Richard A. Hurt Jr., Steven D. Brown, Mircea Podar, Anthony V. Palumbo, Dwayne A. Elias*
Biosciences Division, Oak Ridge National Laboratory, Oak Ridge, Tennessee, United States of America
Abstract
Advancement in high throughput DNA sequencing technologies has supported a rapid proliferation of microbial genome sequencing projects, providing the genetic blueprint for in-depth studies. Oftentimes, difficult to sequence regions in microbial genomes are ruled ‘‘intractable’’ resulting in a growing number of genomes with sequence gaps deposited in databases. A procedure was developed to sequence such problematic regions in the ‘‘non-contiguous finished’’
Desulfovibrio desulfuricansND132 genome (6 intractable gaps) and theDesulfovibrio africanusgenome (1 intractable gap). The polynucleotides surrounding each gap formed GC rich secondary structures making the regions refractory to amplification and sequencing. Strand-displacing DNA polymerases used in concert with a novel ramped PCR extension cycle supported amplification and closure of all gap regions in both genomes. The developed procedures support accurate gene annotation, and provide a step-wise method that reduces the effort required for genome finishing.
Citation:Hurt RA Jr., Brown SD, Podar M, Palumbo AV, Elias DA (2012) Sequencing Intractable DNA to Close Microbial Genomes. PLoS ONE 7(7): e41295. doi:10.1371/journal.pone.0041295
Editor:Sarah K. Highlander, Baylor College of Medicine, United States of America
ReceivedApril 9, 2012;AcceptedJune 19, 2012;PublishedJuly 31, 2012
Copyright:ß2012 Hurt et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Funding:This research was conducted as part of the Oak Ridge National Laboratory Mercury Science Focus Area and was supported by The United States Department of Energy under the Subsurface Biogeochemical Research Program (SBR), Office of Biological and Environmental Research, Office of Science. Oak Ridge National Laboratory is managed by University of Tennessee UT-Battelle LLC for the Department of Energy under Contract No. DE-AC05-00OR22725. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Competing Interests:The authors have declared that no competing interests exist.
* E-mail: [email protected]
Introduction
The emergence of high-throughput next generation DNA sequencing technologies has increased the speed and reduced the cost of genome sequencing [1,2]. There are many reasons that a closed and finished microbial genome is important, including support for functional genomics, comparative genomics, microbial forensics, and genome organization studies [3,4]. A finished genome is defined as having less than one nucleotide (nt) error in 105nt positions with no gaps in the sequence data [5].
Despite this rapid growth in DNA sequencing throughput, there have been few advances in genome finishing, causing a growing disparity in the number of finished genomes and genomes that have gaps in the sequence data deposited in databases [5]. This is in part due to limited advances in sequencing refractory DNA regions, even when complementary or hybrid approaches are used in conjunction with dedicated and directed finishing efforts. Notable advances in computational assembly have reduced the workload involved with acquired sequence data [6,7,8,9]. How-ever, the final stage of genome closure most often requires new data from DNA that is difficult to sequence. Sources of these difficult DNA regions include hairpin structures, elevated %(G+
C), homopolymeric stretches, and repeats with numerous approaches and techniques used to overcome some of them [10,11,12].
Often with genome finishing, as the number of gaps decreases, the difficulty with closing the remaining gaps increases until no further progress can be made, and the remaining gaps are ruled intractable. This common problem bore enough weight that a new category ‘‘non-contiguous finished’’ was introduced to describe genomes with intractable gaps [5]. Without the ability to sequence such intractable regions, advancements in assembly cannot help.
To date, sequencing refractory regions remains dependent on conventional Sanger methods, which are time and cost-intensive [13,14,15].
Two ‘‘non-contiguous finished’’, mercury-methylating, sulfate-reducing bacteria were used in development of the method described herein to finish and close the genomes. The model organism for mercury (Hg) methylation, Desulfovibrio desulfuricans
strain ND132, was isolated from the Chesapeake Bay, and generates high levels of toxic methylmercury (MeHg) [16,17]. The ND132 genome was sequenced by the DOE Joint Genome Institute (JGI) to support a comparative genomics approach in identifying genes responsible for Hg methylation [18,19]. Se-quence was generated using Illumina and Titanium 454 DNA technologies [20,21] and provided 1226 coverage and 406 coverage, respectively. Sequencing was followed by extensive standard and ‘‘high GC’’ finishing that produced a genome consisting of one scaffold and six contiguous segments (GenBank CP003220.1). The genome of D. africanus was sequenced with similar goals [19], and similar effort resulted in one scaffold and one contiguous segment separated by a single gap (GenBank CP003221.1). A process is presented herein to resolve such recalcitrant regions. The ability to sequence all nucleotides within genomes eliminates gaps that could contain open reading frames, ensuring accurate genome annotation. Faster and less laborious procedures for complete genome closure will allow for more confident comparative and functional genomic studies that can benefit many groups facing similar situations.
Results
The cause of the sequence gaps in the depositedD. desulfuricans
stops’’. During the search for PCR conditions that would support preparation of DNA sequencing templates, an approach for surveying the sequences surrounding each gap was adopted so that commonalities among the recalcitrant regions could be identified. The result from this latter effort suggested a requirement for polymerases and PCR thermal-cycling conditions with tailored properties. Once template amplification conditions were identi-fied, the gaps were sequenced using established amendments to Sanger sequencing. The outcome is a simple process that supports closure of ‘‘intractable’’ sequence gaps caused by self-annealing high %(G+C) DNA to produce finished genomes. Now that the tailored survey approach and amplification conditions have been standardized for Sanger sequencing, this approach can be amended to the standard finishing methods used following the initial next generation sequencing effort.
