• Nenhum resultado encontrado

STK31/TDRD8, a germ cell-specific factor, is dispensable for reproduction in mice.

N/A
N/A
Protected

Academic year: 2017

Share "STK31/TDRD8, a germ cell-specific factor, is dispensable for reproduction in mice."

Copied!
7
0
0

Texto

(1)

for Reproduction in Mice

Jian Zhou1, N. Adrian Leu1, Sigrid Eckardt2, K. John McLaughlin2, P. Jeremy Wang1*

1Department of Animal Biology, University of Pennsylvania School of Veterinary Medicine, Philadelphia, Pennsylvania, United States of America,2Research Institute at Nationwide Children’s Hospital, Columbus, Ohio, United States of America

Abstract

Tudor domain containing (Tdrd) proteins that are expressed in germ cells are divided into two groups. One group, consisting of TDRD1, TDRKH, TDRD9 and TDRD12, function in piRNA biogenesis and retrotransposon silencing, while the other group including RNF17/TDRD4 and TDRD5-7 are required for spermiogenesis. These Tdrd proteins play distinct roles during male germ cell development. Here, we report the characterization of STK31/TDRD8 in mice. STK31 contains a tudor domain and a serine/threonine kinase domain. We find that STK31 is a cytoplasmic protein in germ cells. STK31 is expressed in embryonic gonocytes of both sexes and postnatal spermatocytes and round spermatids in males. Disruption of the tudor domain and kinase domain of STK31 respectively does not affect fertility in mice. Our data suggest that the function of STK31 may be redundant with other Tdrd proteins in germ cell development.

Citation:Zhou J, Leu NA, Eckardt S, McLaughlin KJ, Wang PJ (2014) STK31/TDRD8, a Germ Cell-Specific Factor, Is Dispensable for Reproduction in Mice. PLoS ONE 9(2): e89471. doi:10.1371/journal.pone.0089471

Editor:Xiuhcun (Cindy) Tian, University of Connecticut, United States of America

ReceivedNovember 18, 2013;AcceptedJanuary 20, 2014;PublishedFebruary 19, 2014

Copyright:ß2014 Zhou et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Funding:This work was supported by National Institutes of Health/National Institute of General Medical Sciences (Grant number GM089893 and GM076327 to PJW). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Competing Interests:The authors have declared that no competing interests exist. * E-mail: [email protected]

Introduction

The tudor domain was originally identified as a conserved structural motif of approximately 60 amino acids in Drosophila Tudor protein, which is required for assembly of polar granules in germ plasm [1–3]. Tudor domains mediate protein-protein interactions by recognizing and binding the methylated arginines or lysines of target substrates to assemble macromolecular complex or granules at discrete cellular compartments [4,5]. The tudor proteins play important roles in many processes during develop-ment, such as genome stability, cell division and gametogenesis. Moreover, they are involved in many processes of RNA metabolism, including RNA splicing, miRNA/siRNA pathway, and piRNA pathway [6].

The piRNAs are a class of 26–31-nt germline-specific RNAs that are bound to members of the Piwi subfamily of Argonaute proteins. The function of piRNAs is associated with the silencing of transposons to protect the genome integrity during germ cell development [7,8]. In mice, there are three members of Piwi proteins, MILI (PIWIL2), MIWI (PIWIL1) and MIWI2 (PIWIL4). These Piwi proteins harbor multiple methylated arginine sites at conserved positions in N termini [9]. Tudor domain containing (Tdrd) proteins recognize the methylated arginines and bind Piwi proteins to function in piRNA biogenesis and spermiogenesis. TDRD1 interacts with MILI and participates in the primary piRNA biogenesis in intermitochondrial cements [10,11], while TDRD9 interacts with MIWI2 to function in secondary piRNA biogenesis in processing bodies [12]. TDRKH interacts with MIWI/MIWI2 and is involved in primary piRNA maturation [13]. TDRD12 interacts with MILI and is required for secondary piRNA biogenesis [14]. RNF17/TDRD4, TDRD6 and TDRD7

interact with MIWI and are essential for spermiogenesis [15–17]. TDRD5 is a component of intermitochondrial cement and chromatoid body and is required for repression of LINE1 transposons and spermiogenesis [18]. Therefore, Tdrd proteins are critical for male germ cell development.

