• Nenhum resultado encontrado

Ocorrência e caracterização de Staphylococcus spp. resistentes à meticilina isolados de cães isolados de cães e seus contatos humanos em Municípios do Rio de Janeiro

N/A
N/A
Protected

Academic year: 2021

Share "Ocorrência e caracterização de Staphylococcus spp. resistentes à meticilina isolados de cães isolados de cães e seus contatos humanos em Municípios do Rio de Janeiro"

Copied!
70
0
0

Texto

(1)

UNIVERSIDADE FEDERAL FLUMINENSE INSTITUTO BIOMÉDICO

PROGRAMA DE PÓS-GRADUAÇÃO EM MICROBIOLOGIA E PARASITOLOGIA APLICADAS

EDUARDO MOREIRA DE CASTRO

OCORRÊNCIA E CARACTERIZAÇÃO DE Staphylococcus spp. RESISTENTES À METICILINA ISOLADOS DE CÃES E SEUS CONTATOS HUMANOS EM

MUNICÍPIOS DO RIO DE JANEIRO

NITERÓI 2018

(2)

EDUARDO MOREIRA DE CASTRO

OCORRÊNCIA E CARACTERIZAÇÃO DE Staphylococcus spp. RESISTENTES À METICILINA ISOLADOS DE CÃES E SEUS CONTATOS HUMANOS EM

MUNICÍPIOS DO RIO DE JANEIRO

Trabalho apresentado ao Curso de Pós-Graduação em Microbiologia e Parasitologia Aplicadas da Universidade Federal Fluminense para obtenção do grau de Mestre

Orientadora: Profa. Dra. Renata Fernandes Rabello

NITERÓI 2018

(3)

EDUARDO MOREIRA DE CASTRO

DETECÇÃO E CARACTERIZAÇÃO DE Staphylococcus spp. RESISTENTES À METICILINA ISOLADOS DE CÃES E SEUS CONTATOS HUMANOS EM

MUNICÍPIOS DO RIO DE JANEIRO

Trabalho apresentado ao Curso de Pós-Graduação em Microbiologia e Parasitologia Aplicadas da Universidade Federal Fluminense para obtenção do grau de Mestre

Aprovado em _________de_________de_______

BANCA EXAMINADORA

Prof. Dr. Aloysio de Mello Figueiredo Cerqueira – Universidade Federal Fluminense (Presidente)

Prof. Dr. Bruno de Araújo Penna – Universidade Federal Fluminense (Membro)

Profa. Dra. Marcia Giambiagi de Marval – Universidade Federal do Rio de Janeiro (Membro)

NITERÓI 2018

(4)

AGRADECIMENTOS

Agradeço primeiramente à professora Renata Fernandes Rabello Por todos os anos de orientação e apoio.

Agradeço a todos os professores e alunos do laboratório de Cocos Gram positivos por todo apoio e amizade.

Agradeço aos professores Aloysio de Mello Figueiredo Cerqueira, Bruno de Araújo Penna, Marcia Giambiagi de Marval por, por aceitarem o convite para participar deste momento.

Agradeço à professora Márcia Soares Pinheiro pelo grande auxílio durante a escrita.

Agradeço à professora Maria Helena Consendey, a professora Ana Maria Dieckmann e a todos os membros de suas equipes na Faculdade de Medicina Veterinária da UFF pela coleta e processamento de parte das amostras.

Agradeço à Dra. Carla Dray Marassi pela colaboração e disponibilidade na coleta na clínica veterinária particular.

Agradeço aos integrantes da equipe do Instituto Municipal de Medicina Veterinária Jorge Vaitsman, pelo apoio durante a coleta.

Agradeço, à professora Beatriz Meurer Moreira, por toda sua assistência durante a realização deste trabalho, e à Dra. Larissa Botelho, pelo apoio com o MALDI-TOF.

Agradeço também ao curso de Pós Graduação em Microbiologia e Parasitologia e todos os seus integrantes, assim como a FAPERJ e a CAPES, por todo o apoio.

Agradeço, por fim, à minha tia Cristina, por me ajudar a percorrer este caminho até aqui.

(5)

RESUMO

Staphylococcus spp. são membros da microbiota e importantes agentes de infecções em humanos e animais. Infecções causadas por bactérias multirresistentes, dentre estas S. aureus resistente à meticilina (MRSA), representam um grave problema de saúde pública mundial. A ocorrência de MRSA em animais já foi descrita, mas poucos trabalhos estão disponíveis em nosso país. A proximidade entre cães e humanos pode torná-los fontes mútuas de infecção. Deste modo, os objetivos do presente estudo foram investigar a ocorrência de colonização nasal por S. aureus e MRSA em cães e seus contatos humanos, identificar a possível transmissão de MRSA entre eles, investigar a colonização nasal por outras espécies de Staphylococcus resistentes à meticilina (MRS) em cães, além de caracterizar as amostras bacterianas isoladas. Duzentos e noventa cães e 299 contatos humanos residentes em municípios do Rio de Janeiro foram submetidos à coleta de secreção nasal entre março de 2015 e janeiro de 2017. Um questionário referente às características possivelmente associadas à colonização nasal foi respondido pelos contatos humanos. O isolamento foi realizado em Ágar manitol salgado, sem e com oxacilina, e a identificação bacteriana por métodos fenotípicos e MALDI-TOF. A sensibilidade aos antimicrobianos foi determinada pelo método de disco-difusão, para 11 antimicrobianos, e por microdiluição, para vancomicina. Além disso, foi realizada a pesquisa do gene mecA, a tipificação do SCCmec (tipos I a V) e a detecção dos genes da PVL por PCR para as amostras de MRSA, sendo a primeira análise também para MRS. A técnica de MLST foi realizada para identificação das linhagens circulantes em cães em nossa região. S. aureus foi isolado de 16 cães (5,5%) e de 55 contatos humanos (18,4%). Quatro cães e quatro proprietários estavam colonizados por MRSA, mas estes não eram relacionados. Outros 18 cães (6,2%) estavam colonizados por MRS, sendo principalmente de espécies de coagulase positivos. Para três amostras de MRSA, duas de cães e uma de humano, não foi identificado nenhum dos tipos de SCCmec testado e as demais apresentaram o SCCmec tipo IVa. Duas amostras de MRSA, de origem humana, apresentaram os genes da PVL. Tanto para amostras de S. aureus de cães (c) quanto de humanos (h), os maiores percentuais de resistência foram para penicilina (c: 83,3%; h: 84,7%), eritromicina (c: 66,7%; h: 52,5%) e clindamicina induzida (c: 38,9%; h: 47,5%). Resistências a outros antimicrobianos também foram encontradas, exceto para rifampicina e sulfetoxazol+trimetropina, e vancomicina (CMI90 = 1,0µg/mL). Doiss MRSA de origem canina foram do ST5, uma do ST398 e uma de um novo ST. Para humanos, residir no município do Rio de Janeiro e trabalhar em hospital foram associados à colonização por S. aureus. Portanto, MRSA de linhagens frequentemente isoladas de humanos foram isoladas de cães em municípios do Rio de Janeiro. Entretanto, não detectamos o compartilhamento de linhagens de MRSA entre cães e seus contatos. Contudo, detectamos amostras de S. aureus com o mesmo perfil de resistência no cão e seu proprietário, sugerindo compartilhamento da espécie. As taxas de resistência aos antimicrobianos semelhantes entre ambos os hospedeiros alerta para o potencial dos animais na disseminação de amostras resistentes.

(6)

ABSTRACT

Staphylococcus spp. are members of microbiota and agents of infections in different hosts. Methicillin-resistant S. aureus (MRSA) infection is a serious public health problem worldwide. Isolation of MRSA from animals has been increasingly reported. However, almost no data is available about the occurrence of MRSA colonization in dogs and humans in close contact in our country. The close proximity may render dogs and humans, mutual sources of infections. The present study aim was to investigate the occurrence of nasal colonization of MSSA and MRSA in dogs and humans in close contact, and of MRS in dogs, besides characterize them by antimicrobial susceptibility, SCCmec type and presence of the PVL genes. The study included 290 dogs and 299 human contacts (288 owners of these dogs, eight veterinarians and three pet groomers). Nasal swabs were obtained at three veterinarian clinics in Rio de Janeiro and Niterói, from March 2015 to January 2017. Specimens were cultured in mannitol salt agar with and without oxacillin (2μg/mL) and colonies resembling S. aureus were selected. Colonies resembling other species of Staphylococcus, originated from dogs, were also selected from the plates with oxacillin. Bacterial identification was performed by conventional methods and MALDI-TOF. The antimicrobial susceptibility was performed by disk diffusion, for 11 antimicrobial agents, and microdilution for vancomycin. PCR for mecA gene was performed for methicillin resistance confirmation. SCCmec typing and PCR for PVL genes were performed for MRSA. For MRSA originated from dogs, MLST was performed. S. aureus were obtained from 16 (5,5%) dogs e 55 (18,4%) human contacts. Four dogs and four owners were colonized with MRSA, but they weren’t related. Other 18 dogs (6,2%) were carrying MRS, mainly by coagulase positives. For three MRSA samples, two from dogs and one from human, none of the SCCmec types tested were identified, but the others presented SCCmec type-Iva. Two MRSA samples, from humans, presented PVL genes. S. aureus samples, from both dogs (d) and humans (h), presented higher percentages of resistances for penicillin (d: 83,3%; h: 84,7%), erythromycin (d: 66,7%; h: 52,5%) and clindamycin, by induced resistance (d: 38,9%; h: 47,5%). Resistance to other antimicrobials was also found, except for vancomycin (CMI90=1,0μg/ml). Two canine MRSA belonged to ST5, one to ST398 and one presented a new ST. For humans, to live in Rio de Janeiro and to work at hospitals were associated characteristics with S. aureus carriage. There are MRSA of human lineages colonizing dogs in Rio de Janeiro cities. Although related in other studies, the transmission of MRSA weren´t evidenced here. Still, samples of MSSA with same resistance profiles colonizing both dogs and its owners were found. Antimicrobial resistance is high for both hosts, awarding for dog’s dissemination potential of resistant samples.