Sequence Evaluation
High %(G+C) regions were identified within 100 nt of all gaps that included long tandem iterations of the same nucleotide. Further, nucleotides adjacent to all 6 gaps were high %(G+ C) with bases on either side of the gaps complementing to produce secondary (2o) structure (Figure S1). The DNA sequence surrounding gaps 1 and 2 exhibited substantial primary (1o) and 2ostructural similarity. Moreover, alignment searches using 50 nt surrounding gaps 1 and 2 identified a position on the annotated
Desulfovibrio aspoeensis genome located at a junction between a PhoH family protein on the 59side and the formylmethanofuran dehydrogenase subunit E encoded on the 39 side. DNA folding analysis revealed evidence of 2ostructure showing strong thermal stability surrounding all of the gaps in the ND132 genome; except for gap 5, which would not fold at 60uC (Figure S1 and Table S1). Database alignment searches using 100 nt artificial contigs, constructed using 50 nt from either side of each gap, showed that all of the gaps were at or near the junction between two coding regions [22,23].
Gap Region Amplification
PCR optimization withTaqDNA polymerase included testing various PCR additives and 30 mer primers with no resultingD. desulfuricansND132 amplification products. Initial (30 mer) primers targeted positions several hundred bases from the gaps to prevent amplification failure caused by any potential assembly problems (Table 1). PCR development initiated withTaqDNA polymerase used 2 min extensions at 72uC because most amplification products were anticipated to be ,2 Kbp. Standard PCR optimization strategies including gradient thermal cycling to determine an optimal annealing temperature, along with varia-tions in Mg2+, formamide, dimethylsulfoxide, primer, and
template concentrations only produced amplification of gap 4 (Table 2).
A ramped PCR extension cycle (72uC 61 min and 75uC 61 min) combined with either 5% or 10% DMSO supported amplification of gaps 1–4 usingTaqDNA polymerase. However, product generation was inconsistent and invariably produced co-amplified artifacts (Table 2, Figure S2A). The GC-Rich PCR System (Roche) only supported gap 5 and gap 6 amplification using a two-temperature ramped extension segment during thermal-cycling. This was unexpected because gaps 5 and 6 were not amplified with Taq DNA polymerase under any conditions. Gap 1 and 2 PCR products reproducibly exhibited distinctive hard stop signatures. There were two artifacts, smaller than the intended products, for each of the six PCRs targeting gaps 1 and 2, likely resulting from polymerase rejection at hard stops (Figure S2B). Amplification using strand-displacing (SD) DNA
polymerases eliminated co-amplified artifacts from all gap PCRs. All gap 3 PCRs catalyzed by Taq DNA polymerase yielded insufficient product to serve as template in 25 thermal-cycles.
The ramped extension cycle with Taq DNA polymerase
supported gap 4 amplification without additives. However, all three of the gap 4 PCR products were ,250 bp smaller than expected, based on the deposited sequence data. Gap 4 forward sequences read into the gap with high quality sequence, while the reverse reaction was correct for the first 200 nt and then diverged to no significant similarity. Also, a 50 nt artificial contiguous DNA sequence constructed using 25 nt from either side of gap 4 did not align with the nearest sequenced relative,Desulfovibrio aespoeensis.
These findings suggested a potential assembly error with the deposited sequence data surrounding gap 4.
New primers targeting gaps 5 and 6 were designed to generate smaller products (,600 bp) to determine if the source of amplification difficulty was large fragments with high %(G +C).
Taq DNA polymerase also failed with the smaller gap 5 and 6 PCRs (Table 2) suggesting that amplicon length in the context of high %(G+C) DNA was not the only source of difficulty. Use of nucleotide analogue 7-deaza-29-dGTP [12], in concert with 5% DMSO and 1.3 M betaine did support successful amplification of gaps 5 and 6 withTaqDNA polymerase [12] (Table 2). In fact, a review of the various amplification procedures used herein reveals that when using primers targeting DNA regions within a few hundred nucleotides of all gaps, all 6 regions could be amplified with either; 1)PfuSD DNA polymerase using either 7-deaza-29 -dGTP or a natural set of nucleotides with a ramped PCR extension cycle or, 2) a ramped PCR extension cycle withTaq
DNA polymerase, 5% DMSO, 1.3 M betaine and the nucleotide analogue 7-deaza-29-dGTP (Table 2).
GAP Sequence Results
The determined length of the gap regions in the ND132 genome ranged from 0 to 63 nt (Table 3). Gap 1 and gap 2 templates were prepared from a cloned source (see methods) and usedPfuDNA polymerase with 7-deaza-29-dGTP. Re-evaluation of the 2o structure following sequence determination showed a considerable increase in thermal stability of the 2o structures for gaps 1 and 2 (Figure 1). The self-complementing sequence was conserved between gaps 1 and 2 with the 59complementing region comprising the gap region for gap 1, and the 39complementing region comprising the majority of gap 2. The gap 1 forward sequences were weakened by a second hard stop upstream, so gap 1 reverse sequences had higher quality scores (Figure S3). Because gap 2 resided in a different context that lacked a secondary upstream hard stop, the forward sequence data was of good quality.
sequencing reactions were successful once gap 4 template was acquired.
The determined gap 3 length was 0 nt compared to the deposited JGI sequence (Table 3). The deposited sequence surrounding gap 3 formed a very strong 2ustructure (Figure S4). Gap 3 was flanked by a series of 5, 4, and 3 consecutive guanosines separated by islands of adenines that complemented the opposite side of the gap so that sequencing reactions on both strands were exposed to hard stops, diminishing the sequence trace peak height (Figure S4C). The sequence surrounding gap 3 also had strong 1u
and 2ustructural similarity with the determined sequence of gap 5.
