.000579

Antigen processing, endogenous antigen via MHC class I

5 0.00103

Organelle organization and biogenesis 25 0.00141

Antigen processing 7 0.00142

Intracellular transport 35 0.0029

Cytoskeleton organization and biogenesis 20 0.00393

Cell cycle 45 0.00939

Antigen presentation 6 0.00996

Intracellular protein transport 27 0.00997

Antigen presentation, endogenous antigen

4 0.0118

Cell proliferation 62 0.0138

Negative regulation of cell cycle 10 0.0141

Transport 86 0.0142

Positive regulation of cell proliferation 12 0.0157

Protein transport 27 0.0164

Regulation of cell cycle 28 0.0203

Cell organization and biogenesis 35 0.0272

Regulation of cell proliferation 20 0.0305

Pyrimidine nucleotide biosynthesis 4 0.0414

Vesicle-mediated transport 18 0.0487

Genes that changed by more than 1.7-fold in 100lM treated compared to untreated HCAEC (765) were analysed by DAVID-EASE [15] software (National Institutes of Health) to determine biological processes likely to have been affected by ADMA treatment.

(12)

Acknowledgments

The authors would like to thank Dr. R. C. Chambers (University College London) and Ms. D. Fletcher (Institute of Child Health) for their help with the GeneChip analysis and Dr. M. Malaki and Dr. M. Nandi for their assistance with the transgenic mice. This work was funded by British Heart Foundation Grant RG 2000/07. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

1. Vallance P, Leone A, Calver A, Collier J, Moncada S (1992) Accumulation of an endogenous inhibitor of nitric oxide synthesis in chronic renal failure. Lancet 339: 572–575.

2. Achan V, Broadhead M, Malaki M, Whitley G, Leiper J, et al. (2003) Asymmetric dimethylarginine causes hypertension and cardiac dysfunction

in humans and is actively metabolized by dimethylarginine dimethylami-nohydrolase. Arterioscler Thromb Vasc Biol 23: 1455–1459.

3. Cooke JP (2004) Asymmetrical dimethylarginine: The Uber marker? Circulation 109: 1813–1818.

4. Usui M, Matsuoka H, Miyazaki H, Ueda S, Okuda S, et al. (1998) Increased endogenous nitric oxide synthase inhibitor in patients with congestive heart failure. Life Sci 62: 2425–2430.

5. Gorenflo M, Zheng C, Werle E, Fiehn W, Ulmer HE (2001) Plasma levels of asymmetrical dimethyl-L-arginine in patients with congenital heart disease and pulmonary hypertension. J Cardiovasc Pharmacol 37: 489–492. 6. Boger RH, Bode-Boger SM, Szuba A, Tsao PS, Chan JR, et al. (1998)

Asymmetric dimethylarginine (ADMA): A novel risk factor for endothelial dysfunction: Its role in hypercholesterolemia. Circulation 98: 1842–1847. 7. Zoccali C, Bode-Boger S, Mallamaci F, Benedetto F, Tripepi G, et al. (2001)

Plasma concentration of asymmetrical dimethylarginine and mortality in patients with end-stage renal disease: A prospective study. Lancet 358: 2113–2117.

8. Valkonen VP, Paiva H, Salonen JT, Lakka TA, Lehtimaki T, et al. (2001) Risk of acute coronary events and serum concentration of asymmetrical dimethylarginine. Lancet 358: 2127–2128.

9. Savvidou MD, Hingorani AD, Tsikas D, Frolich JC, Vallance P, et al. (2003) Endothelial dysfunction and raised plasma concentrations of asymmetric dimethylarginine in pregnant women who subsequently develop pre-eclampsia. Lancet 361: 1511–1517.

10. Tsikas D, Boger RH, Sandmann J, Bode-Boger SM, Frolich JC (2000) Endogenous nitric oxide synthase inhibitors are responsible for the L-arginine paradox. FEBS Lett 478: 1–3.

11. Chambers RC, Leoni P, Kaminski N, Laurent GJ, Heller RA (2003) Global expression profiling of fibroblast responses to transforming growth factor-beta1 reveals the induction of inhibitor of differentiation-1 and provides evidence of smooth muscle cell phenotypic switching. Am J Pathol 162: 533–546.

12. Seo J, Bakay M, Chen YW, Hilmer S, Shneiderman B, et al. (2004) Interactively optimizing signal-to-noise ratios in expression profiling: Project-specific algorithm selection and detection p-value weighting in Affymetrix microarrays. Bioinformatics 20: 2534–2544.