(7)

LISTA DE FIGURAS

Figura 1 – Desenho do estudo...22 Figura 2 – Percentual de amostras de S. aureus resistentes aos antimicrobianos investigados, pelo método de disco-difusão, isoladas de cães e seus contatos humanos em municípios do Rio de Janeiro no período entre 2015 e 2017...35 Figura 3 – Perfis de resistência aos antimicrobianos de amostras de S. aureus isoladas de cães (A) e humanos (B), em municípios do Rio de Janeiro no período entre 2015 e 2017...36

(8)

LISTA DE TABELAS

Tabela 1 - Sequência e concentração de iniciadores utilizados para detecção de genes por PCR, e tamanho dos produtos esperados...30 Tabela 2 - Iniciadores utilizados na técnica de MLST...32 Tabela 3 - Distribuição de espécies de MRS isoladas de cães residentes em municípios do Rio de Janeiro no período entre 2015 e 2017...34 Tabela 4 - Perfil de resistência das amostras de S. aureus isoladas de cães e de seus respectivos proprietários simultaneamente colonizados em municípios do Rio de Janeiro no período entre 2015 e 2017...37 Tabela 5 - Perfil de resistência aos antimicrobianos, presença de mecA, tipo de SCCmec e presença de pvl entre amostras de MRSA isoladas de cães e seus contatos humanos em municípios do Rio de Janeiro no período entre 2015 e 2017...38 Tabela 6 - Espécies e perfil de resistência aos antimicrobianos pelo método de disco-difusão de amostras de MRS de cães residentes em municípios do Rio de Janeiro no período entre 2015 e 2017...39 Tabela 7 - Avaliação das características associadas à colonização por S. aureus em cães...41 Tabela 8 - Avaliação de características associadas a colonização de cães por MRSA, em municípios do Rio de Janeiro no período entre 2015 e 2017...42 Tabela 9 - Avaliação de características associadas a colonização de proprietários de cães por S. aureus, em municípios do Rio de Janeiro no período entre 2015 e 2017...44 Tabela 10 - Características relacionadas ao uso de antimicrobiano, presença de lesão de pele, hospitalização e de contatos dos proprietários de cães colonizados por MRSA, em municípios do Rio de Janeiro, no período entre 2015 e 2017...45

(9)

SUMÁRIO

1. INTRODUÇÃO ... 9

1.1. O Gênero Staphylococcus ... 9

1.1. Staphylococcus aureus ... Erro! Indicador não definido. 1.2. Staphylococcus aureus resistente à meticilina (MRSA) ... 12

1.2.1. Staphylococcus aureus resistente à meticilina adquirido na comunidade (CA-MRSA) e em hospitais (HA-(CA-MRSA) ... 14

1.2.2. Caracterização molecular de Staphylococcus aureus resistentes à meticilina (MRSA) ... 15

1.3. Transmissão de Staphylococcus aureus resistente à meticilina (MRSA) entre cães e humanos ... 17 2. OBJETIVOS ... 19 2.1. Objetivo Geral ... 19 2.2. Objetivos específicos ... 19 3. METODOLOGIA ... 20 3.1. Desenho de estudo ... 20

3.2. Origem e coleta das amostras ... 23

3.3. Considerações éticas ... 24

3.4. Isolamento e identificação bacteriana ... 24

3.4.1. Métodos de identificação fenotípicos convencionais ... 25

3.4.2. Identificação por MALDI-TOF ... 25

3.5. Determinação da sensibilidade a antimicrobianos ... 26

3.5.1. Teste de disco-difusão ... 26

3.5.2. Teste de microdiluição em caldo para vancomicina ... 27

3.6. Caracterização genotípica ... 27

3.6.1. Liberação de DNA ... 28

(10)

3.6.3. Detecção do gene da toxina Panton-Valentine ... 29

3.6.4. Visualização dos resultados ... 29

3.7. MLST ... 30

3.8. Análise estatística dos dados... 32

4. RESULTADOS ... 33

4.1. Colonização nasal por S. aureus, MRSA e MRS ... 33

4.2. Determinação do perfil de resistência aos antimicrobianos de amostras de S. aureus, MRSA e MRS ... 34

4.3. Caracterização genotípica de MRSA ... 40

4.4. Análise dos questionários ... 40

5. DISCUSSÃO ... 46

6. CONCLUSÕES ... 54

7. ANEXO 1 ... 64

8. ANEXO 2 ... 67

(11)

1. INTRODUÇÃO

1.1. O Gênero Staphylococcus

O gênero Staphylococcus, pertencente à família Staphylococcaceae, é assim denominado por se assemelhar a cachos de uvas quando observado em microscopia óptica pela técnica de coloração de Gram. Também podem ser observados como células isoladas, em pares ou em cadeias curtas. As espécies deste gênero são cocos Gram positivos, imóveis e com diâmetro em torno de 0,5 a 1,5 µm. São halotolerantes (capacidade de crescer na presença de elevada concentração de NaCl, por exemplo 10%), mesófilas (crescem em temperatura entre 18ºC e 40ºC) e anaeróbias facultativas (Deurenberg e Stobberingh, 2008). Além disso, as espécies pertencentes a este gênero produzem a enzima catalase, que converte peróxido de hidrogênio em água e oxigênio gasoso. Outra enzima importante produzida por algumas espécies é a coagulase, cuja ação resulta na conversão de fribrinogênio em fribrina (Otto, 2014). Deste modo, as espécies do gênero são divididas em Staphylococcus coagulase positivos (CoPS, do inglês, coagulase positive Staphylococcus) e Staphylococcus coagulase negativos (CoNS, do inglês, coagulase negative Staphylococcus) (Deurenberg e Stobberingh, 2008).

Até o momento, este gênero abrange 52 espécies e 28 subespécies (http://www.bacterio.net/Staphylococcus.html, acesso em 14/01/2018). Diversas espécies são consideradas como parte da microbiota da pele e mucosas, tanto de humanos como de animais. Apesar disso, são patógenos de grande importância clínica humana e veterinária, destacando-se as espécies Staphylococcus aureus em humanos e Staphylococcus pseudintermedius em cães (Bannoehr e Guardabassi, 2012).

Em humanos, S. aureus é capaz de causar diversos tipos de infecção, destacando-se as bacteremias e endocardites, comumente associadas ao ambiente hospitalar, e as infecções de pele e tecidos moles na comunidade, (Tong et al., 2015). A colonização por S. aureus é considerada um fator de risco para a infecção do hospedeiro (Wertheim et al., 2005). Espécies de CoNS também estão associadas a infecções em humanos, principalmente em ambiente hospitalar. Dentre estas, destacam-se Staphylococcus epidermidis e Staphylococcus haemolyticus, envolvidos em uma série de infecções como bacteremia, endocardite e infecção de ferida

(12)

cirúrgica. Uma espécie que se destaca em infecções na comunidade é Staphylococcus saprophyticus como agente de infecção de trato urinário (Otto, 2009; Söderquist e Berglund, 2009).

Já em cães, a espécie com maior importância clínica veterinária é o S. pseudintermedius, sendo o principal causador de piodermite canina. Apesar de ser encontrado colonizando a pele e mucosa de cães, esta espécie é o patógeno mais frequentemente isolado de espécimes clínicas. Junto com Staphylococcus intermedius e Staphylococcus delphini, estas três espécies formam o grupo S. intermedius (SIG, do inglês, Staphylococcus intermedius group), sendo difícil distingui-las entre si por métodos fenotípicos. Assim como para S. aureus em humanos, a colonização por S. pseudintermedius em cães é um fator de risco para infecções no hospedeiro, visto que cepas dessa espécie resistentes a meticilina (MRSP) também são encontradas e possuem grande importância clínica veterinária (Bannoehr e Guardabassi, 2012). Infecções de pele por esta espécie e por S. aureus são comumente relatadas em cães, inclusive em nosso estado. Além disso, outras espécies como Staphylococcus schleiferi e Staphylococcus simulans também são isoladas de espécimes clínicos, inclusive de infecções de pele (Penna et al., 2010a, 2013b; Worthing et al., 2017)

1.1. Staphylococcus aureus

Desde os primeiros relatos de infecções por S. aureus em 1882 (Ogston, 1882), esta espécie tem ganhado cada dia mais atenção na medicina. Sendo uma das bactérias de maior importância clinica humana nas últimas décadas, é conhecida por ser responsável por uma série de infecções, como infecções de pele e em tecidos moles, endocardite, pneumonia, septicemia entre outras (Gordon e Lowy, 2008).