Pfu polymerase routinely amplified all of the gap regions, but produced less PCR product with nucleotide mixtures that replace dGTP with 7-deaza-29-dGTP. The strength (DG =218.13 kcal-mol21) and length (28 bp) of the gap 3 2u structure are in agreement with the exceptional amplification and sequencing difficulty.
The small PCR products for gaps 5 and 6 (Table 1) yielded sequences within the gap, however, internal stoppage likely prevented read-through despite the use of 7-deaza-29-dGTP. Templates prepared with 7-deaza-29-dGTP yielded long sequenc-ing products that should have spanned the gaps based on the length, but did not. Secondary structure extending back to the primer was observed for gaps 3, 5, and 6. The estimated size of gaps 5 and 6 were 65 and 35 nt, respectively (Table 1). Primers designed closer to gaps 5 and 6 avoided 2ohard stop positions. These smaller products were amplified usingPfuDNA polymerase in conjunction with the ramped extension PCR, without the need for additives or 7-deaza-29-dGTP (Table 2). The surrounding sequence of gap 5 exhibits strong similarity with the gap 3 region. The gap 5 and 6 sequences were determined using PCR derived template prepared from ND132 genomic DNA using standard nucleotides in conjunction with Pfu SD DNA polymerase. Sequencing reactions supplemented with 1 M betaine with an increased extension cycle duration (6 min) supported read through
Table 1.Amplification/Sequencing Primers and Amplicon Electrophoretic Mobility Evaluation.
Primer Gap
Amplicon Size
GAPa Gel Mobilityb
Estimated GAP Length
Alignment Gap Lengthc
GAP1F 59- cgacatcctcaagccctg-39 2363 693 bp 700 bp 10 bp 18 bp
GAP1R 59- gcaagttcgcggacgtcaac-39 +330 ‘‘ ‘‘ ‘‘ ‘‘
GAP2F 59- ctggccgtcaagaccgac-39 2217 508 bp 540 bp 30 bp 30 bp
GAP2R 59- tgacgcttcggacgctc-39 +291 ‘‘ ‘‘ ‘‘ ‘‘
GAP3F 59- ctactgcctgcttagcca-39 2250 372 bp 375 bp 3 bp 21 bp
GAP3P10R 59-gaattgctccggctttgaaaaatgtaaggc-39 +122 ‘‘ ‘‘ ‘‘ ‘‘
GAP4P1F 59-ggaatgggttcaatcttatcaggttggctcc-39 2127 387 bp 400 bp 15 bpb 13 bp
GAP4R 59-cagccgtgccgtgcctgac-39 +260 ‘‘
GAP5F 59- gcttcaactcgggcgaac -39 2260 449 bp 520 bp 60 bp NDc
GAP5R 59- cgagtcgctcacgatggtgtg -39 +189 ‘‘ ‘‘ ‘‘ ‘‘
GAP6P2F 59-cctcaatgtcgcttgatacttgcgtaatcc-39 2496 578 bp 620 bp 40 bp ND
GAP6P2R 59-aaggagtaggtttttatgctactacgcccc-39 +82 ‘‘ ‘‘ ‘‘ ‘‘
GAP5Fs 59- gccaacgccctgaacctg -39 2129 207 bp 260 bp 60 bp ND
GAP5Rs 59- cacaacgaatgccgctgattc-39 +78 ‘‘ ‘‘ ‘‘
GAP6Fs 59-ctgcatcgtctaccgaatctg-39 2137 241 bp 270 bp 30 bp ND
GAP6Rs 59-cggcgtgtcgggaccgag-39 +104 ‘‘ ‘‘ ‘‘
aAmplicon size based on the distance between the 59termini of the primer pair excluding any additional length from the gap.
bElectrophoretic mobility rounded to nearest 10 bp based on a combination of Marker III (Roche), Marker V (Roche), and 100 bp ladder (NEB). cND means not determined because the artificial contigs did not align in BLAST searches.
doi:10.1371/journal.pone.0041295.t001
Table 2.ND132 Template Amplification Summary.
D. desulfuricansND132 Gaps Resolved
PCR Methoda TaqPolymerase Strand displacingPfuPolymerase GC-Rich PCR Systemb
Standard Cycling 4 ND
-Ramped Extensionc 1,2,3,4 1,2,3,4,5,6 5,6
79-deaza-29-dGTPd 1,2,3,4,5,6 1,2,3,4,5,6 ND
aMethod includes all additives, ions, and annealing and extension temperatures tested. bAmplification reagent is the GC-Rich PCR System (Roche).
cTaqpolymerase required 5% or 10% DMSO.Pfupolymerase required no additives.
d7’-deaza-29-dGTP was used with the ramped extension cycle. When used withTaqDNA polymerase, the reaction mixture was supplemented with 1 betaine and 5% DMSO.Pfupolymerase required no additives.
for gap 6, and a 12 bp overlap supported closure of gap 5. Cloned restriction endonuclease fragments yielded clean gap 5 and 6 sequence data, confirming the sequence obtained from the Pfu
polymerase derived PCR products. The single gap in the D. africanus genome was sequenced with the ramped PCR in combination withPfupolymerase and 7-deaza-29-dGTP. A series of 14 consecutive cytosines present in the deposited D. africanus
sequence located at the 59 end of the downstream contig was determined not to exist (Figure S5). Similarly, a series of 17
consecutive cytosines had been reported for gap 6 in prior finishing effort.
Discussion
The nucleotides surrounding all 6 gaps in the D. desulfuricans
ND132 genome exhibited extended complementarity with long segments of deoxyguanosine or deoxycytosine causing 2ostructure formation. This is likely a common source of difficulty for genome
Table 3.Sequences of the SixD. desulfuricansND132 Gaps.