Stk31was first identified as a germ cell-specific gene in a cDNA subtraction screen [19]. STK31 has been reported to interact with MIWI, suggesting a role in spermatogenesis [20]. To characterize the function of STK31, we made two lines of mutants by disrupting its tudor domain and kinase domain respectively. However, reproduction was not affected in either mutant, suggesting functional redundancy among Tdrd proteins.

Results

Specific expression of STK31 in germ cells

(2)

We next determined the spatiotemporal distribution of STK31 by immunostaining of adult testis sections. ACRV1 is a marker of acrosome [21]. To determine the stages of the STK31 expression, we performed double immunostaining of testis sections with anti-STK31 and anti-ACRV1 antibodies (Fig. 2). anti-STK31 was expressed at a very low level in spermatogonia and prepachytene spermatocytes. STK31 was highly expressed in pachytene spermatocytes through round spermatids up to step 5. STK31 was not detectable in spermatids of step 6 and beyond. As expected, STK31 was not detected in epididymal sperm by western blot analysis (Fig. S1).

We then examined the expression of STK31 in embryonic germ cells. Immunofluorescence analysis revealed that STK31 expres-sion in the testis started at E14.5 and significantly increased at E17.5 (Fig. S2A, B). These observations are consistent with human STK31 expression in gonocytes [22]. TheStk31expression in fetal mouse ovaries was reported by Olesenet al[23]. They performed microarray analysis to compare RNA profile of E13.5 ovaries with E11.5 ovaries and found thatStk31mRNA level was significantly increased. To determine the subcellular localization of STK31 in the ovary, we performed immunostaining of embryonic and postnatal ovaries. STK31 protein was localized in the cytoplasm of oocytes in E15.5 and E17.5 ovaries (Fig. S2C, D). MSY2 is a marker of oocytes in the ovary [24]. At postnatal day 10, STK31 was highly expressed in primordial follicles (Fig. S3). MSY2 expression was higher in growing follicles than in primordial

follicles. In contrast, STK31 level was decreased in growing follicles compared with primordial follicles.

STK31 localization overlaps with intermitochondrial cements and processing bodies

The protein components of the piRNA pathway localize to cytoplasmic nuage in the germ cells, such as intermitochondrial cement (IMC) and processing body (P-body). For instance, MILI, TDRD1 and DDX4 localize to IMC in pro-spermatogonia and pachytene spermatocytes, while MIWI2 and TDRD9 are compo-nents of the P-body [10–12]. To exam potential co-localization of STK31 with the piRNA pathway components, we performed co-immunostaining analysis of STK31 with MILI, DDX4 and MIWI2. In spermatocytes, STK31 colocalized with MILI and DDX4 (Fig. 3A, B). In pro-spermatogonia, STK31 granules partially overlapped with cytoplasmic MIWI2 foci (Fig. 3C) but not with nuclear MIWI2 (Fig. 3D). These colocalization results suggest that STK31 may function in the piRNA pathway.

Figure 1. Tissue-specific and temporal expression of STK31.(A) Diagram of predicted tudor and kinase domains in mouse STK31 protein. The C-terminal (919–1018aa) fragment was used as antigen for antibody production. (B) Western blot analysis of STK31 in adult mouse tissues. Anti-STK31 antibody GP79 was used. (C) Western blot analysis of STK31 and DDX4 in testes from mice of different postnatal ages. DDX4 is germ cell-specific and is expressed from prespermatogonia to round spermatids in testes. Note that DDX4 expression increases with the development of postnatal testes and reaches the maximum around postnatal day 12. ACTB served as a ubiquitous control.

doi:10.1371/journal.pone.0089471.g001

Figure 2. Expression pattern and localization of STK31 in adult testes. (A-C) Expression of STK31 in representative seminiferous tubules. Testis sections from adult mice were immunostained with anti-STK31 antibody UP2169 (green) and anti-ACRV1 antibody (red). Nuclei were stained with DAPI. The shape of acrosome showed by ACRV1 and the morphology of nuclei were used to determine the stages of seminiferous tubules. (D) Diagram of STK31 protein (green) localization during spermatogenesis. Stages (I-XII) of spermatogenesis are indicated below. Abbreviations: SG, spermatogonia; PL, prelepto-tene spermatocytes; L, leptoprelepto-tene spermatocytes; Z, zygoprelepto-tene sper-matocytes; Pa, pachytene spersper-matocytes; RS, round spermatids; ES, elongating/elongated spermatids. Scale bar, 50mm.