Uma série de fatores de virulência é responsável pelo sucesso da infecção estafilocócica no indivíduo. Além dos diversos componentes da superfície celular relacionados à invasão, adesão e evasão do sistema imune do hospedeiro, S. aureus é capaz de produzir vários tipos de enzimas e toxinas, como: toxinas citolíticas, enterotoxinas e toxinas superantígenos (Otto, 2014).

Em humanos, S. aureus é a principal causa de bacteremia, acometendo principalmente crianças, até o primeiro ano de vida, e idosos (Laupland et al., 2012). Pacientes em hemodiálise e portadores do vírus HIV também apresentam risco

(13)

aumentado para este tipo de infecção por S. aureus (Laupland et al., 2012). Já foi observado também que a incidência desta infecção em populações negras, nos EUA, e em populações indígenas, na Austrália, é significantemente maior do que em populações brancas e não indígenas, respectivamente (Klevens et al., 2007; Tong et al., 2012). Esta espécie também é responsável pela maior parte das endocardites infecciosas no mundo, principalmente em pacientes com válvula prostética. Além disso, cepas com fatores de virulência específicos estão comumente associadas a uma variedade de infecções de pele e tecidos moles na comunidade, sendo a espécie mais isolada de infecções de sítio cirúrgico, abscessos cutâneos e celulite purulenta (Gordon e Lowy, 2008; Tong et al., 2015). Outros quadros causados por S. aureus incluem a síndrome do choque tóxico, a síndrome da pele escaldada e a intoxicação alimentar (Bukowski,Wladyka e Dubin, 2010; Otto, 2014).

Outra questão importante sobre esta espécie é a resistência aos antimicrobianos, visto que S. aureus apresenta notável capacidade de adquirir genes de resistência. Essa aquisição pode ocorrer tanto de outras cepas de S. aureus como também de outras espécies do mesmo gênero ou ainda de espécies de outros gêneros (Haaber,Penadés e Ingmer, 2017).

Apesar de ser capaz de colonizar mucosas e pele de humanos saudáveis sem causar nenhum dano, portadores desta bactéria podem estar em risco de autoinfecção e são considerados uma importante fonte de disseminação desta bactéria (Chambers e Deleo, 2010). A colonização ocorre mais comumente nas fossas nasais, porém esta bactéria já foi isolada de diversos outros sítios como faringe, períneo, axila, vagina, mãos, dentre outros (Sollid et al., 2014).

Os indivíduos têm sido classificados em três categorias em relação à colonização por S. aureus: portadores persistentes, portadores intermitentes e não portadores. Entretanto, a reclassificação dessas categorias tem sido proposta devido às semelhanças entre portadores intermitentes e não portadores, como a forma com que estes são capazes de se erradicar da colonização nasal e o seu perfil de anticorpos antiestafilocócicos (Van Belkum et al., 2009). Apesar disso, a classificação dos indivíduos quanto a estas categorias depende da metodologia de cada estudo (Wertheim et al., 2005).

Em geral, em torno de 30% dos indivíduos são portadores, mas a prevalência da colonização por S. aureus pode variar de acordo com a população estudada. Essa

(14)

variação se deve a vários fatores diferentes, como idade, sexo, localização geográfica, determinadas doenças (ex. diabetes), uso de contraceptivos hormonais, fumo, exposição constante a ambientes hospitalares, entre outros (Sollid et al., 2014).

Apesar de S. pseudintermedius ser o patógeno deste gênero com maior importância clínica veterinária em cães, infecções por S. aureus nestes animais são comumente relatadas, principalmente em infecções de pele (Penna et al., 2010b, 2013b; Worthing et al., 2017). Além disso, podem causar infecções em cães no trato respiratório superior, otite e infecção urinária (Peton e Le Loir, 2014). Assim como S. pseudintermedius, S. aureus pode ser encontrado colonizando cães saudáveis, porém com menor prevalência (Boost,O’Donoghue e James, 2007; Gómez-Sanz et al., 2013a; Drougka et al., 2016).

1.2. Staphylococcus aureus resistente à meticilina (MRSA)

S. aureus é capaz de adquirir resistência a diferentes antimicrobianos, sendo muitas vezes através da transferência horizontal de genes de outras espécies. Sua elevada capacidade de obter resistência é um dos fatores pelo qual lhe é atribuído sua grande importância clínica (Chambers e Deleo, 2010).

Antes da introdução da penicilina no início da década de 1940, as infecções invasivas por S. aureus eram frequentemente fatais. Com o tratamento por meio deste antimicrobiano, a taxa de mortalidade de pacientes com infecções bacterianas sofreu importante redução (Figueiredo e Ferreira, 2014). Entretanto, devido à pressão seletiva pelo uso intenso deste fármaco, cepas resistentes começaram a emergir. Em 1942, houve o primeiro relato de infecção causada por uma cepa de S. aureus resistente à penicilina. Nas duas décadas seguintes, a proporção de infecções causadas por cepas resistentes à penicilina aumentou e se tornou pandêmica (Chambers e Deleo, 2010).

A penicilina é um antibiótico da classe dos β-lactâmicos, os quais inibem a síntese da parede celular bacteriana através da ligação às proteínas ligantes da penicilina (PBP, do inglês, penicillin-binding proteins). As PBP têm como função catalisar a construção da malha de peptideoglicano presente na parede por ligação entre as cadeias peptídicas. Assim, este antimicrobiano impede a formação da parede celular, forçando a degradação da mesma pela bactéria e, consequentemente, levando à morte celular (Chambers e Deleo, 2010). As cepas de S. aureus resistentes

(15)

à penicilina apresentavam um plasmídeo que carreava um gene codificador de uma β-lactamase. Esta enzima é capaz de degradar a penicilina, permitindo a sobrevivência da bactéria à exposição do antimicrobiano (Chambers e Deleo, 2010).

O desenvolvimento de novos antimicrobianos foi necessário a medida que a resistência à penicilina se tornou um problema grave. Penicilinas semissintéticas, resistente às β-lactamases, como a oxacilina e a meticilina, foram desenvolvidas e começaram a ser utilizadas. Entretanto, no início da década de 1960, foram relatadas infecções por cepas de S. aureus resistentes à meticilina, conhecidas como MRSA (do inglês, methicillin-resistant Staphylococcus aureus) (Figueiredo e Ferreira, 2014). Apesar do mecanismo de resistência só ter sido elucidado na década de 1980, naquele momento já se sabia que era diferente do mecanismo da resistência à penicilina por não haver indícios de degradação do antimicrobiano (Chambers e Deleo, 2010).

Inicialmente, cepas de MRSA eram encontradas apenas em infecções em unidades de saúde, com maior ocorrência na Europa e em casos isolados nos Estados Unidos. Entretanto, ao longo dos anos, MRSA começou a ser responsável por surtos em unidades de saúde e se disseminou pelo resto do mundo. Por muito tempo, a vancomicina foi o único tratamento disponível para infecções por MRSA. No final dos anos de 1990 e início dos anos 2000, cepas de MRSA com susceptibilidade reduzida (VISA, do inglês vancomycin-intermediate S. aureus) e com resistência à vancomicina (VRSA, do inglês vancomycin-resistant S. aureus) começaram a ser relatadas, inclusive no Brasil (Hiramatsu et al., 1997; Oliveira et al., 2001).

Apesar da nomenclatura, cepas de MRSA não são resistentes apenas à meticilina, mas a todos os β-lactâmicos com exceção das novas cefalosporinas de quinta geração (Anderson e Gums, 2008; Parish e Scheinfeld, 2008). Essa resistência é conferida pelo gene mecA, responsável por codificar uma nova PBP (PBP2a) que possui baixa afinidade pelos β-lactâmicos (Figueiredo e Ferreira, 2014). Esse gene está inserido em uma grande ilha genômica conhecida como SCCmec (do inglês, staphylococcal cassette chromosome mec), que está integrada ao cromossomo da bactéria. Além do gene mecA, esta ilha carreia seus genes regulatórios e genes de recombinases. Além disso, o SCCmec pode conter genes de resistência para outras classes de antimicrobianos (Katayama,Ito e Hiramatsu, 2000). Até o momento, onze diferentes tipos e subtipos de SCCmec foram descritos (http://www.sccmec.org,

(16)

acesso em 14/01/2018), estando associados a diferentes cepas de MRSA com características epidemiológicas distintas.