GAP Locusa Length Sequence 59-39
1 657659–657675 17 gag ggg gaa cct ctt tc
2 1009606–1009634 29 cttggaagaggttccccctctggactccc
3 1885438 0
4 2275514 - 2275527 14 aaa agt ttc ccc cc
5 312797223128034 63 ccc ttt gag aaa agg gtt ttt cct ccc ctt ccc ccg aac ccc cat ccc ctc ctt tcc cta aac
6 364810923648144 36 ctt tgc aaa ggg ttc cct ctc gcc ccc ctt ccc ccc
aLocation of gaps in the genome according to updated genome GenBank (CP003220) sequence. doi:10.1371/journal.pone.0041295.t003
Figure 1. Example of the increase in secondary structure following determination of the gap sequences: Gap 1.Left- secondary structure prediction done using the Mfold web server [29] to aid in primer site selection. Closed triangle shows the location of the gap. Structure was prepared by appending 100 nt at the termini of the 59and 39contigs surrounding the gap. Folding parameters used 50 mM NaCl, and 2.5 mM MgCl2 at 60uC. Excess nucleotides were trimmed from the structure for presentation. Right – secondary structure including the determined gap sequence. The determined gap sequence nucleotides are highlighted in upper case. Folding parameters are as given for the structure prepared prior to gap sequence determination.
finishing since a survey of 10 additional non-contiguous finished genomes showed that more than half of the gaps had 2ustructure (Table 4). Viswanathanet al.[24] found that 2ostructure caused by miniTn10 transposon insertion resulted in DNA polymerase translating across the base of a stem-loop, resulting in deletion of the majority of the transposon sequence. However, evidence supporting the determined ND132 gap sequences includes closed gap region alignment withD. aespoeensisand other bacteria over 100 bps and all 59 and 39 terminal nucleotides involved with 2o structure agreed with the contig termini deposited by JGI. Further, none of the gap sites were adjoined to the stem structure base, so there is no reason for any truncation.
Application of an SD polymerase proved to be a key simplifying factor for routine amplification of refractory regions while the ramped thermal-cycling was initially designed to amplify genes when all standard PCR options failed. Together, all gap regions were routinely amplified with a combination of SD polymerase and ramped extension cycles with all additional cycling parameters constant. The result appears to be a one-size fits all for amplification of difficult templates, and the method should reduce an immense testing burden involving the search for amplification conditions during genome finishing work.
Use of 7-deaza-dGTP supported amplification of all 6 gap regions with eitherTaqorPfuDNA polymerase. Incorporation of 7-deaza-29-dGTP weakens Watson-Crick base pairing and disturbs base stacking caused by homopolymeric guanidylate making the DNA more amenable to dissociation [25,26]. Promiscuous nucleotide analogues have been used to insert changes during PCR and make refractory DNA segments amenable to amplification and sequencing [27], but 7-deaza-29 -dGTP is not reported to cause an elevation in mutation rate and so the lack of mismatches in the complementing nucleotides of the gap 2o structures offers confidence in the determined gap sequences. Consistently successful sequencing templates with difficult hard stops were achieved using 7-deaza-29-dGTP, but gaps 5 and 6 revealed that it alone will not support sequence determination in all cases. Evaluation of the gap 5 sequencing revealed that the sequencing reactions extended into the gap and then self-complemented back to the sequencing primer. This would occur if extension terminated on the downstream side
within the gap region by 2ostructure and the DNA then folds back on itself forming a hairpin structure. This was why sequencing reactions long enough to have read well onto the downstream contig failed to do so.
Primer proximity also proved to be important since primers closer to the gap regions (,100 bp away) resulted in more consistent template preparation and improved sequences even though correlations between primer proximity and sequence data quality is weak [28]. Hence, initial primer design should target sites close to the gap with subsequent re-design further away if necessary.
Current high-throughput sequencing methods can leave unre-liable sequence at contig termini [15], however, the deposited contig termini in the ND132 genome were correct except for differences at five positions upstream of gap 5. Similarly, the terminus of the downstream side flanking the ‘‘intractable’’ gap in the depositedD. africanusgenome consisted of 14 cytosines, and like the ND132 gap 6 artifact, was determined not to exist. Digestion and sub-cloning restriction endonuclease fragments provided important support for the ND132 gap 6 DNA sequence. High %(G+C) 2ostructure is the implicated source of difficulty for all tested sequence gaps, although the precise mechanics involved remain poorly understood. The findings presented here make it clear as to why these regions were ‘‘intractable’’ including the 2u structure stem regions containing long regions on complementation such as in gaps 1, 2 and 4 with 10 nt long polypyrimidine tracts while the more difficult gaps 3 and 5 have polypurine tracts 20 and 19 nt long, respectively. Gap 3 was consistently the most difficult region to amplify and this may be due to the tracts of guanosines.
Because of lessons learned herein, a one-size fits-all approach that saves time and effort for the final stages of a finishing effort is presented (Figure 2). The included steps are to first evaluate the available sequence data, removing undetermined nucleotides and append the upstream and downstream contigs to the scaffold. Use 200 nt of the result centered on the gap and run alignment searches to identify assembly errors. Nearest relative alignments can offer an idea on the anticipated size of the gap. Second, run a folding analysis of the surrounding region to rule in or out 2u
structure as was the case for all of the intractable gaps herein. A
Table 4.Survey of Additional Non-contiguous Finished Genomes.
