UNIVERSIDADE ESTADUAL DE CAMPINAS FACULDADE DE CIÊNCIAS MÉDICAS
OLADELE SIMEON OLATUNYA
ASSOCIATION BETWEEN HEMOLYSIS INTENSITY, GENETIC MARKERS AND CLINICAL EVOLUTION IN PATIENTS WITH SICKLE CELL DISEASE
ASSOCIAÇÃO ENTRE A INTENSIDADE DA HEMÓLISE, MARCADORES GENETICOS E EVOLUÇÃO CLÍNICA EM PACIENTES COM DOENÇA FALCIFORME CAMPINAS 2018
ASSOCIATION BETWEEN HEMOLYSIS INTENSITY, GENETIC MARKERS AND CLINICAL EVOLUTION IN PATIENTS WITH SICKLE CELL DISEASE
ASSOCIAÇÃO ENTRE A INTENSIDADE DA HEMÓLISE, MARCADORES GENETICOS E EVOLUÇÃO CLÍNICA EM PACIENTES COM DOENÇA FALCIFORME
Thesis presented to the Faculty of Medical sciences of the University of Campinas in part-fulfilment of the requirement for the award of doctor in medical sciences, with area of concentration in clinical pathology.
Tese apresentada à Faculdade de Ciências Médicas da Universidade Estadual de Campinas como parte dos
requisitos exigidos para a obtenção do título de doutor em Ciências Médicas, área de concentração em Patologia Clínica.
ORIENTADOR: PROF. DR. FERNANDO FERREIRA COSTA ESTE EXEMPLAR CORRESPONDE À VERSÃO
FINAL DA TESE DEFENDIDA PELO
ALUNO OLADELE SIMEON OLATUNYA, E ORIENTADO PELO PROF. DR. FERNANDO FERREIRA COSTA
CAMPINAS
BANCA EXAMINADORA DA DEFESA DE DOUTORADO
OLADELE SIMEON OLATUNYA
ORIENTADOR: PROF. DR. FERNANDO FERREIRA COSTA
MEMBROS:
1. PROF. DR. FERNANDO FERREIRA COSTA
2. PROFA. DRA. MARIA STELLA FIGUEIREDO
3. PROFA. DRA. SANDRA FATIMA MENOSI GUALANDRO
4. PROF. DR. ANDRE FATTORI
5. PROFA. DRA. MARINA PEREIRA COLELLA
Programa de Pós-Graduação em [PROGRAMA] da Faculdade de Ciências Médicas da Universidade Estadual de Campinas.
A ata de defesa com as respectivas assinaturas dos membros da banca examinadora encontra-se no processo de vida acadêmica do aluno.
who gave me the opportunity to start this research and to complete it, may His name be praised forever.
My profound gratitude goes to the Almighty God for His sustaining grace, protection, wisdom, good health and provision throughout the research work. My undiluted gratitude goes to my amiable supervisor, Professor Fernando Ferreira Costa, for his mentorship, guidance and supervision during the research work. Your simplicity and hardwork have impacted me greatly. I am indeed very grateful sir.
I appreciate Drs Dulcinéia Martins de Albuquerque, Carolina Lanaro, Carla Penteado, Ana Leda Longhini, Irene Santosand Flavia Leonardo Costa for their
inestimable supports during the research. God will continue to lift you up. My sincere appreciations also go to Ana Luisa de Lorenzo for providing me with very huge and inestimable administrative and secretariat supports. God bless you richly. To Daniela Pinheiro, and my students` colleagues who assisted me in times of need, i say a big thank you. My thanks to all the laboratory staffs at the Hemocentro (Unicamp), and a host of others who has contributed to the success of this work. I also wish to appreciate Prof (Mrs) Adeyinka Falusi, Mr Abayomi Odetunde, Mr Kayode Tolorunju Segun and Mrs Benson Tolulope for providing laboratory supports for some analysis in Nigeria. I also wish to greatly thank Drs Taiwo Adekunle, Faboya Ayodeji and Ajibola Ayo for their great contributions. God bless you all.
My special appreciation to the sickle cell support society of Nigeria (SCSSN) for nominating me for the programme that allowed me to undertake this study. I also wish to specially appreciate Professor Adekunle Adekile for his mentorships, encouragements and supports. God bless you sir. Also, my deep appreciations go to Professor Marilda of FLOCRUZ foundation Bahia for her supports. I wish to specially thank my teachers at the Ekiti State University for their inestimable roles at seeing me through this programme.
KS Oluwadiya, and OAO Oyelami for their timely supports, encouragements and strongly recommending me for this programme. God bless you richly sirs!
To my father, His Highness Ojo James Olatunya, the Obalese of Oye Ekiti, who has longed so much to see me complete this research and my wonderful ever supporting mother Chief Mrs Margaret Modupe Olatunya, i say thank you so much i`m eternally grateful to you both.
This section will not be complete if i fail to mention the supports of my friend, my companion and God given wife, Dr Mrs Mercy Ayomadewa Olatunya for her financial, moral, spiritual and academic supports. My love, you are wonderful! I pray that God will protect us and help us to reap the fruits of our labour (Amen). Also, i want to say a big thank you to our children Tijesunimi, Jesutimilehin, and Jesudarasimi who were always praying and longing for me to complete this research work. I pray that God will spare your lives and make you great in life in Jesus name. Amen.