1.2.1. Staphylococcus aureus resistente à meticilina adquirido na comunidade (CA-MRSA) e em hospitais (HA-MRSA)

Inicialmente, MRSA era considerado um patógeno responsável por infecções relacionadas à assistência à saúde (IRAS), que são infecções adquiridas após a admissão do paciente no ambiente hospitalar. Entretanto, no início da década de 1990, MRSA emergiu como agente de infecções na comunidade e assim se estabeleceu como um dos patógenos de maior importância clínica da atualidade. MRSA que causavam infecções na comunidade eram cepas com características diferentes daquelas que causavam infecções nos hospitais, como susceptibilidade a outras classes de antimicrobianos que não fossem β-lactâmicos e maior virulência (Chambers e Deleo, 2010). Dessa forma, foram denominados HA-MRSA e CA-MRSA (do inglês, Hospital-acquired MRSA e Community-acquired MRSA) para diferenciar estes dois tipos de cepas (Figueiredo e Ferreira, 2014). Inicialmente, as infecções por CA-MRSA e por HA-MRSA eram adquiridas na comunidade e no ambiente hospitalar, respectivamente. Entretanto, as infecções por estas cepas não ficaram restritas aos seus ambientes de origem. Nos últimos anos, cepas de CA-MRSA têm sido responsáveis também por infecções no ambiente hospitalar (Nichol et al., 2011; Hadler et al., 2012).

Estas cepas apresentam várias características que as diferenciam, como por exemplo o perfil de resistência aos antimicrobianos, tipo de infecção e, principalmente, o genótipo (Loewen et al., 2017). As cepas de HA-MRSA possuem principalmente SCCmec dos tipos I, II e III, os quais são tipos maiores e abrigam normalmente genes de resistência para outras classes de antimicrobianos. Já as cepas de CA-MRSA, possuem SCCmec dos tipos IV ou V, os quais são menores e, por isso, normalmente não carreiam outros genes de resistência sendo mais suscetíveis quando comparadas com as HA-MRSA (Loewen et al., 2017). O fato do SCCmec do tipo IV possuir um tamanho muito menor do que os outros tipos, pode estar associado a disseminação de CA-MRSA. Sendo menor, este cassete exige menos gasto metabólico da bactéria, permitindo de forma mais eficiente sua disseminação (Otto, 2010).

(17)

Cepas de CA-MRSA também estão mais associadas a infecções de pele e tecidos moles, que apresentam grandes taxas de mortalidades (Otto, 2010). Acredita-se que tal fato esteja associado a genes de virulência mais comumente encontrados nesta cepa do que nas de origem hospitalar (Loewen et al., 2017). Apesar desta informação ainda não ser tão clara, ao fator de virulência Panton-Valentine leukocidin (PVL) tem sido atribuído parte deste maior potencial de virulência (Tristan et al., 2007; Spaan et al., 2013). Genes que codificam a PVL têm sido detectados principalmente em CA-MRSA, sendo por um tempo considerados marcadores destas cepas. A PVL é uma toxina formada por duas diferentes subunidades denominadas LukS-PV e LukF-PV, codificadas respectivamente pelos genes lukS-PV e lukF-PV. Estas subunidades se ligam a receptores da membrana de leucócitos, formando poros e causando a lise celular (Spaan et al., 2013). Evidências sugerem que esta toxina esteja associada a infecções de pele graves e a formação de abscessos, como aquelas geralmente associadas a infecções por CA-MRSA (Chambers e Deleo, 2010; Otto, 2010). Entretanto, a utilização dos genes desta toxina como marcadores genéticos de cepas de CA-MRSA ainda é controversa, visto que esta toxina não tem se demonstrado essencial para o estabelecimento de infecções por esta cepa. Ainda assim, ela continua sendo mais comumente detectada em CA-MRSA do que em HA-MRSA (Otto, 2010, 2014)

Alguns fatores de risco diferentes também estão associados a infecções por estas duas classes. O contato frequente com o ambiente hospitalar, como hospitalização e até mesmo o trabalho nestes locais, está associado a infecções por HA-MRSA. Já em relação às infecções por CA-MRSA, evidências indicam que baixas condições de saneamento, habitações superlotadas, frequente contato pele a pele, entre outras condições sociais e sanitárias, possam ser fatores de risco (Loewen et al., 2017).

1.2.2. Caracterização molecular de Staphylococcus aureus resistentes à meticilina (MRSA)

Para melhor entendimento da dinâmica populacional e da disseminação de MRSA pelo mundo, assim como da caracterização de linhagens específicas, técnicas moleculares são amplamente empregadas. A combinação dos resultados obtidos pelas técnicas de genotipificação do SCCmec, a análise de perfil de restrição de DNA

(18)

pela eletroforese em gel de campo pulsado (PFGE, do inglês pulsed-field gel electrophoresis) e a análise de sequências de regiões de genes de isoenzimas (MLST, do inglês multilocus sequence typing) têm sido utilizadas na identificação das linhagens ou clones epidêmicos de MRSA, ou seja, daqueles mais disseminados em unidades de saúde e na comunidade no mundo (Figueiredo e Ferreira, 2014).

Na técnica de genotipificação do SCCmec, é determinado o tipo ou subtipo desta ilha de resistência pela reação em cadeia da polimerase (PCR, do inglês, polymerase chain reaction) (Zhang et al., 2005). A PFGE consiste na digestão do DNA genômico, com enzimas de restrição para sítios de clivagem pouco frequentes e posterior eletroforese em campo pulsado, sendo o resultado um perfil de bandas (Bannerman et al., 1995). Já a MLST consiste no sequenciamento e análise de fragmentos internos de sete genes de isoenzimas. De acordo com o perfil alélico obtido na análise, identifica-se a sequência tipo (ST, do inglês, sequence type) a que pertence a cepa bacteriana. Cada perfil alélico corresponde a um ST e estes podem ser agrupados em complexos clonais (CC, do inglês, clonal complex) quando diferem na sequência de nucleotídeos em apenas um gene. Aos ST e CC são atribuídos uma numeração (Enright et al., 2000). Dessa forma, foi possível estabelecer associação entre linhagens e determinados hospedeiros, tipos de infecção e regiões geográficas. Uma das vantagens da MLST sobre a PFGE é a facilidade de comparação de resultados de diferentes estudos, pois a primeira técnica compara sequências de DNA e a segunda perfis de bandas.

MRSA dos CC5, CC8, CC22, CC30 e CC45 são os mais frequentemente envolvidos em infecções em humanos pelo mundo. Diversas linhagens epidêmicas amplamente conhecidas pertencem a estes complexos e distribuem-se pelo mundo todo, sendo as do CC5 e CC8 as mais prevalentes (Stefani et al., 2012).

Duas linhagens epidêmicas de HA-MRSA do CC5 de ampla distribuição são USA100 (ST5-HA-MRSA-SCCmecII) e USA800 (ST5-HA-MRSA-SCCmecIV). USA100, também conhecido como clone Nova Iorque/Japão, encontra-se amplamente distribuída pelos EUA, Canadá, Japão, Coréia do Sul, Europa e Austrália. Já USA800, também conhecido como clone pediátrico, é encontrado principalmente na Europa, América do Sul e EUA.

O clone USA300 (ST8-MRSA-SCCmecIV), pertencente ao CC8, é um CA-MRSA encontrado principalmente na Ásia, Austrália, Europa e EUA. Outro destaque

(19)

do CC8 é o clone epidêmico brasileiro (ST239-HA-MRSA-SCCmecIII) predominantemente encontrado em várias regiões do nosso país.

O clone USA1100 (ST30-CA-MRSA-SCCmecIV), também conhecido por OSPC (do inglês, Oceania Southwest Pacific clone), pertence ao CC30 e tem sido encontrado na América do Sul e EUA (Deurenberg e Stobberingh, 2008; Stefani et al., 2012; Figueiredo e Ferreira, 2014). No trabalho de Quitoco e colaboradores (2013), este clone foi encontrado colonizando um gato.

Além disso, MRSA do CC398 tem sido associado a animais de pecuária, principalmente suínos (Moodley et al., 2012; Peton e Le Loir, 2014). Porém, esta linhagem já foi identificada em cães e em outros animais (Drougka et al., 2016; Lozano et al., 2016). Apesar de associado a animais, linhagens deste CC também já foram encontradas causando infecções em humanos, assim como linhagens ditas humanas de origem hospitalar já foram isoladas de espécimes clínicos de origem canina (Krziwanek,Metz-Gercek e Mittermayer, 2009; Worthing et al., 2017).

A caracterização molecular das linhagens apresenta grande importância, já que dessa forma é possível estudar a epidemiologia global de MRSA, sua dinâmica populacional em diversas regiões do planeta, a evolução da resistência aos antimicrobianos entre outras questões (Deurenberg e Stobberingh, 2008). Dessa forma, é possível determinar fatores de risco para colonização e infecção por estas linhagens, novas formas de tratamento e realizar o controle da disseminação desta espécie.

1.3. Transmissão de Staphylococcus aureus resistente à meticilina (MRSA) entre cães e humanos

Apesar de sempre ter sido considerado um patógeno humano, infecções por MRSA em animais são cada vez mais descritas pelo mundo. Além disso, diversos estudos sobre colonização por MRSA em animais têm sido elaborados, mostrando que esta é capaz de colonizar diversas espécies (Lozano et al., 2016). Ainda não está claro se as infecções em animais são sempre de origem humana, principalmente devido à descoberta de linhagens com grande associação a animais (Price et al., 2012). Porém, devido ao grande número de relatos de colonização por MRSA em animais, torna-se importante caracterizar e analisar a dinâmica populacional destas linhagens.