Non-contiguous Finished Genome URLa,b Total Number of Gaps Positive for 2
6Structurec
Brenneria sp. EniD312 /bren/ 9 5
Burkholderia cepaciaBu72 /bcep bu72/ 3 3
Clostridium sp. DL-VIII /cspDL/ 1 0
Desulfovibrio africanus CP003221 1 1
Desulfovibrio desulfuricansND132 CP003220 6 5
Desulfovibrio sp. FW1012B /dfw101/ 2 2
Frankia sp. EUN1f /fran_eun1f/ 1 1
leptonema illiniDSM 21528 /lil21528/ 17 5
Methanofollis liminatansDSM 4140 /mli4140/ 6 3
Methylocystis sp.ATCC 49242 /meth4292/ 1 1
Shewanella balticaOS183 /sbal_183/ 4 2
Thermotogales bacteriummesG1.Ag.4.2 /tbac/ 2 2
ahttp://genome.ornl.gov/microbial/dfw101/. bhttp://www.ncbi.nlm.nih.gov/nuccore/CP003220.
survey of 10 additional non-contiguous finished genomes showed that 57% of 59 gaps involved 2ustructure (Table 4). Many of the gaps that did not meet the criteria of being located within a stem structure, within the loop, or adjoined to a stem structure were located in the vicinity of a strong 2ustructure. If 2u structure is identified, use a ramped extension cycle in conjunction with a SD polymerase and standard nucleotides. Sequencing reactions done in this assessment used the standard BigDyeH Terminator v3.1 reagents except for gaps 5 and 6 where the sequencing reagent was supplemented to 1 M betaine and the extension time was extended from 4 to 6 min for 25 cycles.
Finally, use the gap sequence and surrounding context to run a final alignment search to ensure against truncation has resulted from 2ustructure. All 6 of the ND132 gaps were at the junction of two coding regions, and so they may serve as strong transcriptional terminators. The gaps sequenced in this work, along with the cursory survey of other non-contiguous finished genomes show that stable stem-loop structures are a common cause for ‘‘intractable’’ regions, underscoring the importance of structural modeling using the available data surrounding these difficult to sequence regions. Where the type of 2ustructure described in this effort is identified, use of ramped extension segments during thermal-cycling in conjunction with SD polymerase are an efficient resource. Moreover, improved sequencing reagents that use a strong SD polymerase should prove equally helpful.
While Sanger sequencing was utilized in the development of this procedure, efforts are underway to optimize both the survey and
the amplification conditions to be amenable for next generation sequencing. Automation of this procedure in a high-throughput fashion would be very desirable and would likely be included at the initial stages of finishing. While application of these techniques to improve metagenomic assemblies would be difficult at this time, automation and incorporation into standard next generation finishing protocols could be envisioned for metagenomes as a longer-term goal. However, in the shorter-term, the increased availability of closed, contiguous and truly finished genomes would likely improve contig length and confidence in the longer contig accuracy for community sequencing projects.
Methods
Preliminary sequence evaluation
Sequence data surrounding the six gaps in theD. Desulfuricans
ND132 genome deposited by JGI was examined for high %(G+
C) islands and secondary structure. Secondary structure was evaluated by appending 100 nucleotides at the 59side to the first 100 nucleotides at the 39 side of the gaps and submitting the resulting 200 nucleotide contigs to the mFold program [29]. Secondary structure more distant from the gap was noted, and the sequences closer to the gap were re-evaluated by trimming the sequence data to 5 nucleotides on either side of the secondary structural elements located at the gap loci and submitting the resulting artificial contig to mFold. Thermal stabilities for the 6 preliminary mfold structures were determined using SciTools with
Figure 2. Work Flow Diagram.Top- 100 nt from either side of the gap are appended and used for alignment search to identify and potential problems with assembly causing the gap. N(n)denotes unknown nucleotides (50 or 100 by convention) inserted into the gaps in deposited sequence data The resulting 200 nt artificial contig is subjected to 2ustructure analysis. The folding analysis reveals additional 2ustructures in the vicinity of the gap that may present added difficulty with amplification and sequencing. Primers are targeted to positions proximal to the gap relative to any additional problems identified in the folding evaluation. Where the gap position is involved with secondary structure, amplification with an SD polymerase and use of a two-step extension cycle (1 min at 72uC followed by 1 min at 75uC) supports amplification. The second segment of the extension cycle can be modified based on the thermal stability identified in the initial folding analysis.
[Na+
] = 50 mM [MgCl2] = 2.5 mM. The 200 nucleotide artificial
contigs (100 nt on either side of the gap loci) were used for alignment searches to identify discontiguous sequence relative related bacterial sequences for identification of potential assembly problems, followed by re-evaluation with the shortened artificial contigs. The thermal stability of the stem regions was evaluated using the DNAanalyzer found in the SciTools environment located on the IDT website using standard PCR parameters of 50 mM Na+
and 2.5 mM Mg++
to assist with PCR optimization.
Gap Region Amplification
High molecular weight DNA was extracted fromD. desulfuricans
ND132 cells grown in Walls medium for 3 days as described [30] followed by treatment with DNase free RNaseA (NEB) and adjusted to 16105 genomesml21 [30,31]. Amplification primers (30 mer) targeting the 6 gaps in theD. desulfuricansND132 genome were purchased from Integrated DNA Technologies (Coralville, IO). The initial primer set was designed as 30 nucleotide oligos to insure specificity at high annealing temperatures to support optimization assays. The 6 gaps present in the D. desulfuricans
ND132 genome are listed in order of appearance on the genome scaffold (Table 2, text). Additional primers were designed to target loci closer to the gaps to bypass additional hard stop loci and generate smaller amplicons for improved sequence data.