(3)

Deletion of STK31 tudor domain in mice

The Stk31 gene encodes a protein of 1018 amino acids, containing a tudor domain close to its N terminus and a kinase domain at the C terminus (Fig. 4A). The conservative estimate of tudor domain is 81–135 amino acids (SMART) or 28–147 amino acids (PFAM). To specifically delete the tudor domain, we generated a conditional mutant allele (Stk31fl) with one loxP site in intron 4 and one in intron 6 (Fig. 4A). Exons 5 and 6 encode aa 84–161. The mutant transcript was expected to maintain its reading frame.Stk31flmice were crossed withActb-Cre to delete exons 5 and 6.Actb-Cre is ubiquitously expressed [25]. The tudor deletion male and female mice appeared to be healthy and fertile. The size of mutant testes was comparable to that of controls (Fig. 4B). Western blot analysis with our STK31 antibody GP79 showed that the mutant protein was present and appeared to be less abundant (Fig. 4C). Histology of mutant testis appeared to be normal (Fig. 4D). These mice were generated on a mixed genetic background. After backcrossing to the C57BL/6J strain for six generations, mutant male mice were still fertile with normal testis weight and normal sperm count (Table 1). In summary, the tudor domain of STK31 is dispensable for spermatogenesis in mice.

Disruption of STK31 kinase domain in mice

The kinase domain remained intact in theStk31mouse mutant with the deletion of its tudor domain. To disrupt the kinase domain, we used the neo cassette to replace the DNA fragment harboring exons 17–21, removing residues 691–880 (Fig. 5A). The most conservative prediction of the kinase domain is 800–923 amino acids, starting in exon 19. Interbreeding of heterozygous mice yielded a normal Mendelian ratio of offspring (+/+,+/–, –/– : 57, 102, 59), suggesting lack of lethality inStk31-deficient pups. Both Stk312/2 male and female mice appeared to be grossly

healthy and fertile. The size ofStk312/2testis was comparable to

that of wild type littermates (Fig. 5B). RT-PCR and sequencing results confirmed that exon 22 is linked to exon 16 in theStk31 mutant mRNA from Stk312/2 testis. Exons 22-24 were still in

frame and contained the antigen fragment for our anti-STK31 antibody GP79 (Fig. 1A). However, western blot analysis with antibody GP79 showed that STK31 protein was absent in the Stk312/2testis (Fig. 5C). In addition, immunofluorescence analysis

with antibody GP79 showed the absence of STK31 in theStk312/

2testis (Fig. 5D). These results showed that this mutant lacking the

STK31 kinase domain is null. Histology of Stk312/2 testis

appeared to be normal (Fig. 5E). These mice were generated on a mixed genetic background. After backcrossing to the C57BL/6J strain for ten generations,Stk312/2 male mice were still fertile

with normal testis weight and normal sperm count (Table 1).

STK31 is not a component of the DNA damage checkpoint in oocytes

Since STK31 is expressed in oocytes throughout oogenesis, we wondered whether it plays a role in the DNA damage checkpoint, which triggers apoptosis of oocytes upon DNA damage. To test this possibility, we treated young pups with c-irradiation and

analyzed the survival of oocytes by immunostaining with MSY2 antibody [24,26,27]. Both wild type and mutant ovaries lack primordial follicles, suggesting that the DNA damage checkpoint is intact (Fig. S4). This result suggests that STK31 did not function in DNA damage-induced apoptosis in ovaries.

Discussion

Previous genetic studies have shown that Tdrd proteins play distinct roles in piRNA biogenesis and spermiogenesis. However, our present study demonstrates that STK31 is not essential for spermatogenesis. A recent study also showed that STK31 is dispensable for spermatogenesis [28]. Except STK31, six members of Tdrd proteins are expressed in pre-spermatogonia. In Tdrkh, Tdrd9andTdrd12mutants, male germ cell development is arrested at the zygotene stage of meiosis [12–14]. In Tdrd1, Tdrd5 and Tdrd7mutants, LINE1 expression is derepressed and the apoptotic cells increase, but at least part of germ cells go through meiosis and arrest at round spermatid stage [17,18,29]. TDRD1, TDRD5, TDRD6 and TDRD7 are components of chromatoid bodies in round spermatids and RNF17 forms distinct granules in spermatocytes. They are required for post-meiotic germ cell development [30,31]. STK31 does not localize to chromatoid bodies or RNF17 granules. Recently, two studies reported that STK31 localizes to equatorial segment of acrosome in sperm [20,32]. In contrast, we did not observe this signal in immuno-fluorescence assay. Our western blot analysis showed that STK31 was undetectable in epididymis and isolated epididymal sperm. Our antibody is highly specific. Therefore, the previous report on the localization of STK31 in sperm might result from non-specific cross-reaction of their antibodies [20,32].