(20)

Além dos animais de pecuária, diversos relatos de colonização por MRSA e S. aureus sensíveis à meticilina (MSSA, do inglês methicillin-susceptible S. aureus) em animais de estimação já foram realizados por todo o mundo (Boost,O’Donoghue e James, 2007; Gómez-Sanz et al., 2013a; Davis et al., 2014; Wedley et al., 2014; Iverson et al., 2015; Misic et al., 2015; Mouney et al., 2015; Bean e Wigmore, 2016; Drougka et al., 2016). A relação entre cães e seus proprietários confere grande contato entre os mesmos, com animais compartilhando espaços e objetos da casa. Tal fato pode determinar a transmissão mútua de bactérias entre humanos e cães. Desta forma, os cães podem ser mais uma fonte de infecção de MRSA para seres humanos. Sabe-se que é possível cães estarem colonizados temporariamente com linhagens de S. aureus originadas de seus proprietários (Gómez-Sanz et al., 2013b). Portanto, mesmo que a linhagem colonizando o animal seja de origem humana, este pode funcionar como reservatório.

Além disso, outras espécies de Staphylococcus, incluindo algumas mais frequentemente encontradas em cães, podem ser resistentes à meticilina (MRS, do inglês methicillin-resistant Staphylococcus). A resistência à meticilina nestas espécies também ocorre por meio do gene mecA, logo são reservatórios deste gene de resistência. Desta forma, há a possibilidade do gene de resistência ser transferido de MRS para S. aureus (Otto, 2009; Söderquist e Berglund, 2009; Haaber,Penadés e Ingmer, 2017). Várias espécies de MRS também são de grande importância na clínica veterinária, sendo mais prevalentes do que MRSA em cães (Gómez-Sanz et al., 2013a; Penna et al., 2013b; Quitoco et al., 2013).

Ainda não são conhecidas as linhagens de MRSA que circulam entre a população canina em nosso país, assim como se as linhagens circulantes estão sendo compartilhadas com contatos humanos. Apesar de estudos sobre colonização de animais de estimação por MRS e MRSA terem sido conduzidos em outros países, poucos estudos no Brasil foram reportados (Muniz,Penna e Lilenbaum, 2013; Penna et al., 2013a; Quitoco et al., 2013). A investigação de colonização de cães por estas bactérias e do compartilhamento de suas linhagens entre cães e humanos são imprescindíveis para esclarecer o impacto atual e futuro destes animais como reservatório. Além disto, o conhecimento do que ocorre em nossa região é imprescindível para identificar a necessidade de se estabelecer medidas que possam proteger a população local.

(21)

2. OBJETIVOS

2.1. Objetivo Geral

Investigar a ocorrência de colonização nasal por MRSA e MSSA em cães e seus contatos humanos, e por outros MRS em cães, residentes em municípios do Rio de Janeiro, além do compartilhamento de linhagens entre estes hospedeiros.

2.2. Objetivos específicos

1. Identificar cães e seus contatos humanos colonizados por MSSA e MRSA, além de cães colonizados por outras espécies de MRS.

2. Avaliar a sensibilidade a antimicrobianos de uso clínico das amostras Staphylococcus spp. obtidas, incluindo a sensibilidade à vancomicina para amostras resistentes à meticilina.

3. Identificar as linhagens de MRSA circulantes em cães residentes em municípios do Rio de Janeiro, a partir da tipificação do SCCmec, detecção da PVL e pela técnica de MLST, e o possível compartilhamento com seus contatos humanos.

4. Avaliar características dos cães e seus contatos humanos que possam estar associadas à colonização nasal por MSSA e MRSA.

(22)

3. METODOLOGIA

3.1. Desenho do estudo

O estudo proposto investigou a colonização de cães e seus contatos humanos por S. aureus e MRSA, o perfil de resistência aos antimicrobianos, as características moleculares das amostras de MRSA, a ocorrência de transmissão de MRSA entre os dois hospedeiros e quais linhagens de MRSA estão circulando em cães residentes em municípios do Rio de Janeiro. Além disso, também, investigou a colonização de cães por MRS. O desenho de estudo utilizado encontra-se esquematizado na Figura 1.

Para isto, foram coletados swabs nasais de cães e de seus proprietários em três unidades de saúde veterinária, assim como de veterinários e tosadores destas unidades. Os swabs foram semeados em meio de cultura seletivo para isolamento de estafilococos com e sem oxacilina. O meio com o antibiótico foi utilizado para facilitar o isolamento de MRSA. Foram selecionadas até cinco colônias suspeitas de serem S. aureus (fermentadoras de manitol) do meio com e do meio sem oxacilina. Para cães, também foram selecionadas até cinco colônias suspeitas de serem outras espécies de Staphylococcus (não fermentadoras de manitol) no meio com oxacilina, com a finalidade de detectar MRS. Após a identificação bacteriana por MALDI-TOF e métodos fenotípicos convencionais, todas as colônias selecionadas identificadas como S. aureus ou outras espécies do gênero, no caso das isoladas do meio com oxacilina isoladas de cão, foram analisadas pelo método de disco-difusão para determinação do perfil de resistência aos antimicrobianos. A determinação da resistência a meticilina foi realizada com a utilização do disco de cefoxitina ou oxacilina. As amostras resistentes a estes dois últimos antimicrobianos foram confirmadas como MRSA por meio da detecção do gene de resistência à meticilina mecA.

A determinação da susceptibilidade à vancomicina, pelo método de microdiluição, foi realizada para amostras de MRSA, assim como a tipificação do SCCmec e à presença dos genes para toxina PVL. Por fim, as amostras de MRSA de cães foram identificadas pela técnica de MLST para determinação de suas linhagens. Todas as colônias de outras espécies de Staphylococcus isoladas de cães isoladas do meio com oxacilina, logo potencialmente MRS, foram submetidas também ao método de disco-difusão. Amostras resistentes à cefoxitina ou oxacilina foram

(23)

avaliadas quanto a presença do gene mecA. As amostras que carreavam o gene mecA foram também analisadas quanto à susceptibilidade à vancomicina pelo método de microdiluição.

Questionários respondidos pelos contatos humanos foram analisados para identificar características que possam estar associadas a colonização por S. aureus e MRSA.

(24)

Figura 1 – Desenho de estudo. AMS: ágar manitol salgado; CFO: cefoxitina; MAN (+): fermenta manitol; MAN (-): não fermenta manitol; OXA: oxacilina.

Cão Swab nasal NANNASALna Humano Swab nasal AMS AMS + OXA AMS AMS + OXA PCR mecA MRSA Cão Humano Microdiluição vancomicina MALDI-TOF Disco-difusão Até 5 UFC MAN (+) MAN (-) Até 5 UFC MAN (+) Até 5 UFC

MAN (+) Até 5 UFCMAN (+)

Outros Staphylococcus (cão) (Cão) S. aureus (cão) S. aureus (humano) Resistência CFO/OXA (+) PCR SCCmec PVL MRS Cão MLST MRSA (cão e humano) MRSA (cão)

(25)

3.2. Origem e coleta das amostras

A coleta foi realizada no Hospital Universitário de Medicina Veterinária Professor Firmino Mársico Filho da Universidade Federal Fluminense (HUVET-UFF), em uma clínica veterinária particular e no Instituto Municipal de Medicina Veterinária Jorge Vaitsman. O HUVET-UFF localiza-se no município de Niterói enquanto as outras duas unidades de saúde veterinárias localizam-se no município do Rio de Janeiro. As amostras foram obtidas no período entre maio de 2015 e janeiro de 2017. Um total de 290 cães, 288 proprietários, oito médicos veterinários e três tosadores foram incluídos no estudo. Todos os proprietários incluídos no estudo eram maiores de 18 anos.

As amostras bacterianas foram coletadas por meio de swabs, umedecidos em solução salina estéril, das fossas nasais dos cães e de seus contatos humanos. Após a coleta, os swabs foram transportados em meio de Stuart (Citotest Labware Manufacturing CO, Haimen Town, Jiangsu, China) até o laboratório para processamento. Apenas um cão por proprietário participou do estudo, com exceção de dois proprietários, para os quais dois cães de cada foram submetidos à coleta.

Os proprietários e profissionais submetidos à coleta também responderam a um questionário epidemiológico, contendo perguntas sobre características que possam estar associadas à colonização por S. aureus (Anexo 1 e 2).

Os indivíduos investigados residiam em diferentes cidades da região metropolitana do Rio de Janeiro, sendo estas Duque de Caxias, Maricá, Niterói, São Gonçalo e o próprio munícipio do Rio de Janeiro.

No ano de 2015, foram coletadas amostras de 134 cães, 132 proprietários, quatro médicos veterinários e três tosadores. Em 2016, foram coletadas amostras de 129 cães e 129 proprietários. Já em 2017, foram coletas amostras de 27 cães, 27 proprietários e 4 médicos veterinários.