Diversas hipóteses têm sido propostas para explicar a diversidade clínica da doença falciforme (DF). Estas incluem a classificação de um sub-fenótipo hemolítico e sugerem a potencial contribuição de marcadores genéticos. No entanto, estes não são explicam totalmente as expressões fenotípicas observadas nos pacientes com DF, assim, há a necessidade de buscar por mais marcadores candidatos para a DF. Este é um estudo de correlação fenotípica com alguns marcadores hemolíticos conhecidos e desconhecidos dentre os pacientes com DF. Este estudo avaliou a relação entre micropartículas eritrocitárias e outros marcadores tradicionais de hemólise com os fenótipos clínicos de 138 brasileiros com DF, após consentimento, sendo 78 HbSS (63 em uso de hidroxiureia, 15 sem o uso da medicação), 12 HbS-Beta0 talassemia, 12 HbS-Beta+ talassemia e 36 HbSC sem uso de hidroxiurea e em estado estacionário da doença. Ainda, 110 crianças nigerianas com DF, sendo 102 HbSS e 8 HbSC, foram avaliadas. Um total de 107 indivíduos, 39 do Brasil e 68 da Nigéria, fizeram parte do grupo controle. As micropartículas eritrocitárias foram quantificadas em plasma por citometria de fluxo, haptoglobina e hemopexina foram avaliadas por ELISA, e a hemoglobina plasmática e o heme foram mensurados por ensaio colorimétrico. PCR foi utilizada para confirmar o diagnóstico de DF. O perfil para alfa talassemia foi determinado por GAP-PCR multiplex, os genótipos para UGT1A1 foram analisados por meio dos fragmentos gerados, e os haplótipos βS e a deficiência de G6PD por meio de ensaio TaqMan. Os pacientes apresentaram níveis elevados de micropartículas, hemoglobina plasmática e heme livre na seguinte ordem: HbSS > HbSC > HbAA. Por outro lado, haptoglobina e hemopexina estiveram mais elevadas no grupo controle: HbSS<HbSC<HbAA. As micropartículas eritrocitárias mostraram correlações significantes com os marcadores tradicionais de hemólise. Não foram observadas diferenças significantes nos níveis de micropartículas,
ocorrência de úlcera de perna e o risco para hipertensão pulmonar determinado pela velocidade de regurgitação da tricúspide (TRV). Além disso, este estudo mostrou que a coexistência de alfa talassemia foi significantemente associada com melhores índices hematológicos, aumento de crises de dor óssea e proteção contra úlcera de perna. O polimorfismo UGT1A1 foi significantemente associado com níveis mais altos de bilirrubina e ocorrência de cálculo biliar dentre os pacientes nigerianos. Da deficiência de G6PD nao foi associada com os eventos clinicos. Os SNPs do gene BCL11A influenciaram significantemente os níveis de hemoglobina fetal desses pacientes e seus haplótipos βS foram principalmente a homozigose do tipo Benin/Benin. Em conclusão, este estudo mostrou que a alfa talassemia, e o polimorfismo UGT1A1 afetam os eventos clínicos das crianças nigerianas com DF. Além disso, estabeleceu que as micropartículas eritrocitárias são associadas com a hemólise e os eventos clínicos em brasileiros com DF. Ambos RMP e heme foram associados com úlcera de perna e TRV (risco para hipertensão pulmonar) elevado. Ainda, o heme esteve associado com microalbuminúria. Essas observações sugerem que as micropartículas e o heme podem desempenhar importantes papeis na fisiopatologia e nas manifestações clínicas da DF. Assim, RMP e heme como alvo de terapias podem ser uma nova estratégia para tratar a DF.
Palavras chaves: doença falciforme, manifestações clínicas, hemólise, micropartículas
Several hypotheses have been proposed for the clinical diversity in SCD. These include the classification of a sub-hemolytic phenotype and hints on the potential contributions of genetic markers. However, these do not fully explain the phenotypic expressions observed in SCD patients. Hence, the need to search for more candidate markers of SCD. This is a study on phenotype correlation with some known genetic and newer candidate hemolysis markers among SCD patients. This study evaluated the relationship between red blood cell microparticles and other traditional markers of hemolysis in relation to clinical phenotypes of 138 consenting adult Brazilians with SCD made up of 78 HbSS (63-hydroxyurea treated &15-hydroxyurea naïve), 12 S-Beta0 thalassemia, 12 S-Beta+ thalassemia and 36 HbSC hydroxyurea naive patients in steady state. Also, 110 Nigerian children with SCD made up of 102 SS and 8 HbSC were studied. A total of 107 individuals, 39 from Brazil and 68 from Nigeria, served as controls. The plasma red blood cell microparticles were quantified by flow cytometer, haptoglobin and hemopexin by ELISA, plasma hemoglobin and heme were measured by colorimetric assays. PCR was used to confirm the diagnosis of SCD. Alpha thalassemia status was determined by multiplex GAP-PCR, UGT1A1 genotypes by Fragment analysis, βS haplotype and G6PD by TaqMan SNP genotyping assays. The patients had significant higher levels of red blood microparticles, plasma hemoglobin, heme in the following order HbSS > HbSC > HbAA. On the contrary, both haptoglobin and hemopexin were higher in controls than the patients in the following reverse order HbSS<HbSC<HbAA.