Figure 3. Co-localization of STK31 with MILI, DDX4 and MIWI2 in male germ cells. (A, B) Testis sections from adult mice were immunostained with anti-STK31 antibody GP79 (red) and anti-MILI antibody (green) or anti-DDX4 antibody (green). Nuclei were stained with DAPI. (C) Testis sections from E17.5 embryos were immunostained with anti-STK31 antibody GP79 (red) and anti-MIWI2 antibody (green). Pa, pachytene spermatocytes; RS, round spermatids. (D) The same images as in panel C without the DAPI channel. Scale bar, 50mm (A, B),

10mm (C, D).

(4)

Table 1.Testis weight and sperm production inStk31mutant mice.

Tudor domain deletiona Kinase domain deletiona

+/+or+/– (n = 8) –/– (n = 8) P-valueb

+/+or+/– (n = 7) –/– (n = 7) P-valueb

Body weight (g) 23.061.8 23.861.5 0.36 23.461.0 23.561.1 0.9

Testis weight (mg) 170.8619.8 179.5613.0 0.32 169.9615.2 173.2610.9 0.65

Sperm/cauda (106) 8.6

61.5 8.761.5 0.88 8.561.4 8.961.1 0.59

a Mice backcrossed to the C57BL/6J strain for six generations for tudor domain deletion mutant and ten generations for kinase domain deletion mutant were used at 8 weeks of age.

b ByStudent’s T-test.

doi:10.1371/journal.pone.0089471.t001

Figure 4. Tudor domain of STK31 is not required for spermatogenesis.(A) Targeted disruption of the tudor domain in theStk31gene. MouseStk31gene (encoding a protein of 1018 aa) has 24 exons over a 74-kb genomic region on Chr. 6. The targeting strategy is to flox exon 5 and 6

(encoding 84–161 aa). The floxed region was removed by crossing withActB-Cre mice. (B) Testis size of 8-wk-old wild type and mutant mice. (C) Western blot analysis of 8-wk-old wild type,Stk31+/2andStk312/2testes. The mutant protein (Stk31D) was less abundant. The small band (*) resulted

possibly from degradation of the mutant protein or alternative splicing of the mutant allele. Anti-STK31 antibody GP79 was used. (D) Histological analysis of 8-wk-old wild type and mutant testes. Scale bar, 50mm.

(5)

Several Tdrd proteins are expressed in mouse ovary. TDRD1 and TDRD9 are expressed in growing oocytes, but show different localization [12,29]. TDRD1 only localizes to the cytoplasm with a granular appearance, while TDRD9 localizes to both cytoplasm and nucleus without any granule. TDRD5 is also expressed in the ovary, but its localization has not been reported [18]. STK31 is expressed in oocytes from embryonic stage to adult and localizes to cytoplasm without particular appearance. However, the female mutants of all Tdrd and Piwi factors are fertile. Recently, it has been hypothesized that MARF1 instead silences retrotransposons in mouse female germline [33,34].

Protein phosphorylation and dephosphorylation have been illustrated in many signaling pathways, including the apoptotic pathway [35]. A recent study showed that TDRKH-deficient spermatocytes were eliminated through a non-apoptotic pathway, suggesting a role of Tdrd proteins in the cell death pathway [13].

STK31 is highly expressed in primordial follicle oocytes in ovaries. The primordial follicle oocytes are very sensitive to DNA damage. The c-irradiation-induced DNA damage results in apoptosis of

primordial follicle oocytes through activation of p63 [26]. STK31 deficiency does not rescue primordial follicle oocytes from apoptosis, suggesting that STK31 may not function in apoptotic pathway in oocytes.

A number of germline-specific genes are expressed in human cancers [36]. These factors are potential targets for cancer immunotherapy and are thus referred to as ‘‘cancer/testis antigens’’ [37]. HumanSTK31 was reported to be expressed in gastrointestinal cancers, including esophageal, gastric, colonic and colorectal cancers [38,39]. Knockdown ofSTK31in colonic cancer cells promotes cell differentiation and thus suppresses tumorige-nicity [39]. In addition, the kinase domain in STK31 is required for its tumor-suppressing activity. Therefore, STK31 might be involved in tumorigenesis and is a potential target for immuno-therapy in gastrointestinal cancers.