Diversas raças foram identificadas entre os cães investigados: 47 como Poodle, 24 como Yorkshire, 14 como Shih Tzu, 13 como Labrador, 10 como Pinscher e 10 como Pug, além de outros 68 cães identificados como outras raças e 96 como sem raça definida. Por fim, para seis cães não foi obtida resposta quanto a raça.

A idade dos cães também foi investigada, sendo classificados em filhotes (menos de um ano), adultos (idade entre um e sete anos) e idosos (mais de sete anos). Dessa forma, foram identificados 36 cães como filhotes, 112 como adultos, 139 como

(26)

idosos e quatro com idade desconhecida. Já em relação ao sexo dos animais, foram identificados 135 cães como machos, 154 como fêmeas e, para um, esta informação não constava no questionário. Por fim, em relação ao motivo da ida a clínica, 221 animais foram levados por estarem com alguma doença, 23 para realização de cirurgia e 46 por outros motivos.

3.3. Considerações éticas

O projeto foi aprovado pelo Comitê de Ética no Uso de Animais (projeto 495, 13/03/2014), pelo Comitê de Ética em Pesquisa da UFF (parecer 680.135, 06/06/2014) e pelo Comitê de Ética em Pesquisa da Secretaria Municipal de Saúde do Rio de Janeiro (parecer 1.374.329, 17/12/2015). Todos os proprietários foram informados sobre o estudo e assinaram termos de consentimento para a coleta de amostras dos seus cães e de si mesmos.

3.4. Isolamento e identificação bacteriana

Cada swab foi semeado em duas placas contendo ágar manitol salgado (Becton, Dickinson and Company BD, Sparks, Maryland, USA), sendo uma sem e outra com oxacilina (Sigma Chemical CO, St. Louis, Missouri, USA) na concentração de 2 µg/mL (Kampf et al., 1998). As placas foram incubadas à 37ºC, em aerobiose, por 24-48h.

Foram selecionadas até cinco colônias fermentadoras de manitol, característica típica de Staphylococcus aureus, tanto do meio sem quanto do meio com oxacilina. Apenas para cães, do meio com oxacilina, foram também selecionadas até cinco colônias não fermentadoras para rastrear outras espécies de Staphylococcus potencialmente resistentes à meticilina. Cada colônia foi semeada em meio ágar tripticase soja (Becton, Dickinson and Company BD) e, após incubação a 37ºC por 24h, em aerobiose, estocadas em 1,0 mL de leite desnatado na concentração de 10%, adicionado de glicerol a 10%, na temperatura de -20ºC.

A identificação foi realizada para todas as colônias obtidas, por meio de métodos fenotípicos convencionais (coloração de Gram, teste da catalase e teste da coagulase em tubo) e pelo método de MALDI-TOF (do inglês, Matrix assisted laser desorption ionization – Time of flight). As colônias de origem canina e humana identificadas como S. aureus foram selecionadas para o estudo assim como outras

(27)

espécies de Staphylococcus de origem canina que cresceram na placa de ágar manitol salgado contendo oxacilina.

3.4.1. Métodos de identificação fenotípicos convencionais

A partir do crescimento bacteriano em meio de ágar tripticase soja à 37°C por 24 horas, foram realizados três métodos fenotípicos convencionais para as colônias suspeitas de serem S. aureus: a coloração de Gram, o teste da catalase e o teste da coagulase em tubo. Para as demais colônias selecionadas, foi realizada a coloração de Gram e o teste da catalase. As espécies de Staphylococcus são cocos Gram positivos com arranjo em grupo e são produtoras de catalase, sendo a espécie S. aureus também uma das produtoras da coagulase livre.

Para o teste da catalase, uma pequena massa bacteriana foi exposta a uma gota de peróxido de hidrogênio a 3% em uma lâmina de vidro. Os estafilococos produzem gás oxigênio a partir da degradação do peróxido de hidrogênio pela enzima catalase, formando pequenas bolhas desse gás. A cepa S. aureus ATCC 25923 foi utilizada como controle positivo.

Para o teste da coagulase em tubo, foi utilizado plasma de coelho liofilizado Coagu-Plasma LB (Laborclin, Pinhais, Paraná, Brasil), previamente suspendido em solução salina 0,85%. Uma pequena massa do crescimento bacteriano foi adicionada a tubos estéreis contendo 0,25 mL do plasma suspendido. Os tubos foram incubados a 37°C em aerobiose e observados a cada hora, por um período de quatro horas, e, caso não apresentassem positividade, observados também até completar 24h. As amostras produtoras de coagulase formam um coágulo visível dentro deste período de tempo. A cepa S. aureus ATCC 25923 foi utilizada como controle positivo.

3.4.2. Identificação por MALDI-TOF

Além da identificação convencional por testes fenotípicos, foi realizada a identificação pela tecnologia MALDI-TOF, no equipamento MALDI Biotyper 3.1 (Bruker Daltonik, Fahrenheitstraße, Bremen, Germany), no Instituto de Microbiologia Paulo de Góes, da Universidade Federal do Rio de Janeiro. O teste foi realizado a partir de um crescimento bacteriano em meio ágar tripticase soja incubado à 37ºC, por 24h, em aerobiose. Uma pequena massa deste crescimento bacteriano para cada amostra a ser identificada foi aplicada em uma placa de metal em duplicata. Sobre

(28)

cada uma das amostras aplicadas nesta placa, foi adicionado ácido fórmico 70% e uma matriz composta por ácido α-ciano-hidroxicinâmico (10 mg/mL) para, então, a placa ser analisada no equipamento com auxílio do software FlexControl 3.1 (Bruker Daltonik, Fahrenheitstraße, Bremen, Germany). Uma cepa Escherichia coli foi utilizada como controle da análise.

Os resultados obtidos por MALDI-TOF foram considerados como a identificação final das espécies das amostras bacterianas investigadas, considerando escores superiores a 2000.

3.5. Determinação da sensibilidade a antimicrobianos 3.5.1. Teste de disco-difusão

A técnica de disco-difusão foi utilizada para determinar o perfil de resistência aos antimicrobianos das amostras bacterianas já identificadas e selecionadas para o estudo. O teste foi realizado seguindo os padrões recomendados pelo Clinical and Laboratory Standards Institute (CLSI, 2017).

A partir do crescimento bacteriano em meio de ágar tripticase soja à 37°C por 24 horas, foi realizada uma suspensão bacteriana em solução salina 0,85% estéril, na turvação 0,5 da escala de McFarland (1-2x108 UFC/mL). Em seguida, com o auxílio de um swab estéril, a suspensão foi semeada em ágar Mueller Hinton (Becton, Dickinson and Company BD), onde foram depositados os discos de antimicrobianos. O teste foi realizado para os seguintes antimicrobianos: cefoxitina (30 µg), ciprofloxacina (5 µg), clindamicina (2 µg), cloranfenicol (30 µg), eritromicina (15 µg), gentamicina (10 µg), norfloxacina (10µg), oxacilina (1 µg), penicilina G (10 UI), rifampicina (5 µg), tetraciclina (30 µg) e sulfametoxazol+trimetropina (1,25/23,75 µg) (CECON, Vila Sonia, São Paulo, Brasil).

Após incubação à 37ºC por 24 horas, o resultado foi avaliado a partir do diâmetro do halo de inibição do crescimento formado em volta dos discos. A resistência à meticilina foi identificada a partir do resultado observado para o disco de cefoxitina para todas as espécies, com exceção das espécies do SIG. Para SIG, foi identificada a resistência à meticilina pelo disco de oxacilina. A cepa S. aureus ATCC 25923 foi utilizada como controle.

Também foi observada a resistência induzida à clindamicina pelo método do disco duplo que consiste em posicionar os discos de clindamicina e eritromicina a 1,5

(29)

mm de distância. A observação da redução do halo de inibição do crescimento ao redor do disco de clindamicina na área entre os dois discos indica resistência induzida. Colônias isoladas do mesmo indivíduo que apresentaram mesmo perfil de resistência foram consideradas como sendo a mesma amostra.

3.5.2. Teste de microdiluição em caldo para vancomicina

Também foi realizado o teste de microdiluição em caldo para avaliar a suscetibilidade à vancomicina para as amostras de MRSA e MRS. Para a produção das placas e a interpretação dos resultados, foram seguidos os padrões e recomendações do CLSI (2008; 2017).

Para a produção das placas de microdiluição com as diferentes concentrações do antimicrobiano, uma solução estoque de vancomicina de 10 mg/mL foi inicialmente preparada. A partir desta solução estoque, foi realizada uma diluição seriada à metade em caldo Mueller Hinton (Becton, Dickinson and Company BD) adicionado de cátions (Ca++ 25 mg/L e Mg++ 12,5 mg/L) de forma a obter concentrações variando de 0,125 µg/mL a 256 µg/mL. Com o auxílio da pipeta multicanal, foi distribuído 0,1 mL do meio contendo o antimicrobiano nos poços da microplaca, de forma que cada coluna estivesse preenchida com uma concentração diferente.