Red blood cell microparticles showed significant correlations with traditional markers of hemolysis. There were no significant differences in the red blood cell microparticles, heme and plasma hemoglobin levels of hydroxyurea treated SS patients compared to untreated patients. Both red blood cell microparticles and heme were associated with leg
significantly associated with better hematologic indices, increased bone pain crisis and protection against leg ulcer. The UGT1A1 polymorphism was significantly associated with higher bilirubin levels and occurrence of gallstone among the Nigerian patients. Similarly, G6PD deficiency was not associated with clinical events. The SNPs of the BCL11A significantly influenced the fetal hemoglobin levels of the Nigerian patients and their βS haplotypes were mainly of the homozygous Benin/Benin type. In conclusion, this study established that alpha thalassemia, and UGT1A1 polymorphisms affect the clinical events among Nigerian SCD children. It also established that the red blood cell microparticles are associated with hemolysis and clinical events among Brazilian SCD patients. Both RMP and heme were associated with leg ulceration and elevated TRV (risk for pulmonary hypertension). Also, heme was associated with microabuminuria. These observations suggest that red blood cell microparticle and heme may have important roles in the pathophysiology and clinical manifestations of SCD. Hence, therapies targeting RMP and heme could be another strategy to combat SCD.
Keywords: Sickle cell disease, Clinical manifestations, Hemolysis, Red blood cells
SCD – Sickle cell disease SCA – Sickle cell anaemia RBC – Red blood cells WBC – White blood cells
RMP – Red blood cell microparticles TRV – Trancuspid regurgitation velocity UACR – Urinary albumin creatinine ratio VOC – Vaso occlusive crisis
ACS – Acute chest syndrome NO – Nitric oxide
TLR4 – Toll-like receptor 4
DAMPs – Damage associated molecular pattern molecules LDH – Lactate dehydrogenase
MCV – Mean corpuscular volume HU – Hydroxyurea
HbF – Fetal haemoglobin
SNP – Single nucleotide polymorphism Hp - Haptoglobin
HPX – Hemopexin
Plasma Hb- Plasma Hemoglobin
G6PD – Glucose 6 phosphate dehydrogenase
Table 2: Effects of hydroxyurea treatment on biologic markers of HbSS patients Table 3: Effects of hydroxyurea treatment on biologic markers of HbS-β thalassemia patients
Table 4: Associations between acute chest syndrome and biologic markers
Table 5: Associations between acute bone pain crisis (VOC) and biologic markers Table 6: Associations between leg ulcer and biologic markers
Table 7: Associations between elevated tricuspid regurgitation velocity/risk for pulmonary hypertension and biologic markers
Table 8: Associations between stroke and biologic markers
Table 9: Associations between sickle cell retinopathy and biologic markers Table 10: Associations between osteonecrosis and biologic markers
Table 11: Associations between priapism and biologic markers
Table 12: Associations between microalbuminuria and biologic markers
Table 13: Distribution of βs-haplotypes and G6PD deficiency among Nigerian cohorts Table 14 : Associations between G6PD deficiency and biologic markers of Nigerian SS cohorts
Table 15: Co-inheritance of sickle cell anemia with G6PD deficiency and clinical events Table 16: Allele and genotype frequencies of UGT1A1 promoter polymorphism among participants
Table 17: Comparison of laboratory markers between patients and controls UGT1A1 study cohort
Table 18: Influence of UGT1A1 genotype on laboratory parameters of SS cohort Table 19: Influence of UGT1A1 genotype on clinical events of SS patients Table 20: Comparison of parameters in patients with and without gallstones Table 21: Biodata and frequencies of alpha thalassemia alleles
Table 22: Laboratory parameters of patients and controls of the thalassemia study cohort Table 23: Alpha thalassemia Alleles and laboratory parameters
Table 24: Co-inheritance of sickle cell anemia with Alpha Thalassemia and clinical events Table 25: Comparison of parameters in patients with or without leg ulcer in the absence of Alpha thalassemia
Table 27: Influence of Haptoglobin genotype on clinical events of SS cohorts Table28: Table of BCL11A SNPs examined
Table 29: Descriptive statistics and comparisons of BCL11A SNPs between the patients and controls
Table 30: Measures of fetal hemoglobin by allele combination and comparison in Patients group
Table 31: Measures of fetal hemoglobin by allele combination and regression analysis. Table 32: Linkage disequilibrium between the SNPs pairs.