In summary, we described the expression and localization of STK31 in male and female germ cells. Our two mutants ofStk31 showed that this gene was dispensable for spermatogenesis and oogenesis. To elucidate the redundant role of Tdrd proteins, double or triple knockout ofStk31with other Tdrd genes may be necessary. Furthermore, ourStk31mutant mice will be useful for genetically testing the tumor-suppressing activity of STK31 in gastrointestinal cancer mouse models.

Materials and Methods

Ethics statement

Mice were maintained and used according to standards approved by the Institutional Animal Care and Use Committee (IACUC) of the University of Pennsylvania. Full details of the study were approved in IACUC protocol#804050. Tissues were collected after euthanasia. Mice were euthanized by CO2 inhalation and were monitored to assure that respiration has stopped and does not resume.

Generation of antibodies

GST-mouse STK31 (amino acids 919–1018) was expressed in E. colistrain BL21 using the pGEX-4T-1 vector (Fig. 1A). After affinity purification with glutathione sepharose, the fusion protein was used to immunize rabbits and guinea pigs, resulting in anti-STK31 rabbit serum UP2169 and guinea pig serum GP79 (Cocalico Biologicals). The antibodies were purified by affinity immunoblotting and were diluted (1:50) for western blot analysis.

Targeted disruption of theStk31gene

Mutant 1 (Fig. 4A): disruption of the tudor domain in theStk31 gene. Three DNA fragments (2.2 kb, 2.9 kb and 2.3 kb) were amplified by high-fidelity PCR using an Stk31-containing BAC clone (RP23-64D14) as template. The HyTK cassette was flanked by two loxP sites in the targeting construct. The V6.5 ES cells were electroporated with the linearized construct (ClaI) and selected in the presence of hygromycin (120mg/ml, Roche). By screening 196 ES clones, we identified eightStk313loxclones. TwoStk313lox ES cell lines were electroporated with the Cre-expressing pOG231 plasmid to remove the HyTK cassette. Two ES clones were injected into B6C3F1 (Taconic) blastocysts and theStk31fl allele was transmitted through the germline in chimeric mice. Stk31fl mice were crossed with the ubiquitously expressing Actb-Cre to deleteStk31floxed region [25]. TheStk31mutant (479 bp) allele was assayed by PCR with primers AAGTCCAGCAAT-CAAAAGCC and GTAGCCTAGTATAATGGACTCTGG.

Figure 5. The kinase domain of STK31 is dispensable for spermatogenesis.(A) Targeted deletion of the kinase domain in the

Stk31 gene. The targeting strategy is to delete exons 17–21 (5.16 kb

genomic region) by replacing it with the PGK-Neo selection cassette. (B) Comparable size of wild type and mutant testes from mice at the age of 8 weeks. (C) Western blot analysis of 8-wk-old wild type,Stk31+/2, and Stk312/2 testes. The mutant protein was undetectable. Anti-STK31

antibody GP79 was used. (D) Immunofluorescence analysis of the STK31 protein in adult wild type andStk312/2testes. (E) Histological analysis

of 8-wk-old wild type andStk312/2testes. Scale bar, 50mm.

(6)

Mutant 2 (Fig. 5A): deletion of the kinase domain in theStk31 gene. Two DNA fragments (2.2 kb and 2.5 kb) were amplified using the same BAC clone as template. The Neo and HyTK cassettes were used for positive and negative selections respective-ly. The V6.5 ES cells were electroporated with the linearized construct (ClaI) and selected in the presence of G418 (350mg/ml, Gibco) and ganciclovir (2mM, Sigma). By screening 196 ES clones, we identified one Stk31 targeted clone (2A9). The Stk31 mutant allele was transmitted through the germline in chimeric mice. All offspring were genotyped by PCR with the primers GGGATACCAAGTGAGAGCTGTC and CCAAACCCTATG-TCTTCCTACTC for the wild type allele (527 bp), TTCCTGA-AAAGCAACATACTACAGTT and CCTACCGGTGGATGT-GGAATGTGTG for the mutant allele (335 bp).