13. Teerlink T, Nijveldt RJ, de Jong S, van Leeuwen PA (2002) Determination of arginine, asymmetric dimethylarginine, and symmetric dimethylarginine in human plasma and other biological samples by high-performance liquid chromatography. Anal Biochem 303: 131–137.

14. Dennis G Jr, Sherman BT, Hosack DA, Yang J, Gao W, et al. (2003) DAVID: Database for Annotation, Visualization, and Integrated Discovery. Genome Biol 4: P3.

15. Hosack DA, Glynn Dennis G, Sherman BT, Lane BC, Lempicki RA (2003) Identifying biological themes within lists of genes with EASE. Genome Biol 4: R70.

16. Closs EI, Basha FZ, Habermeier A, Forstermann U (1997) Interference of L-arginine analogues with L-L-arginine transport mediated by the yþcarrier hCAT-2B. Nitric Oxide 1: 65–73.

17. Tang J, Gary JD, Clarke S, Herschman HR (1998). PRMT 3, a type I protein arginine N-methyltransferase that differs from PRMT1 in its oligomeriza-tion, subcellular localizaoligomeriza-tion, substrate specificity, and regulation. J Biol Chem 273: 16935–16945.

18. Kielstein JT, Bode-Boger SM, Frolich JC, Haller H, Boger RH (2001) Relationship of asymmetric dimethylarginine to dialysis treatment and atherosclerotic disease. Kidney Int Suppl 78: S9–S13.

19. Zoccali C (2002) Endothelial damage, asymmetric dimethylarginine and cardiovascular risk in end-stage renal disease. Blood Purif 20: 469–472. 20. Stuhlinger MC, Abbasi F, Chu JW, Lamendola C, McLaughlin TL, et al.

(2002) Relationship between insulin resistance and an endogenous nitric oxide synthase inhibitor. JAMA 287: 1420–1426.

21. MacAllister RJ, Whitley GS, Vallance P (1994) Effects of guanidino and uremic compounds on nitric oxide pathways. Kidney Int 45: 737–742. 22. Faruqi TR, Erzurum SC, Kaneko FT, DiCorleto PE (1997) Role of nitric

oxide in poly(I-C)-induced endothelial cell expression of leukocyte adhesion molecules. Am J Physiol 273: (5 Pt 2): H2490–H2497.

23. Hemish J, Nakaya N, Mittal V, Enikolopov G (2003) Nitric oxide activates diverse signaling pathways to regulate gene expression. J Biol Chem 278: 42321–42329.

24. Cardounel AJ, Xia Y, Zweier JL (2005) Endogenous methylarginines modulate superoxide as well as nitric oxide generation from neuronal nitric oxide synthase: Differences in the effects of monomethyl and dimethyl arginines in the presence and absence of tetrahydrobiopterin. J Biol Chem 280: 7540–7549.

25. Suda O, Tsutsui M, Morishita T, Tasaki H, Ueno S, et al. (2004) Asymmetric dimethylarginine causes arteriosclerotic lesions in endothelial nitric oxide synthase-deficient mice: Involvement of renin-angiotensin system and oxidative stress. Arterioscler Thromb Vasc Biol 24: 1682–1688.

26. Smirnova IV, Kajstura M, Sawamura T, Goligorsky MS (2004) Asymmetric dimethylarginine upregulates LOX-1 in activated macrophages: Role in foam cell formation. Am J Physiol Heart Circ Physiol 287: H782–H790. 27. Cross JM, Donald AE, Kharbanda R, Deanfield JE, Woolfson RG, et al. (2001)

Acute administration of L-arginine does not improve arterial endothelial function in chronic renal failure. Kidney Int 60: 2318–2323.

28. Arrigoni FI, Vallance P, Haworth SG, Leiper JM (2003) Metabolism of Figure 8.BMP2K Is Increased in DDAH1 Gene Deletion Mice

Expression ofBMP2KmRNA from brain, heart, and kidney is increased in 12-wk DDAH1 heterozygous knockout mice compared to wild-type litter-mates (p¼0.0473,p¼0.0379, andp¼0.0070, respectively); mRNA was corrected for differences inb-actinmRNA expression, wheren¼5 wild type, andn¼9 DDAH heterozygous.

(13)

asymmetric dimethylarginines is regulated in the lung developmentally and with pulmonary hypertension induced by hypobaric hypoxia. Circulation 107: 1195–1201.