Figure 2: Sickle cell disease and hemolysis products Figure 3: Theβs-haplotypes
Figure 4: Comparison of red blood cell microparticles across groups Figure 5: Comparison of plasma hemoglobin across groups
Figure 6: Comparison of heme across groups Figure 7: Comparison of haptoglobin across groups Figure 8: Comparison of hemopexin across groups Figure 9: Comparison of LDH across groups
Figure 10: Comparison of total serum bilirubin across groups Figure 11: Comparison of unconjugated bilirubin across groups Figure 12: Comparison of reticulocyte count across groups Figure 13: Comparison of RBC concentration across groups
Figure 14: Comparison of haemoglobin concentration across groups Figure 15: Comparison of fetal hemoglobin across groups
Figure 16: Red blood cell correlation plots
Figure 17: Glucose 6 phosphate dehydrogenase agarose gel by restriction analysis Figure 18: UGT1A1 promoter genotypes found among Nigerian groups
Figure 19: Agarose gel analysis showing α 3.7 deletion by PCR.
Figure 20: Illustration of modeled Red blood cells microparticles in the lumen and endothelial regions of blood vessels
Figiure 21: Illustration of the predictive value of tricuspid regurgitant velocity on functional outcomes and mortality risk in sickle cell disease
Figure 22: Mechanisms of hemolytic anemia in reducing NO bioavailability and association with vasculopathic sub-phenotypes of sickle cell disease
TABLE OF CONTENTS
PAGE Introduction………...17 – 28 Justification………29 Objectives………..30 Patients and methods……….32 – 44 Results………45 – 101 Discussion………..102 – 118 Conclusions………119 – 120 References……….……….121 – 133 Appendices……… 134 – 201 Annexes………. 202 - 209
Sickle cell disease (SCD) is a common genetic disorder of man that is caused by a mutation in the β-globin gene1,2. SCD is a disorder of public health importance, especially in sub-Saharan Africa where the largest burden of the disease exists with about 6 million people affected.Nigeria is the country with the highest burden of the disease where approximately 2 to 3% of all newborns are born with the disorder3. Due to slave trade and people migration, the disease has spread from Africa to the other parts of the world. In Brazil, the prevalence of SCD varies between 0.8 and 60 per 100,000 live births in different regions of the country and most of those affected are Brazilians of African descent4,5.
Pathophysiologic basis of SCD
The proximate cause of SCD is a single gene mutation resulting in a single base change from adenine to thymine (GAG to GTG) in the codon for amino acid. This mutation results in the replacement of the hydrophilic glutamate by hydrophobic valine at the sixth amino acid residue of the β-globin polypeptide chain and HbS (Hemoglobin S) β-globin chain substitute for normal HbA β-globin chain. The HbS can undergo reversible polymerization when deoxygenated. However, following repeated sickling and un-sickling cycles, the HbS becomes irreversibly polymerized and injures the RBC (Red blood cell) by causing irreversible damage to the RBC membrane. The damaged RBCs have a shortened life span and are removed thus forming the basis for chronic anemia in SCD. The intravascular component of hemolysis depletes nitric oxide thereby causing disruption in its balance and this leads to some vascular complications. In addition, other complex interactions with endothelial cells and some molecules lead to cellular injuries, inflammation, and other cascades of downstream events.and injuries seen in SCD1,2. Some aspects of the pathophysiology and complicating events are summarized in Figure 1 below.
Figure 1: The Glu6Val mutation leads to HbS formation which polymerises at low O2 tension causing damage to RBC membrane, ↓RBC life span, Hemolysis, NO depletion, and vasoocclusion. Steinberg MH, 2008. The Scientific World Journal2
Studies have shown that SCD is clinically pleiotropic both within an individual and among groups of patients. The clinical spectrum ranges from asymptomatic or mild course to persistent, severe or life-threatening situations often requiring frequent hospital visits and admissions1,2. These inter- and intra-patient variability and unpredictable phenotypic expression pose significant management challenges to physicians and caregivers1,4.
Several hypotheses have been proposed for the phenotypic diversity in SCD with environmental influences as well as sociodemographic characteristics playing major roles in tropical Africa2,3,6. Others have attributed the clinical variability to the roles of some genetic modifiers such as the presence of α-thalassemia, and Glucose 6 phosphatase dehydrogenase deficiency (G6PD). Also, fetal hemoglobin production which is thought to be influenced by β-globin gene haplotype and some other factors, has been implicated6,7,8. In addition, other non-globin genetic factors like the uridine diphosphate glucuronosyl transferase 1A (UGT1A1) promoter polymorphism has also been found to
phenotypic diversity observed in SCD patients. Hence, researchers continue to search for more markers of the SCD clinical expression8,9. Studies on markers of hemolysis such as reticulocyte count, lactate dehydrogenase, aspartate transaminase, serum bilirubin, heme, haptoglobin, hemopexin, cell-free plasma haemoglobin and red blood cell micro particles, have shown some promise in elucidating the clinical course of SCD9-11. Hemolysis, though considered traditionally as the cause of anemia and gallstone formation in SCD, has now been shown to cause more than these complications in SCD. Some pathophysiological processes, such as, endothelial dysfunction, chronic inflammation and vascular injury have been linked to hemolysis via the release of cell free plasma haemoglobin, heme, and other toxic products during hemolysis. This leads to a cascade of downstream events and complications in SCD patients12-15.Due to the damages and injuries caused by these products of hemolysis, circulating cell free haemoglobin and heme are now being referred to as erythrocytic damage associated molecules (eDAMPS)12,15. This is further explained and simplified in figure 2 below. As shown, in the figure, although the human body has innate mechanisms to neutralise products of intravascular hemolysis, these endogenous mechanisms are often overwhelm in SCD patients thus leading to circulating eDAMPS12,15.