Western blot

The tissues collected from mice at different ages were homogenized in the SDS-PAGE sample buffer and then were heated at 95uC for 10 minutes. Protein lysates were separated on 10% SDS-PAGE gel and electro-blotted on PVDF membranes. The primary antibodies used for western blot analysis were anti-STK31 GP79 (this study), anti-DDX4 (a gift from T. Noce) [40], anti-ACTB (Sigma-Aldrich), and anti-MNS1 UP2060 [41].

Histological and immunofluorescence analyses

For histology, testes were fixed in Bouin’s solution overnight, processed, sectioned, and stained with hematoxylin and eosin. For immunofluorescence analysis, ovaries and testes were fixed in 4% PFA at 4uC for 3 hours and overnight respectively, dehydrated in 30% sucrose overnight, frozen in dry ice/95% ethanol, and sectioned at –20uC. The primary antibodies used for immunoflu-orescence analysis were anti-STK31 UP2169 and GP79 (this study), anti-ACRV1 (a gift from P. Reddi) [21], anti-DDX4 (a gift from T. Noce) [40], anti-MIWI2 (a gift from R. Pillai), anti-Mili (Abcam) and anti-MSY2 (a gift from R. Schultz) [24].

Supporting Information

Figure S1 The STK31 protein was undetectable in the sperm from cauda epididymis.Sperm were collected from wild type cauda epididymis. Western blot analysis of testis and sperm was performed using anti-STK31 antibody GP79 and

anti-MNS1 antibody UP2060. MNS1, a component of sperm flagella, served as a control.

(TIF)

Figure S2 Expression of STK31 in embryonic testes and ovaries. (A, B) Sections from embryonic testes were immuno-stained with anti-STK31 antibody GP79 (green). The STK31pro-tein was detected in testis at E14.5 (A). Large granules of STK31 were observed in the cytoplasm of gonocytes at E17.5 (B). (C, D) STK31 expression in female germ cells. The STK31protein was detected in ovary at E15.5 (C). No STK31 granule was observed in oocytes at E17.5 (D). Scale bar, 50mm.

(TIF)

Figure S3 Dynamic expression and localization of STK31 in primordial and growing follicles.Ovary sections from 10-day-old wild type (A) and kinase domain mutant (B) mice were immunostained with anti-STK31 antibody GP79 (green) and anti-MSY2 antibody (red). Nuclei were stained with DAPI. The abundance of STK31 protein was high in primordial follicles and low in growing follicles. STK31 protein was undetectable in the mutant ovary. PF, primordial follicle; GF, growing follicle. Scale bar, 50mm.

(TIF)

Figure S4 Loss of STK31 did not rescue primordial follicle oocytes from DNA damage-induced apoptosis. Female pups (postnatal day 5) were untreated (A) or exposed to 0.45 Gy ofc-irradiation (B, C). Ovary sections from wild type and STK31 kinase domain mutant mice at postnatal day 10 were stained with anti-MSY2 antibody (green). PF, primordial follicle; GF, growing follicle. Scale bar, 50mm.

(TIF)

Acknowledgments

We thank T. Noce for anti-DDX4 antibody, P. P. Reddi for anti-ACRV1 antibody, R. S. Pillai for MIWI2 antibody, and R. M. Schultz for anti-MSY2 antibody. We thank Fang Yang and Ke Zheng for help in this study.

Author Contributions

Conceived and designed the experiments: JZ PJW. Performed the experiments: JZ NAL SE KJM. Analyzed the data: JZ PJW. Wrote the paper: JZ PJW.

References

1. Boswell RE, Mahowald AP (1985) Tudor, a gene required for assembly of the germ plasm in drosophila melanogaster. Cell 43: 97–104.

2. Callebaut I, Mornon JP (1997) The human EBNA-2 coactivator p100: Multidomain organization and relationship to the staphylococcal nuclease fold and to the tudor protein involved in drosophila melanogaster development. Biochem J 321 ( Pt 1): 125–132.

3. Ponting CP (1997) Tudor domains in proteins that interact with RNA. Trends Biochem Sci 22: 51–52.

4. Liu H, Wang JY, Huang Y, Li Z, Gong W, et al. (2010) Structural basis for methylarginine-dependent recognition of aubergine by tudor. Genes Dev 24: 1876–1881.

5. Botuyan MV, Lee J, Ward IM, Kim JE, Thompson JR, et al. (2006) Structural basis for the methylation state-specific recognition of histone H4-K20 by 53BP1 and Crb2 in DNA repair. Cell 127: 1361–1373.