PCR optimization assays usingTaqDNA polymerase were done by varying the annealing temperature between 55uC and 63uC using an EppendorfHgradient thermal cycler. MgCl2
concentra-tion was varied between 1.5 and 3 mM in 0.5 mM increments, and all standard PCR optimization assays were replicated using 5% formamide, 5% DMSO, and 10% DMSO. The listed additive tests were repeated using a ramped PCR extension cycle based on findings from secondary structure evaluations. Ramped extension thermal-cycling used an initial dissociation at 98uC for 3 min followed by 30 cycles of dissociation at 95uC for 30 s, annealing at 59uC for 30 s, extension at 72uC for 1 min and 75uC for an additional minute, with a final extension at 72uC for 7 min.Pfu
DNA polymerase selected for the properties of strand displace-ment and high fidelity [32] was expressed from a cloned source, purified using a nickel chelating column (GE Healthcare), and assessed for activity using universal primers targeting the 16S V3/ V4 region withD. desulfuricansND132 DNA. 1 unit ofPfuDNA polymerase was established as the minimum amount of polymer-ase that still gave the maximum quantity of PCR product from a 25 thermal-cycle 50ml reaction in 16Pfureaction buffer [20 mM Tris-HCl (pH 8.8), 2 mM MgSO4, 10 mM (NH4)2SO4,
10 mM KCl, 0.1 mgml21BSA, 0.1% Triton X-100]. Following initial testing, all PCRs using Pfu DNA polymerase used the ramped extension cycle described above. A GC-Rich PCR SystemTM (Roche) was used according to manufacturer instruc-tions.PfuDNA polymerase was used to prepare PCR products for cloning to support comparison of sequencing results using plasmid templates with direct sequencing of PCR products.
IllustraTMGFX gel band purification reagents (GE Healthcare) or a QIAquickH Gel Extraction Kit (QIAGEN, Boulder CO). Terminal deoxyadenosine was added usingTaqDNA polymerase and 1 mM deoxyadenosine 59 triphosphate in 16PCR buffer [25 mM Tris-HCl (pH 9.0) 50 mM KCl, 2.5 mM MgCl2, 0.1%
Triton X-100] at 72uC for 20 min. The resulting tailed Pfu
amplification products were ligated into pCR2.1 (Invitrogen) using a TOPOTM TA cloning kit (InvitrogenH) and plasmids were grown inEscherichia coliTOP 10 cells (InvitrogenH). Because of the difficulty with gap region amplification, recombinant screening required preparation of plamids by alkaline lysis followed by purification with organic extraction. Plasmid screening was done
with PCR primers specific for pCR2.1, using the ramped thermal-cycling process described previously.
Once amplification conditions were established for all 6 gap regions sequencing template was prepared using Pfu DNA polymerase. In addition to PCR products prepared using a standard mixture of deoxyribonucleotide triphosphates (dNTPs), templates were prepared using 7-deaza-29- deoxyguanosine-59 -triphosphate (USB, Cleveland OH) or CleanAmpTM 7-deaza-29 -deoxyguanosine-59-triphosphate (TriLink Technologies San Diego CA) to improve the quality of sequencing results [33]. Gap 3 template production usingPfu DNA polymerase was consistemly weak, and was therefore prepared usingTaqDNA polymerase in conjunction with 1 M betaine and 5% DMSO.
Gap Sequencing
BigDyeTMV3.1 (Applied Biosystems) was used for all sequenc-ing reactions. Tested amendments included 5% DMSO and 1 M betaine. Sequences for gaps 1, 2, 3, and 4 were obtained using a combination of 5% DMSO and 1 M betaine under standard cycling conditions that included an initial hold at 96uC61 min followed by [96uC610 s, 50uC610 s, and 60uC64 min] over 25 cycles. Gaps 5 and 6 were pre-incubated at 98uC for 3 min in a solution containing primer and sufficient betaine to give a final concentration of 1 M following the addition of sequencing reagent. BigDyeTMV3.1 sequencing reagent added according to manufacturer reccomendations and thermal-cycled as described above with a modification of the extension time to 6 min.
Separation of Hairpin Structures
Gap 5 and gap 6 were amplified usingPfuDNA polymerase and evaluated with a battery of restriction endonucleases. Based on a digestion assessment, restriction endonuclease HaeIII and MspI digests were cloned into pCR2.1 (Invitrogen) using TOPO TA cloning reagents. Terminal deoxyadenine was added by incubat-ing theHaeIII digestion products with 1 UTaqDNA polymerase and 1 mM dATP in 16PCR buffer [50 mM KCl, 25 mM Tris
(pH 9.0), 0.1% Triton X-100] supplemented with
2.5 mM MgCl2.MspI digestion products have recessed 39termini
requiring extension with terminal dexoyadenine addition using dATP, dCTP and dGTP at 330mM each. Because of difficulty with amplification through the hard stop loci, clone screening required plasmid preparation by alkaline lysis. Constructs containing inserts were sequenced using plasmid complementing
primers TAF 59-GCC GCC AGT GTG CTG GAA TT-39 and
TAR 59-TAG ATG CAT GCT CGA GCG GC-39.
Data Access
The original non-contiguous finished genomes for D. africanus
(CM001160.1) and D. desulfuricans ND132 (CM001077.1) were deposited in GenBank and can be found at (http://www.ncbi.nlm. nih.gov/nuccore/CM001160.1?report = genbank) and (http:// www.ncbi.nlm.nih.gov/nuccore/CM001077.1?report = genbank), respectively. The closed genomes as a result of this work forD. africanus(CP003221) andD. desulfuricansND132 (CP003220) can be found at (http://www.ncbi.nlm.nih.gov/nuccore/CP003221) and (http://www.ncbi.nlm.nih.gov/nuccore/CP003220), respec-tively.
Supporting Information
Figure S1 Pre- gap determination 26structure
proximal nucleotides flanking each gap so that the preliminary structures shown lack the gap nucleotides. Blue arrows show the site of the gap for each structure. DNA was folded using standard PCR conditions (50 mM Na+
and 2.5 mM Mg2+
). All folds were performed using 60uC except gap 5 (37uC). Note mismatches in the gap 5 stem structure (black arrows).