Figure 2: Hemolysis releases erythroid DAMP molecules to drive vascular injury and sterile inflammation, which contribute to the pathogenesis of sickle cell disease. Hemolysis releases cell free hemoglobin (Hb), which is normally scavenged by haptoglobin and CD163. Free hemoglobin reacts with and scavenges NO via the dioxygenation reaction and also reacts with hydrogen peroxide to generate hydroxyl radicals via the Fenton reaction. This process leads to endothelial dysfunction and
pathological vascular remodeling. Oxidized hemoglobin releases free heme, which can trigger a sterile inflammatory reaction involving TLR4 activation, and stimulates neutrophils to release NETs. These inflammatory events are proposed to cause vasoocclusion and acute chest syndrome in sickle cell disease. There are several potential therapies using the indicated agents (shown in red text) that target multiple stages of this proposed pathophysiological pathway. RBC=red blood cell (Gladwin MT et al12).
Furthermore, although the impacts of genetic modifiers of SCD are relatively known in the developed world, there is paucity of information on this from Africa. Moreover, because of genetic variability in different populations, it is pertinent that more studies are carried out among cohorts from different ethnic backgrounds to fully understand the impact of genetic modifiers on SCD.
These observations underscore the inherent potentials of hemolysis and genetic markers contributions to the clinical course of SCD and fuells the need for search for more markers of SCD expression that could help to fully understand the disease. Therefore, putting more focus on some hypothesised markers may help in elucidating more facts on predictors of SCD phenotypes.
1.2. REVIEW OF SOME HYPOTHESISED SCD PHENOTYPE MARKERS OF INTEREST
HEMOLYSIS MARKERS
1.2.1 Haptoglobin: This is a protein produced mainly by the liver and regarded
as an acute phase protein because it is elevated in inflammatory conditions. It is an α-sialoglycoprotein found in mammals but in humans it exhibits polymorphism through two dominant alleles (Hp1 and Hp2) located on the long arm of chromosome 16q22 and 3 phenotypes have been recognised (HP1-1, HP2-2, & HP2-1)16,17. The HP1-1 allele is found commonly among Africans and South Americans. It is least prevalent in South east Asia and it is the most biologically active of the three haplotypes with regards to binding free plasma Hb (plasma hemoglobin) and suppressing inflammation16. The HP2-2 variant has the least biological activities with respect to binding free plasma HB and suppressing inflammation16,17. The HP2-1 variant has intermediate biological and anti-inflammatory abilities compared to the first two variants. Although haptoglobin has antioxidant and antibacterial properties, their most striking roles are generally in modulating acute phase
bind free hemoglobin in the blood stream to form an hemoglobin-haptoglobin (Hb-HP) complex which is quickly recognised by the scavenger receptor CD163 located on the surfaces of circulating monocytes and liver macrophages16,17. Haptoglobin disappears faster than being created when large amounts of RBC are destroyed in the intravascular compartment due to excess amount of free Hb released into the blood stream. This leads to reduction in the blood level of haptoglobin. As a result of this, haptoglobin has high sensitivity and specificity in the diagnosis of hemolytic anemia16,17. Hence, in conjunction with other markers of hemolysis, and in the absence of other factors like liver disease, infections, drugs and other inflammatory diseases that may cause alterations in haptoglobin, blood levels of haptoglobin could be used to ascertain the degree of hemolysis in chronic hemolytic anemia condition like SCD16,17. Although previous studies showed the predominance of Hp 1-1 and Hp 2-1 haplotypes among Brazilian and Nigerian SCD patients respectively,16,18 till date, the influence of Hp polymorphism on the phenotypic expressions of the SCD patients in the two countries has not yet been studied. A study of Haptoglobin genotypes’ behaviour among SCD patients will help to further understand how this parameter influences the clinical outcome of SCD bearing in mind that haptoglobin is now being used for acute severe haemolytic conditions in some parts of the world19. This will help to answer the question as to whether the proposition for its use as an adjunct therapy in the treatment of SCD is justifiable20.
1.2.2 Hemopexin (HPX): Hemopexin is a heme-binding plasma glycoprotein
which is the second line of defense against hemolysis mediated oxidative damage by mopping up the liberated free plasma heme. It is produced primarily in the liver but in addition, other parenchymal cells produce it. The heme-hemopexin complex that is formed is subsequently delivered to the liver cells through receptor- mediated endocytosis after which the heme is taken off and the HPX is recycled. Decreased plasma level of HPX indicates higher degree of hemolysis from RBC destruction reflective of increased hemolysis severity in patients with associated heme toxicities and/or SCD19,21,22,23. To this end, researchers are currently exploring therapeutic roles for hemopexin infusion in SCD19,21,22. Hence, further studies are needed to throw more light on the influence of hemopexin on the clinical expression of SCD in order to justify or dispel the need to incorporate hemopexin therapy into the care of SCD patients.