6. Pek JW, Anand A, Kai T (2012) Tudor domain proteins in development. Development 139: 2255–2266.

7. Thomson T, Lin H (2009) The biogenesis and function of PIWI proteins and piRNAs: Progress and prospect. Annu Rev Cell Dev Biol 25: 355–376. 8. Malone CD, Hannon GJ (2009) Small RNAs as guardians of the genome. Cell

136: 656–668.

9. Vagin VV, Wohlschlegel J, Qu J, Jonsson Z, Huang X, et al. (2009) Proteomic analysis of murine piwi proteins reveals a role for arginine methylation in specifying interaction with tudor family members. Genes Dev 23: 1749–1762.

10. Wang J, Saxe JP, Tanaka T, Chuma S, Lin H (2009) Mili interacts with tudor domain-containing protein 1 in regulating spermatogenesis. Curr Biol 19: 640– 644.

11. Reuter M, Chuma S, Tanaka T, Franz T, Stark A, et al. (2009) Loss of the mili-interacting tudor domain-containing protein-1 activates transposons and alters the mili-associated small RNA profile. Nat Struct Mol Biol 16: 639–646. 12. Shoji M, Tanaka T, Hosokawa M, Reuter M, Stark A, et al. (2009) The

TDRD9-MIWI2 complex is essential for piRNA-mediated retrotransposon silencing in the mouse male germline. Dev Cell 17: 775–787.

13. Saxe JP, Chen M, Zhao H, Lin H (2013) Tdrkh is essential for spermatogenesis and participates in primary piRNA biogenesis in the germline. EMBO J 32: 1869–1885.

14. Pandey RR, Tokuzawa Y, Yang Z, Hayashi E, Ichisaka T, et al. (2013) Tudor domain containing 12 (TDRD12) is essential for secondary PIWI interacting RNA biogenesis in mice. Proc Natl Acad Sci U S A 110: 16492–16497. 15. Pan J, Goodheart M, Chuma S, Nakatsuji N, Page DC, et al. (2005) RNF17, a

component of the mammalian germ cell nuage, is essential for spermiogenesis. Development 132: 4029–4039.

16. Vasileva A, Tiedau D, Firooznia A, Muller-Reichert T, Jessberger R (2009) Tdrd6 is required for spermiogenesis, chromatoid body architecture, and regulation of miRNA expression. Curr Biol 19: 630–639.

(7)

18. Yabuta Y, Ohta H, Abe T, Kurimoto K, Chuma S, et al. (2011) TDRD5 is required for retrotransposon silencing, chromatoid body assembly, and spermiogenesis in mice. J Cell Biol 192: 781–795.

19. Wang PJ, McCarrey JR, Yang F, Page DC (2001) An abundance of X-linked genes expressed in spermatogonia. Nat Genet 27: 422–426.

20. Bao J, Wang L, Lei J, Hu Y, Liu Y, et al. (2012) STK31(TDRD8) is dynamically regulated throughout mouse spermatogenesis and interacts with MIWI protein. Histochem Cell Biol 137: 377–389.

21. Reddi PP, Naaby-Hansen S, Aguolnik I, Tsai JY, Silver LM, et al. (1995) Complementary deoxyribonucleic acid cloning and characterization of mSP-10: The mouse homologue of human acrosomal protein SP-10. Biol Reprod 53: 873–881.

22. Wu X, Schmidt JA, Avarbock MR, Tobias JW, Carlson CA, et al. (2009) Prepubertal human spermatogonia and mouse gonocytes share conserved gene expression of germline stem cell regulatory molecules. Proc Natl Acad Sci U S A 106: 21672–21677.

23. Olesen C, Nyeng P, Kalisz M, Jensen TH, Moller M, et al. (2007) Global gene expression analysis in fetal mouse ovaries with and without meiosis and comparison of selected genes with meiosis in the testis. Cell Tissue Res 328: 207– 221.

24. Yu J, Hecht NB, Schultz RM (2001) Expression of MSY2 in mouse oocytes and preimplantation embryos. Biol Reprod 65: 1260–1270.