(DOC)
Figure S2 Amplification of D. desulfuricans ND132
sequencing templates. (A) Taq DNA polymerase (10% DMSO) PCR products from gap 1–6 using a ramped extension cycle consisting of 1 min at 72uC followed by 1 min at 75uC over 30 thermal-cycles. For each gap, 20ml from each of 3 different
PCRs is electrophoresed. Gap 3 products show the typical low yield for each of the 30 mer primed PCRs. Lane M; Marker IIITM (Roche). (B) Expanded view of artifacts from gaps 1 and 2. For gap 1 and gap 2 sufficient product is generated so that 2 artifacts are visible for each of the 3 PCRs targeting both gap regions. P-product; A1 and A2 indicate the position of artifacts that are
generated for all 6 PCRs usingTaqDNA polymerase for gaps 1 and 2. Gap 4 amplifies without difficulty and does not produce the 2 artifacts even though the 2uC structure shares strong similarity with gaps 1 and 2 (see figure 3).
(DOC)
Figure S3 Secondary Structure Assessment of Gap 1, 2,
and 4.Mfold structure for Gaps 1, 2, and 4 showing 1uand 2u
structural similarity determined by placing the determined gap sequence within 21 nucleotides of context on both the 59and 39 sides of the determined sequence. Polypurine tracts 10 nt long occur in the 59stem complement of the gap 1 and 2 structures that complement polypyrimidine tracts in the 39side of the stems. Gap 4 also has a 10 nt polypurine tract in the 59stem sequence that contains a stretch of 6 consecutive guanosines. All gap sequences determined using the current process are shown in upper case. Mfold parameters used default settings at (60uC; [Na+
] = 50 mM, [Mg++] = 2.5 mM). Gap sequence data quality: gap 1 Q = 94.4%,
gap 2 Q = 94.5% gap 4 Q = 73.0% as called by SequencherH Version 4.9).
(DOC)
Figure S4 Sources of gap sequencing difficulty.(A) Gap 3
1uand 2ustructure. The nucleotides (A-T) surrounding the site of the non-extant gap in the sequence data are shown in upper case on the folded structure. The sequence is trimmed to the limit of the stem region complementarity. A 20 nt polypurine tract comprises the majority of the 59complement of the stem structure (nt 3–23).
Folding parameters include 60uC, 50 mM Na+, and
2.5 mM Mg++
to match conditions used for primer annealing in gap region amplification. (B) The gap 3 sequence trace showing nucleotide positions (black arrows) where the determined sequence diverges from the sequence determined by prior next-generation sequencing and finishing work (Q = 93.0% by SequencherTM4.9).
The sequence trace shows the typical effect of a hard stop locus with elevated peaks between nucleotide positions 250 to 270 followed by diminished peak height. The elevated peaks of the polypurine tract complement the downstream polypyrimidine tract (nucleotides 285–305). Sequence changes marked2C and+
T indicate nucleotides absent or inserted relative to prior data giving a net gap length of 0 nt. (C) Model for self-priming effect observed for gaps 3, 5, and 6. (1) Polymerase extension product having a 39terminal segment (light blue) that complements a series of nucleotides upstream on the extension product and is terminated by polymerase halting at the site of a hard-stop (light blue arrow) instead of by incorporation of a labeled terminator during an extension cycle. (2) Fold-back of the complementing segment of the sequencing reaction extension product forms a hairpin structure. (3) The self-annealed 39terminus of the hairpin structure primes extension during the subsequent annealing segment of the cycle sequencing program. The mfold structure shown below is a representative fold of a sequencing product for gap 5 derived from template containing 79-deaza-29-dGTP instead of dGTP.
(DOC)
Figure S5 Desulfovibrio africanus gap structure. (A)
Folding structure prepared using 200 nt centered on the gap. Arrow indicates the location of the gap prior to determination of the gap sequence. Structure was determined using mfold through SciTools located on the Integrated DNA Technologies web site. (B) Determined structure. Gap nucleotides were determined using template prepared with 7-deaza-29- deoxyguanosine-59 -triphos-phate (TriLink Technologies San Diego CA) in conjunction with
Pfu DNA polymerase and sequenced using standard BigDyeTM procedure (Q = 73.9%, forward and reverse sequences, by SequencherTM 4.9). Determined gap nucleotides are shown in uppercase. The structure was determined using the Mfold website. Thermodynamic data; DG =26.81 kcal/mol at 60uC; Tm= 87.8uC; assuming a 2 state model. Ionic conditions:
[Na+
] = 0.05 M, [Mg++
] = 0.0025 M. (DOC)
Table S1 (DOC)
Acknowledgments
We would like to thank Trilink Biotechnologies (San Diego, CA, USA) for the gift of 7-deaza-29-dGTP that supported cleaner sequence reads.
Author Contributions
Conceived and designed the experiments: RAH DAE. Performed the experiments: RAH. Analyzed the data: RAH DAE AVP SDB MP. Contributed reagents/materials/analysis tools: DAE. Wrote the paper: RAH DAE AVP SDB MP.
References
1. Mardis ER (2008) Next-Generation DNA Sequencing Methods. Ann Rev Gen Human Gen 9: 387–402.
2. Medini D, Serruto D, Parkhill J, Relman DA, Donati C, et al. (2008) Microbiology in the post-genomic era. Nat Rev Micro 6: 419–430. 3. Alkan C, Sajjadian S, Eichler EE (2011) Limitations of next-generation genome
sequence assembly. Nat Meth 8: 61–65.