1.2.3 Lactate dehydrogenase (LDH): Lactate dehydrogenase is an intracellular
enzyme that abounds in many cells and tissues of human body where it plays crucial roles in generating energy for the cells through two key processes (glycolysis and gluconeogenesis)24. Different isoenzymes of it have been recognised based on their cells or tissues of origin. LD1 and LD2 are primarily derived from the red blood cells, heart and the kidney while LD3 is mainly from lymphoid cells and platelet. LD4 and LD5 are primarily from the liver and skeletal muscles. The concept about the mechanisms of LDH as marker of SCD severity is still debatable. While some authors have argued that the elevated levels of LDH in SCD is due to hemolysis24,25, others have linked the elevation to tissue destruction26. However, more studies are in agreement with the hemolysis theory as the primary source of the LD1 and LD2 isoenzymes in patients with SCD as they strongly correlate with known markers of hemolysis in these patients24,25,27. As a result of this, LDH serum levels especially the LD1 & LD2 isoenzymes, are now been considered useful markers of intravascular hemolysis and disease severity in patients with SCD24,25,27. It is now being considered as parts of routine tests for SCD in most developed parts of the world as markers of SCD severity based on new findings that it also correlates well with other complications of SCD9,24,25,27. Kato et al24, found high correlation of elevated LDH with ntiric oxide insufficiency, increased rates of leg ulcers, pulmonary hypertension, priapisms and deaths among SCD patients in the USA. Similarly, Mikobi et al28 found increased disease severity among SCD patients with elevated LDH in Congo. But of more interest is the suggestion by Mecabo et al27, that LDH levels in SCD could be used to monitor response to hydroxyurea following their study of LDH behaviour among the Brazilian cohorts of SCD patients. However, due to lack of resources and tools, testing for LDH is seldomly performed in most developing countries of Africa including Nigeria28,29. This is a paradox given the huge burden of SCD in these parts of the world. Drawing from these, the yield of information that could be obtained from such studies is therefore huge. Hence, further correlational studies on LDH could unravel more potentials for this marker in the various aspects of care for the SCD patients and help to further clarify its roles in SCD expression.
1.2.4 Red blood cell derived microparticles (RMP): These are small
biologically active plasma membrane vesicles released by red blood cells into the blood stream either as a result of their aging and self preservation processes or as a result of cellular injuries and destruction of the red blood cell30,31. They are generally less than
exert sundry roles which include: immune modulation, transfer of messages between cells, activation of coagulation cascade and endothelial injury30,31. In SCD, levels of RMP have been shown to be elevated both in steady state and in vaso-occlusive crisis31,32. In addition, they concentrate plasma heme and transfer it to vascular endothelium where it mediate oxidative stress, vascular dysfunction and vaso-occlussions in SCD31,32,33. Also, the degree of RMP elevation has also been speculated to be closely related to known markers of SCD complications/severity like nitric oxide (NO) depletion, generation of thrombin, rise of plasma free plasma Hb, and increased rate of intravascular hemolysis30,31,32,33. These deleterious synergies between the RMP and known markers of SCD disease severity raises a possibility of using the RMP levels of SCD patients to categorise them into clinical sub-phenotype groups and possibly prognosticate the disease outcome. Most current studies on RMP in SCD were conducted on patients in the developed parts of the world. A further study of RMP in SCD patients will help to explore more on the roles of this biomarker in the clinical expressions of SCD patients.
1.2.5 Free plasma haemoglobin: Although majority (≥70%) of total hemolysis
in SCD occurs in the extravascular space (monocytic-phargocytic systems in spleen and liver), while approximately ≤30% takes place within the intravascular compartment. In SCD patients, polymerization of HbS leads to the destabilisation of the RBC membrane and excessive premature destruction of the erythrocytes. The rate of destruction can be up to 10% of their total erythrocytes in every 24 hours19,23,34. This process can lead to the release of as much as 30g of free (decompartmentalised or plasma hemoglobin) per day and this amount is enough to saturate the endogenous scavenging mechanisms comprising the plasma haptoglobin and CD163 scavenging receptor. Hence, may result in substantial amount of free circulating plasma Hb19,23. Free plasma Hb has been found to significantly scavenge the nitric oxide (NO) levels because of its high affinity for NO. An experimental study has observed rapid depletion of NO levels in SCD patients by up to 1000 fold by free plasma Hb and noted that the release of plasma free haemoglobin and its role in depleting the NO levels may be the main reason for the vascular complications seen in SCD34. In addition, there is a catastrophic synergy in NO depletion between free plasma Hb and arginase enzyme released by destroyed RBC during hemolysis in SCD patients35,36. Nitric oxide is required for the maintenance of vascular integrity and relaxation to prevent vascular events in SCD patients24,34,35,36. These roles have been
found to be totally abrogated when the plasma free haemoglobin level rises up to 6µM leading to serious vascular complications like systemic and pulmonary hypertensions24,34. In view of this, some authorities have hinted on the possible need to administer Haptoglobin (the scavenger of free plasma Hb) to SCD patients in order to ameliorate the disease complications19,20,23.Therefore, there is need for more studies on the free plasma Hb of SCD patients in order to unravel more of its roles in the pathophysiology of SCD as this could help to further strengthen or dispel its roles in the sequaelae of SCD.