29. Millatt LJ, Whitley GS, Li D, Leiper JM, Siragy HM, et al. (2003) Evidence for dysregulation of dimethylarginine dimethylaminohydrolase I in chronic hypoxia-induced pulmonary hypertension. Circulation 108: 1493–1498. 30. Deng Z, Morse JH, Slager SL, Cuervo N, Moore KJ, et al. (2000) Familial

primary pulmonary hypertension (genePPH1) is caused by mutations in the bone morphogenetic protein receptor-II gene. Am J Hum Genet 67: 737–744.

31. Hruska KA, Saab G, Chaudhary LR, Quinn CO, Lund RJ, et al. (2004) Kidney-bone, bone-kidney, and cell–cell communications in renal osteo-dystrophy. Semin Nephrol 24: 25–38.

32. Xiao ZS, Quarles LD, Chen QQ, Yu YH, Qu XP, et al. (2001) Effect of asymmetric dimethylarginine on osteoblastic differentiation. Kidney Int 60: 1699–1704.

33. Kearns AE, Donohue MM, Sanyal B, Demay MB (2001) Cloning and characterization of a novel protein kinase that impairs osteoblast differ-entiation in vitro. J Biol Chem. 276: 42213–42218.

34. Boger RH, Sydow K, Borlak J, Thum T, Lenzen H, et al. (2000) LDL cholesterol upregulates synthesis of asymmetrical dimethylarginine in human endothelial cells: Involvement of S-adenosylmethionine-dependent methyltransferases. Circ Res 87: 99–105.

35. Bachand F, Silver PA (2004) PRMT3 is a ribosomal protein methyltransfer-ase that affects the cellular levels of ribosomal subunits. EMBO J 23: 2641– 2650.

36. Casellas P, Jeanteur P (1978) Protein methylation in animal cells. II. Inhibition of S-adenosyl-L-methionine:protein(arginine) N-methyltransfer-ase by analogs of S-adenosyl-L-homocysteine. Biochim Biophys Acta 519: 255–268.

Patient Summary

BackgroundDiseases of the circulation system are common and cause many deaths. Medical conditions associated with damage to the blood vessels include heart failure, high blood pressure, stroke, and kidney failure. The lining of the blood vessels plays an active role in maintaining their health. A substance called asymmetric dimethylarginine (ADMA) is found naturally in the vessel lining, both in healthy people and in people with vascular disease, but in the latter it is present at higher levels. Thus raised ADMA may be a marker of vascular disease. This means it could be used to help identify people with a circulation problem. However, it has not been clear whether ADMA actually causes any damage, i.e., whether it is more than just a marker.

What Did the Researchers Do and Find?The researchers are trying to find out whether elevated ADMA levels can cause vascular disease. In this study, they treated cells from blood vessel linings with levels of ADMA equal to those found in people with vascular disease and measured how gene activity changed in response. They found that a number of genes were more active when the cells were exposed to the elevated ADMA levels. Some of these were interesting because other studies suggest that they might be involved in lung, heart, and kidney disease.

What Do the Results Mean for Patients?This area of research is still at an exploratory stage. Additional studies need to examine which function (if any) the genes that respond to elevated ADMA levels play in vascular disease. If they do play active roles, drugs that inhibit them might help to prevent or treat vascular disease.

Where Can I Get More Information? For general information on cardiovascular disease see information provided by the following organisations.

The British Heart Foundation:

http://www.bhf.org.uk/hearthealth/index_home.asp?SecID¼1 The American Academy of Family Physicians:

http://familydoctor.org/292.xml

The National Heart, Lung, and Blood Institute: http://www.nhlbi.nih.gov/health/public/heart/index.htm New York Online Access to Health:

http://www.noah-health.org/en/blood/vascular/index.html University College London:

Referências

Documentos relacionados

The broad objective of the study is to analyze male and female access to land for cassava production in Abia state and specifically to describe the

To evaluate whether these changes in gene expression can be related to the transformation process of EP156T cells, we examined the expression of the genes of both clusters in a

albicans Caspofungin-Responsive Genes The expression profiles of 34 caspofungin-responsive genes that (i) exhibited a 2-fold change ( p , 0.05) in response to caspofungin treatment

Despite the differences in the total number of genes affected, all antibiotics induced a very similar gene expression pattern with an overrepresentation of genes encoding

To confirm that alterations in the mRNA expression profiles of the metabolic genes were reflected in protein expression, we performed IHC staining for 7 metabolic genes on

We analyzed differential gene expression within the context of time-mediated gene-expression changes and show that in the context of HBV replication a number of genes and

To determine the effects of o,p’ -DDT on the gene expression in granulosa cells, we examined the mRNA levels of genes that play important roles in ovarian functions.. These

Analysis of the number of genes differentially expressed in response to radiation at the two different doses was consistent with the idea that gene expression levels are dependent