4. Fraser CM, Eisen JA, Nelson KE, Paulsen IT, Salzberg SL (2002) The Value of Complete Microbial Genome Sequencing (You Get What You Pay For). J Bacteriol 184: 6403–6405.
5. Chain PSG, Grafham DV, Fulton RS, FitzGerald MG, Hostetler J, et al. (2009) Genome Project Standards in a New Era of Sequencing. Science 326: 236–237.
6. Boisvert S, Laviolette F, Corbeil J (2010) Ray: simultaneous assembly of reads from a mix of high-throughput sequencing technologies. J Comput Biol 17: 1519–1533.
7. Koren S, Miller JR, Walenz BP, Sutton G (2010) An algorithm for automated closure during assembly. BMC Bioinform 11: 457.
8. Kumar S, Blaxter ML (2010) Comparing de novo assemblers for 454 transcriptome data. BMC Gen 11: 571.
9. Miller JR, Koren S, Sutton G (2010) Assembly algorithms for next-generation sequencing data. Gen 95: 315–327.
10. Kieleczawa J (2006) Fundamentals of sequencing of difficult templates–an overview. J Biomol Tech 17: 207–217.
12. Musso M, Bocciardi R, Parodi S, Ravazzolo R, Ceccherini I (2006) Betaine, dimethyl sulfoxide, and 7-deaza-dGTP, a powerful mixture for amplification of GC-rich DNA sequences. J Mol Diagn 8: 544–550.
13. Nagarajan N, Cook C, Di Bonaventura M, Ge H, Richards A, et al. (2010) Finishing genomes with limited resources: lessons from an ensemble of microbial genomes. BMC Gen 11: 242.
14. Tettelin H, Radune D, Kasif S, Khouri H, Salzberg SL (1999) Optimized multiplex PCR: efficiently closing a whole-genome shotgun sequencing project. Gen 62: 500–507.
15. van Hijum SA, Zomer AL, Kuipers OP, Kok J (2005) Projector 2: contig mapping for efficient gap-closure of prokaryotic genome sequence assemblies. Nucl Acids Res 33: W560–566.
16. Gilmour CC, Elias DA, Kucken AM, Brown SD, Palumbo AV, et al. (2011) Sulfate-Reducing Bacterium Desulfovibrio desulfuricans ND132 as a Model for Understanding Bacterial Mercury Methylation. Appl Environ Microbiol 77: 3938–3951.
17. Schaefer JK, Rocks SS, Zheng W, Liang L, Gu B, et al. (2011) Active transport, substrate specificity, and methylation of Hg(II) in anaerobic bacteria. PNAS 108: 8714–8719.
18. Brown SD, Gilmour CC, Kucken AM, Wall JD, Elias DA, et al. (2011) Genome sequence of the mercury-methylating strain Desulfovibrio desulfuricans ND132. J Bacteriol 193: 2078–2079.
19. Brown SD, Wall JD, Kucken AM, Gilmour CC, Podar M, et al. (2011) Genome sequence of the mercury-methylating and pleomorphic Desulfovibrio africanus Strain Walvis Bay. J Bacteriol 193: 4037–4038.
20. Margulies M, Egholm M, Altman WE, Attiya S, Bader JS, et al. (2005) Genome sequencing in microfabricated high-density picolitre reactors. Nat 437: 376–380. 21. Loudig O, Brandwein-Gensler M, Kim RS, Lin J, Isayeva T, et al. (2011) Illumina whole-genome complementary DNA-mediated annealing, selection, extension and ligation platform: assessing its performance in formalin-fixed, paraffin-embedded samples and identifying invasion pattern-related genes in oral squamous cell carcinoma. Hum Pathol.
22. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ (1990) Basic local alignment search tool. J Mol Biol 215: 403–410.
23. Mount DW (2007) Using the Basic Local Alignment Search Tool (BLAST). CSH Protoc 2007: pdb top17.
24. Viswanathan VK, Krcmarik K, Cianciotto NP (1999) Template secondary structure promotes polymerase jumping during PCR amplification. Biotech 27: 508–511.
25. Mizusawa S, Nishimura S, Seela F (1986) Improvement of the Dideoxy Chain Termination Method of DNA Sequencing by Use of Deoxy-7-Deazaguanosine Triphosphate in Place of Dgtp. Nucl Acids Res 14: 1319–1324.
26. Seela F, Driller H (1989) Alternating d(G-C)3 and d(C-G)3 hexanucleotides containing 7-deaza-29-deoxyguanosine or 8-aza-7-deaza-29-deoxyguanosine in place of dG. Nucl Acids Res 17: 901–910.
27. Keith JM, Cochran DA, Lala GH, Adams P, Bryant D, et al. (2004) Unlocking hidden genomic sequence. Nucl Acid Res 32: e35.
28. Kieleczawa J (2008) Effect of primer proximity to a difficult-to-sequence region on read length and sequence quality. J Biomol Tech 19: 335–341.
29. Zuker M (2003) Mfold web server for nucleic acid folding and hybridization prediction. Nucl Acids Res 31: 3406–3415.
30. Hurt RA, Qiu XY, Wu LY, Roh Y, Palumbo AV, et al. (2001) Simultaneous recovery of RNA and DNA from soils and sediments. Appl Environ Microbiol 67: 4495–4503.
31. Zane GM, Yen HCB, Wall JD (2010) Effect of the Deletion of qmoABC and the Promoter-Distal Gene Encoding a Hypothetical Protein on Sulfate Reduction in Desulfovibrio vulgaris Hildenborough. Appl Environ Microbiol 76: 5500–5509. 32. Andre P, Kim A, Khrapko K, Thilly WG (1997) Fidelity and mutational spectrum of Pfu DNA polymerase on a human mitochondrial DNA sequence. Gen Res 7: 843–852.