1.2.6 Heme: Heme is synthesised in all human cells including the RBC. This
process involves eight enzymatic reactions that take place either within the cells’ mitochondria or their cytosols37. Upon formation, the heme is maintained in constant equilibrium within the RBC through three regulatory mechanisms. These include diffusion though the cell membrane, binding to the RBC cell membrane or cytoskeleton and intracellular degradation by glutathione38. The first two mechanisms are concentration dependent while the third mechanism requires the presence of adequate glutathione at a concentration not ˂ 2mM within the RBC otherwise, excess heme could accumulate and or escape to injure the RBC or other cells38. However, as the RBCs become senescent they become denatured and some of them undergo autoxidation to methemoglobin leading to the release of free heme into the plasma. In SCD patients, it has been shown that sickled HbS has an exaggerated rate of autoxidation compared to normal HbA leading to excess free heme in these patients38. In addition, the high rate of destruction of sickled RBC also contributes to excessive amount of free heme in them38. Free heme has been implicated in the pathophysiology and clinical expression of SCD through two key methods. Firstly, it is implicated as a co-factor in the promotion of HbS polymerization (the primary event in the pathophysiology of SCD) causing cascades of pathological processes. Secondly, it has also been implicated in damaging the RBC membrane thereby contributing to the increased rate of endothelium adhesion, hemolysis, RBC removal by monocytic-phargocytic system and these lead to shorter life span of RBC in SCD patients38. Recently, some researchers found that administration of hemopexin (a known heme scavenger), prevents these unwanted events in animal models22. This observation has led to others proposing the possibility of administering hemopexin to SCD patients in order to ameliorate their disease19. It is therefore pertinent that, more studies be conducted on SCD patients to further highlight the roles of plasma free heme as a marker of disease severity in SCD. The major complications attributed to heme and plasma hemoglobin in the SCD hemolysis phenotypes appear to be mediated
promotion, oxidative injuries, and networking to signal the activation of other mediatory molecules like the toll like receptors39-42. Given the impacts of these effects on SCD patients, researchers are now suggesting that using the scavengers of heme and plasma hemoglobin on patients with SCD could ameliorate their disease20,42. This raise the need for more studies to further explore the relationships between these markers as well their contributions to the clinical manifestations of SCD.
GENETIC MARKERS
1.2.7 Thalassemia syndromes: The thalassaemia syndromes are a group of
inherited disorders in which there is absence or reduced rate of synthesis of one of the globin chains: either the alpha or the beta-globin chains of hemoglobin A (α2β2), which is the major human adult haemoglobin approximately 97%. The other minor adult haemoglobins are haemoglobin A2 (α2δ2) comprising 2.5% and fetal haemoglobin (α2γ2) comprising less than 1% of the total hemoglobins. The involvement of either globin chain causes imbalanced globin chain production, ineffective erythropoesis, microcytosis, hemolysis and various degrees of anaemia43,44. The alpha (α) thalassaemia is usually due to gene deletion, and is caused by loss of one (αα/-α) or two (-α/-α) of the normal complement of four alpha genes (αα/αα) leading to a decrease in or absence of α chains. Alpha thalassaemia is common in Africa where it is believed to offer some protection against malaria in addition to ameliorating some clinical features of SCD patients43. The beta (β) thalassaemia is usually due to a point mutation, may be beta (βo) or beta (β+). A βo thalassaemia is one in which there is no β gene expression and, therefore, no β chain synthesis and consequently no haemoglobin A (HbA) production. A β+ thalassaemia is one in which the β gene is expressed but at a reduced rate so that there is some β chain synthesis and some production of HbA. Beta thalassaemia trait has been found among 2.1% of Nigerian SCD patients44. Beta thalassaemia has been classified into three main clinical subtypes based on the severity of the clinical manifestations and these include: (a) Beta thalassaemia major otherwise known as Cooley’s anaemia in which case patients have severe symptoms and blood transfusion dependent. (b) Beta thalassaemia trait this is direct opposite of Cooley’s anaemia here patient is usually not symptomatic and the diagnosis is usually made by chance when patients manifest very mild symptoms upon the exposure of the patients to extreme stress. (c) Beta thalassaemia intermedia represents
the group of patients between the first two groups. They have mild to moderate intermediate symptoms and are not blood transfusion dependent. The combination of sickle cell mutation and beta-thalassaemia mutation gives rise to varying heterogenous groups known as Hb S/β thalassaemia (Hb S/β-Thal). Patients with Hb S/β-Thal exhibit heterogeneity in their clinical manifestations ranging from nearly asymptomatic state to severe symptoms depending on the types of mutations involved and the amount β globin synthesis which is reflected by the amount of HbA produced45. Currently, there is no consensus about the classification of Hb S/β-Thal. However, two types namely: (Hb S/βo -Thal and Hb S/β+-Thal) have been recognised generally45. The Hb S/βo-Thal has no production of HbA and its clinically indistinguishable from sickle cell anaemia. Therefore, it tend to exhibit a more severe course compared to the Hb S/β+-Thal in which there is production of variable amounts of HbA which dilute the polymerisation of HbS thus resulting in milder phenotypic expression. It is however important to note that the influence of other genetic modifiers of SCD also affect this phenotypic expression45. To this end, while increased hypercoagulability have been associated with coinheritance of thalassaemia with SCD46, others have found very mild SCD phenotypic expressions with Hb S/β+-Thal47 and alpha thalassaemia43 respectively. These observations suggest that the exact pathophysiologic mechanisms and or influence of the thalassaemias on the phenotypic expression of SCD are not yet fully elucidated hence, the need for more studies.