Para a realização do teste, utilizou-se um crescimento bacteriano em meio de ágar tripticase soja, incubado à 37°C por 24 horas, de cada amostra bacteriana. Foi realizada então uma suspensão em solução salina estéril, na turvação 0,5 da escala de McFarland. Desta suspensão, uma alíquota de 0,1 mL foi diluída em 1,9 mL de solução salina estéril, resultando na concentração de 5x106 UFC/mL. Desta suspensão final, 10 µL foram inoculados em um poço de cada concentração diferente ao longo da placa, de forma que cada poço continha uma concentração de aproximadamente 5x105 UFC/mL. Os resultados foram avaliados após incubação à 37º C por 18 horas, observando a formação ou não de crescimento bacteriano na forma de um precipitado no fundo de cada poço, seguindo as recomendações do CLSI (2017). A cepa S. aureus ATCC 29213 foi utilizada como controle.

3.6. Caracterização genotípica

Todas as amostras bacterianas, S. aureus e outras espécies, que apresentaram resistência à meticilina pelo método de disco-difusão, foram submetidas

(30)

à reação em cadeia da polimerase (PCR) para detecção do gene mecA (Zhang et al., 2005). Para as amostras de S. aureus que carreavam o gene mecA, foi realizada também a tipificação do SCCmec (Zhang et al., 2005) e a detecção dos genes da PVL (Von Eiff et al., 2004).

Uma amostra de MRSA de cada cão colonizado foi analisada pela técnica de MLST para identificação das linhagens circulantes em municípios do Rio de Janeiro (Enright et al., 2000).

3.6.1. Liberação de DNA

Para a realização destas técnicas, foi realizada a liberação de DNA das amostras bacterianas por meio da lise térmica, segundo Pacheco e colaboradores (1997) com modificações. Uma suspensão foi preparada a partir do crescimento bacteriano, em meio de ágar tripticase soja a 37° C por 24 horas, em 2,0 mL de solução tampão TE com pH 8,0 (Tris-HCL 10mM, EDTA 1nM), na escala 6 de McFarland. Desta suspensão, 558 µl foram transferidos para um tubo de 1,5 ml e centrifugado a 12.000 x G por 1 minuto. O sobrenadante foi descartado e ao restante foi adicionado 200µl de tampão TE, para em seguida ser levado ao banho seco à 100ºC, por 10 minutos. Por fim, a suspensão foi novamente centrifugada a 12.000 xg por 1 minuto e o sobrenadante, contendo o DNA liberado, foi coletado e armazenado à -20ºC, para posterior utilização nas técnicas moleculares.

3.6.2. Detecção do gene mecA e tipificação do SCCmec

Para a detecção do gene mecA e tipificação do SCCmec foi realizada a técnica de PCR segundo Zhang e colaboradores (2005) com modificações. Foi realizada PCR simples para detecção do mecA, SCCmec I e V, PCR multiplex para SCCmec IV (subtipos a, b, c, d) e PCR multiplex para os tipos II e III.

Para cada reação, o volume final foi de 25 L, contendo neste: 50 mM de KCl, 20 mM de Tris-HCl (pH 8.4), 2,5 mM de MgCl2, 0,2 mM de cada nucleotídeo trifosfatado (dATP, dCTP, dGTP e dTTP), várias concentrações dos respectivos iniciadores (Tabela 1), 1 U de Taq DNA polimerase (todos os reagentes, obtidos da Thermo Fisher Scientific, São Paulo, São Paulo, Brasil) e 2 L da solução contendo DNA da amostra analisada. A sequência dos iniciadores para detecção do mecA e dos tipos e subtipos de SCCmec estão indicados na Tabela 1.

(31)

As reações de amplificação foram realizadas em um termociclador (Applied Biosystems, Foster City, Califórnia, EUA) consistindo nas seguintes etapas: uma etapa inicial de desnaturação de 94ºC por 5 minutos, seguida de 10 ciclos de 94°C por 45 segundos, 65º C por 45 segundos e 72°C por 1,5 minutos, 25 ciclos de 94°C por 45 segundos, 55°C por 45 segundos e 72°C por 1,5 minutos, e uma etapa de extensão final de 72ºC por 10 minutos. A cepa MRSA USA100 foi utilizada como controle para detecção do mecA, e do SCCmec do tipo II, a MRSA HU25 para do tipo III e a WB45 para do tipo IVa.

3.6.3. Detecção do gene da toxina Panton-Valentine

Para a detecção dos determinantes genéticos da PVL, lukS-PV e lukF-PV, também foi realizada a técnica de PCR, segundo von Eiff e colaboradores (2004). O volume final desta reação foi 25 L, contendo neste: 50 mM de KCl, 20 mM de Tris-HCl (pH 8,4), 1,5 mM de MgCl2, 200 M de cada nucleotídeo trifosfatado (dATP, dCTP, dGTP e dTTP), 500 nM de cada iniciador (Tabela 1), 0,5U de Taq DNA polimerase (todos os reagentes, obtidos da Thermo Fisher Scientific) e 2,0 L da solução contendo DNA da amostra analisada.

As reações de amplificação foram realizadas no mesmo equipamento do item anterior, consistindo em uma etapa de desnaturação inicial de 95o C por 2 minutos, 30 ciclos de 95o C por 1 minuto, 55o C por 1 minuto e 72o C por 1 minuto, e uma etapa de extensão final de 72o C por 10 minutos. A cepa ATCC 49775 foi utilizada como controle positivo.

3.6.4. Visualização dos DNA amplificado

A visualização dos produtos obtidos nas reações de PCR foi realizada através da eletroforese em gel de agarose a 1% (Invitrogen, Carlsbad, Califórnia, EUA) em tampão TBE 0,5x (0,05 mM de Tris, 1,25 mM de EDTA e 0,05 M de ácido bórico, pH 8,4). O gel foi corado com brometo de etídio à 0,5 g/mL e observado sob luz ultravioleta no equipamento L-PIX (Loccus Biotecnologia, Cotia, SP, Brasil). Um marcador de 100 pb (Invitrogen, Carlsbad, Califórnia, EUA) foi utilizado para estimar o tamanho dos produtos obtidos. Os tamanhos dos produtos esperados encontram-se na Tabela 1.

(32)

Tabela 1 – Sequência e concentração de iniciadores utilizados para detecção de genes por PCR, e tamanho dos produtos esperados.

Iniciador Sequência de oligonucleotídeos

(5’ – 3’) Concentração (nM) Alvo Produto (pb) MecA147-F MecA147-R GTGAAGATATACCAAGTGATT ATGCGCTATAGATTGAAAGGA 48 mecA 147 Type I-F Type I-R GCTTTAAAGAGTGTCGTTACAGG GTTCTCTCATAGTATGACGTCC 48 Tipo I 613 Type II-F Type II-R CGTTGAAGATGATGAAGCG CGAAATCAATGGTTAATGGACC 32 Tipo II 398 Type III-F Type III-R CCATATTGTGTACGATGCG CCTTAGTTGTCGTAACAGATCG 40 Tipo III 280 Type IVa-F Type IVa-R GCCTTATTCGAAGAAACCG CTACTCTTCTGAAAAGCGTCG 104 Tipo IVa 776 Type IVb-F Type IVb-R TCTGGAATTACTTCAGCTGC AAACAATATTGCTCTCCCTC 92 Tipo IVb 493 Type IVc-F Type IVc-R ACAATATTTGTATTATCGGAGAGC TTGGTATGAGGTATTGCTGG 78 Tipo IVc 200 Type IVd-F Type IVd-R CTCAAAATACGGACCCCAATACA TGCTCCAGTAATTGCTAAAG 280 Tipo IVd 881 Type V-F Type V-R GAACATTGTTACTTAAATGAGCG TGAAAGTTGTACCCTTGACACC 60 Tipo V 325 PVL-1 PVL-2 ATCATTAGGTAAAATGTCTGGACATGATC CA GCATCAASTGTATTGGATAGCAAAAGC 500 lukS-PV lukF-PV 433

3.7. Multilocus sequence typing

A técnica de MLST foi realizada como descrito previamente por Enright e colaboradores (2000) para cada uma amostra de MRSA de cada cão colonizado. Inicialmente, foi realizada a amplificação por PCR de fragmentos de sete genes de isoenzimas identificados na Tabela 2. A liberação de DNA foi realizada como descrito no item 3.6.1. A reação consistia de um volume final de 50 μL contendo: 50 mM de KCl, 20 mM de Tris-HCl (pH 8,4), 1,5 mM de MgCl2, 200 μM de cada nucleotídeo trifosfatado (dATP, dCTP, dGTP e dTTP), 200 μM de cada iniciador (Tabela 2), 1U de

(33)

Taq polimerase (todos os reagentes, obtidos da Thermo Fisher Scientific) e 1,0 μL da solução contendo DNA. A amplificação foi realizada com uma etapa de desnaturação inicial de 95o C por 5 minutos, seguida de 30 ciclos de 95o C por 1 minuto, 55º C por 1 minuto e 72 o C por 1 minuto, seguidos de uma etapa de extensão final de 72o C por 2 minutos. A visualização dos produtos foi realizada como descrito no item 3.6.4. e os tamanhos esperados encontram-se na Tabela 2.