25. Lewandoski M, Meyers EN, Martin GR (1997) Analysis of Fgf8 gene function in vertebrate development. Cold Spring Harb Symp Quant Biol 62: 159–168. 26. Suh EK, Yang A, Kettenbach A, Bamberger C, Michaelis AH, et al. (2006) P63

protects the female germ line during meiotic arrest. Nature 444: 624–628. 27. Kerr JB, Hutt KJ, Michalak EM, Cook M, Vandenberg CJ, et al. (2012) DNA

damage-induced primordial follicle oocyte apoptosis and loss of fertility require TAp63-mediated induction of puma and noxa. Mol Cell 48: 343–352. 28. Bao J, Yuan S, Maestas A, Bhetwal BP, Schuster A, et al. (2013) Stk31 is

dispensable for embryonic development and spermatogenesis in mice. Mol Reprod Dev.

29. Chuma S, Hosokawa M, Kitamura K, Kasai S, Fujioka M, et al. (2006) Tdrd1/ Mtr-1, a tudor-related gene, is essential for male germ-cell differentiation and

nuage/germinal granule formation in mice. Proc Natl Acad Sci U S A 103: 15894–15899.

30. Zhang Z, Xu J, Koppetsch BS, Wang J, Tipping C, et al. (2011) Heterotypic piRNA ping-pong requires qin, a protein with both E3 ligase and tudor domains. Mol Cell 44: 572–584.

31. Anand A, Kai T (2012) The tudor domain protein kumo is required to assemble the nuage and to generate germline piRNAs in drosophila. EMBO J 31: 870– 882.

32. Sabeur K, Ball BA, Corbin CJ, Conley A (2008) Characterization of a novel, testis-specific equine serine/threonine kinase. Mol Reprod Dev 75: 867–873. 33. Su YQ, Sugiura K, Sun F, Pendola JK, Cox GA, et al. (2012) MARF1 regulates

essential oogenic processes in mice. Science 335: 1496–1499.

34. Su YQ, Sun F, Handel MA, Schimenti JC, Eppig JJ. (2012) Meiosis arrest female 1 (MARF1) has nuage-like function in mammalian oocytes. Proc Natl Acad Sci U S A 109: 18653–18660.

35. Kurokawa M, Kornbluth S (2009) Caspases and kinases in a death grip. Cell 138: 838–854.

36. Simpson AJ, Caballero OL, Jungbluth A, Chen YT, Old LJ (2005) Cancer/testis antigens, gametogenesis and cancer. Nat Rev Cancer 5: 615–625.

37. Scanlan MJ, Simpson AJ, Old LJ (2004) The cancer/testis genes: Review, standardization, and commentary. Cancer Immun 4: 1.

38. Yokoe T, Tanaka F, Mimori K, Inoue H, Ohmachi T, et al. (2008) Efficient identification of a novel cancer/testis antigen for immunotherapy using three-step microarray analysis. Cancer Res 68: 1074–1082.

39. Fok KL, Chung CM, Yi SQ, Jiang X, Sun X, et al. (2012) STK31 maintains the undifferentiated state of colon cancer cells. Carcinogenesis 33: 2044–2053. 40. Fujiwara Y, Komiya T, Kawabata H, Sato M, Fujimoto H, et al. (1994) Isolation

of a DEAD-family protein gene that encodes a murine homolog of drosophila vasa and its specific expression in germ cell lineage. Proc Natl Acad Sci U S A 91: 12258–12262.

Referências

Documentos relacionados

A compreensão dos efeitos dos elementos sensoriais numa experiência de consumo dos consumidores, num ambiente tão distinto e único como são as caves, contribui

Equal cell equivalents of the fractions were subjected to western blot analyses, which showed that the native Rv0132c protein is present in the cell wall and membrane fractions of

Nesse período, ficou praticamente completa a criação de organismos essenciais para estruturar a intervenção estatal na economia: organismos de coordenação econômica, que

6 § 2º No âmbito do Contrato Organizativo, caberão às autoridades mencionadas no caput, em acordo com a instituição de educação superior e os Programas de

6xHis fusion protein expression in Sf-9 cells in- fected with the recombinant virus was confirmed by West- ern Blot analysis, using VD1-ORF4 protein-specific antibodies (Figure

Os an ne- xos esquerdos são mais predispostos do que os direitos á inflammação, e, nos casos em que a inflammação invadiu os dois lados o ovário e a trompa esquerda estão mais

Assim, este trabalho tem como objetivo, possibilitar reflexão sobre alimentos funcionais, visando contribuir para a saúde das pessoas, a fim de viabilizar a melhoria da

On the other hand, rats that underwent experimental varicocele creation showed significantly increased levels of germ cell apoptosis in the ipsilateral testis 14 days