Os produtos da amplificação foram purificados pelo QIAquick PCR Purification kit (QIAGEN, Valencia, California, USA), como recomendado pelo fabricante e o DNA sequenciado no Laboratório Multiusuários de Microbiologia e Parasitologia, no

Instituto Biomédico, na UFF. O programa BioEdit

(http://www.mbio.ncsu.edu/bioedit/bioedit.html) foi utilizado para analisar as sequências dos genes. Posteriormente, as sequências foram submetidas ao site www.mlst.net para comparação com o banco de dados e determinação dos alelos e sequência tipo de cada amostra, além da identificação dos respectivos complexos clonais.

(34)

Tabela 2 - Iniciadores utilizados na técnica de MLST.

Gene Iniciadores Sequência de oligonucleotídeos

(5’ – 3’) Produto (pb) arcC arcC up arcC-dn TTGATTCACCAGCGCGTATTGTC AGGTATCTGCTTCAATCAGCG 456 aroE aroE-up aroE-dn ATCGGAAATCCTATTTCACATTC GGTGTTGTATTAATAACGATATC 456 glpF glpF-up glpF-dn CTAGGAACTGCAATCTTAATCC TGGTAAAATCGCATGTCCAATTC 465 gmk gmk-up gmk-dn ATCGTTTTATCGGGACCATC TCATTAACTACAACGTAATCGTA 429 pta pta-up pta-dn GTTAAAATCGTATTACCTGAAGG GACCCTTTTGTTGAAAAGCTTAA 474 tpi tpi-up tpi-dn TCGTTCATTCTGAACGTCGTGAA TTTGCACCTTCTAACAATTGTAC 402 yqiL yql-up yql-dn CAGCATACAGGACACCTATTGGC CGTTGAGGAATCGATACTGGAAC 516

arcC: Carbamato quinase; aroE: Shiquimato desidrogenase; glpF: Glicerol quinase; gmk:

Guanilato quinase; pta: Fosfato acetil tansferase; tpi: Triosefosfato isomerase; yqiL: Acetil coenzima A acetiltransferase.

3.8. Análise estatística dos dados

A partir das respostas obtidas nos questionários, foram analisadas as características associadas à colonização por S. aureus e MRSA de cães e seus contatos humanos. Foram utilizados o teste do X2 ou teste exato de Fisher bicaudal para variáveis categóricas. Estas análises foram empregadas utilizando o programa EpiInfo versão 3.3.2. (CDC, Atlanta, GE, www.cdcgov/epiinfo/about.htm) e foram consideradas significativas diferenças com valor de p < 0,05.

(35)

4. RESULTADOS

4.1. Colonização nasal por S. aureus, MRSA e MRS

Amostras de S. aureus foram isoladas das fossas nasais de 16 (5,5%) dos 290 cães investigados (5,5%), sendo amostras de 3 cães (1,0%) isoladas do meio de cultura contendo oxacilina. Já entre os 299 contatos humanos, amostras de S. aureus foram detectadas em 55 indivíduos (18,4%), sendo 53 proprietários, um tosador e um veterinário. Todas as amostras de origem humana foram isoladas apenas do meio de cultura sem antibiótico.

Em relação à colonização por MRSA, confirmados pela presença do gene mecA, quatro cães (1,4%) e quatro contatos humanos (1,3%) estavam colonizados por esta cepa. Todos os contatos humanos eram proprietários, mas nenhum dos cães estava também colonizado por MRSA.

Amostras de outras espécies de Staphylococcus foram isoladas de 29 cães (10%) do meio de cultura contendo oxacilina. As espécies mais prevalentes foram as do SIG (nove cães, 3,1%) e Staphylococcus sciuri (nove cães, 3,1%), sendo isoladas ainda outras sete espécies. O MALDI-TOF não é capaz de diferenciar com eficácia entre as espécies do SIG, indicando na maioria das vezes duas espécies diferentes deste grupo para a mesma amostra bacteriana (Decristophoris et al., 2011). O teste da coagulase foi utilizado para confirmar as identificadas como SIG como coagulase positivos. Deste modo, todas as amostras identificadas como membros do SIG pelo MALDI-TOF foram coagulase positivas. Embora tenha havido crescimento de outras espécies de Staphylococcus no meio contendo oxacilina de 29 cães, um número menor foi confirmado como sendo colonizado por MRS com a análise fenotípica e genotípica de resistência. Portanto, foram isoladas 20 amostras de MRS, de seis espécies diferentes, originadas de 18 cães (6,2%) (Tabela 3).

(36)

Tabela 3 – Distribuição de espécies de MRS isoladas de cães residentes em municípios do Rio de Janeiro no período entre 2015 e 2017.

Espécie Número de cães colonizados (%)

Potenciais MRSb MRSc SIGa 9 (3,1) 7 (2,4) S. sciuri 9 (3,1) 3 (1,0) S. schleiferi 5 (1,7) 1 (0,3) S. haemolyticus 5 (1,7) 5 (1,7) S. saprophyticus 4 (1,4) 3 (1,0) S. simulans 2 (0,7) 1 (0,3) S. epidermidis 1 (0,3) 0 (0,0) S. hominis 1 (0,3) 0 (0,0) S. xylosus 1 (0,3) 0 (0,0)

aSIG: Staphylococcus intermedius group: S. pseudintermedius, S. intermedius e S. delphini; bCrescimento em meio de cultura contendo oxacilina (2g/mL); cApós análise fenotípica e

genotípica para detecção de resistência à meticilina.

4.2. Determinação do perfil de resistência aos antimicrobianos

Todas 52 colônias isoladas de S. aureus de cães e 227 de seus contatos humanos, identificadas pelo MALDI-TOF, foram analisadas pelo método de disco-difusão. Colônias do mesmo indivíduo que apresentassem o mesmo perfil de resistência foram consideradas como sendo a mesma amostra, caso apresentassem perfis diferentes, foram consideradas como amostras diferentes. Deste modo, dois cães e quatro contatos humanos estavam colonizados por amostras de S. aureus com diferentes perfis de resistência. Portanto, foram consideradas 18 amostras de S. aureus de cães e 59 amostras de seus contatos humanos.

Em relação as amostras de S. aureus obtidas de cães, 15 (83,3%) eram resistentes a pelo menos um antimicrobiano, sendo a penicilina G sempre um deles. Logo, resistência a este antimicrobiano foi prevalente entre as amostras de S. aureus obtidas de cães dentre aqueles investigados. Resistência à eritromicina foi a segunda mais frequente, observada em 12 amostras (66,7%), seguida pela resistência induzida à clindamicina, presente em sete amostras (38,9%) (Figura 2). Três amostras (16,7%) não apresentaram resistência a nenhum dos antimicrobianos testados (Figura 3). Além disso, sete amostras (38,9%) apresentaram resistência a mais de três

(37)

antimicrobianos. Não foi observada resistência à rifampicina e ao sulfametoxazol+trimetropina (Figura 2).

Já em relação as amostras de S. aureus isoladas de contatos humanos, 54 (91,5%) apresentavam resistência a ao menos um antimicrobiano. A resistência à penicilina G foi encontrada em 50 amostras (84,7%), sendo este o antimicrobiano para o qual houve maior número de amostras resistentes. A resistência à eritromicina foi a segunda mais prevalente, assim como entre as amostras de cães, sendo encontrada em 31 amostras (52,5%), seguida pela resistência induzida à clindamicina, presente em 28 amostras (47,5%) (Figura 2). Além disso, 11 amostras (18,6%) apresentaram resistência a mais de três antimicrobianos. Não foi observada resistência para rifampicina, cloranfenicol e sulfametoxazol+trimetropina (Figura 2). Cinco amostras (8,5%) foram sensíveis a todos os antimicrobianos testados (Figura 3).

Figura 2 – Percentual de amostras de S. aureus resistentes aos antimicrobianos investigados, pelo método de disco-difusão, isoladas de cães e seus contatos humanos em municípios do Rio de Janeiro no período entre 2015 e 2017.

0% 10% 20% 30% 40% 50% 60% 70% 80% 90%

Referências

Documentos relacionados

For the first restriction we settled with using layers with no padding for all models intended to screen the image. For the second, we can apply the filter without and with the

Exercendo essa função, notei que apesar do acompanhamento, do monitoramento e da implementação do planejamento estratégico proposto pela Secretaria de Educação do

Ressalta-se que mesmo que haja uma padronização (determinada por lei) e unidades com estrutura física ideal (física, material e humana), com base nos resultados da

Rhizopus-associated soft ti ssue infecti on in an immunocompetent air-conditi oning technician aft er a road traffi c accident: a case report and review of the literature.

Data will be extracted from all papers included in the scoping review by two independent reviewers using a data extraction tool developed by the reviewers in Microsoft Excel

Neste artigo busco pensar Américo de Castro como empresário concessionário de companhias ferro carril e em outras atividades relacionadas à construção civil e que de- pendiam

No universo infantil, os conhecimentos prévios podem ser considerados como o resultado das concepções de mundo das crianças, estruturado a partir das interações sensoriais, afetivas e