1.2.8 Fetal hemoglobin (HbF) AND BCL11A ,HBS1L-MYB polymorphisms:
HbF has emerged as a central modifier of the several phenotypes like anemia, stroke, infections and others seen in SCD patients48,49,50. The presence of HbF limits the rate of polymerisation of HbS which is the primary event that leads to the cascades of both pathological and clinical manifestations in SCD48,49,50. Luckily, the expression of HbF is amenable to therapeutic manipulation. To this end, clinicians have used hydroxyurea to increase the proportion of HbF in SCD patients with the aim of making the patients benefit from its ameliorative effects on their disease phenotypes51,52. Interestingly, genetic variations at three principal loci (BCL11A, HBS1L-MYB and HBB) each on chromosomes 2, 6 and 11 respectively, have been shown to account for increased expression of 10-20% HbF variation among SCD patients in the USA, Brazilian and United Kingdom50. Of these, only the BCL11A locus has been studied among the African SCD patients. Initial studies in Tanzania 53 and Cameroon 54,55 have shown that single-nucleotide
countries with significant association of these SNPs with HbF. Researchers have hinted on the high degree of variations in the micro allele frequency (MAF) of SNPs of other genetic variants among the African SCD patients thus making extrapolation of findings from one African country to another difficult50. These findings suggest that studies of multiple SCD populations are needed especially from Africa, to further improve the understanding of the impact of human diversity on HbF expression in SCD.
1.2.9 Glucose 6 phosphate dehydrogenase (G6PD): G6PD is a cytosolic
enzyme in the pentose phosphate pathway which supplies reducing energy to cells by maintaining the level of the co-enzyme nicotinamide adenine dinucleotide phosphate (NADPH). G6PDH reduces nicotinamide adenine dinucleotide phosphate (NADP) to NADPH while oxidizing glucose-6-phosphate (G6PD)56. Humans with a genetic deficiency of G6PD are predisposed to non-immune hemolytic anaemia and this deficiency is highly prevalent in sub-Saharan Africa where it is believed that both HbS and G6PD deficiency confer partial protection against malaria hence, its predominance in Africa where malaria is endemic57,58. The prevalence of G6PD among the Nigerian population is between 15-25%59 while that among the Brazilian population varies between 1-13% depending on the region of the country.56 The most prevalent variant in the two countries is the G6PD A-variant56,59. There have been conflicting reports about the genetic polymorphisms of G6PD A-variants in Africa 60,61,62. De-Araujo et al60 and Capelini et al61 found a predominance of G6PD genotypes with G6PD 202A and G6PD 376G alleles in Senegal and other parts of Africa similar to the genotypes in Brazil56. However, Clark et al62 found a predominant of G6PD968C and G6PD376G allelesamong the Gambian population also from the West Africa sub-region like Senegal. This suggests heterogeneity in the patterns of G6PD A-variants among the African population and this factor could affect the clinical events in patients with G6PD deficiency. Till date, only few studies investigated the potential effects of G6PD deficiency on SCD and the studies have shown conflicting reports. While studies from Saudi Arabia and Burkina Faso, found no effect of G6PD deficiency on the clinical manifestations and laboratory parameters of SCD patients63,64, studies from the USA and France found association with increased cerebral blood flow velocity, increased rate of acute anaemic events, blood transfusions, vaso-occlussive crisis, and decreased steady state haemoglobin levels58,65,66. The mixed reports from these studies concerning the effects of G6PD deficiency co-inheritance on
the clinical events or laboratory parameters of the SCD raise the need for further studies to dispel or establish if the co-inheritance impact any influence on SCD manifestations.
1.2.10 Uridine diphosphate glucuronyltransferase 1A (UGT1A) Polymorphism: Patients with Gilbert's syndrome (GS) have a defect in the uridine
diphosphate glucoronosyl transferase 1A gene that encodes for uridine diphosphate glucuronyltransferase 1A (UGT1A) enzyme which is the main enzyme responsible for bilirubin conjugation among the uridine diphosphate glucuronosyl transferase (UGT) family67,68. Polymorphisms in the UGT1A gene results in a 60-70% reduction in the enzyme and by extension, the liver's ability to conjugate bilirubin leading to unconjugated hyperbilirubinemia.69 Bilirubin is an endogenous antioxidant and some authors have postulated that, Gilbert's syndrome may actually reduce the risk of various age-related diseases because of the antioxidant properties of bilirubin67,69. One recent study found that mortality rates observed for people with Gilbert's syndrome in the general population were shown to be almost half those of people without evidence of Gilbert's syndrome70 and the occurrence of GS had also been thought to give protection to Africans against malaria among other benefits71.Reports on co-inheritance of SCD with GS have shown increased rates of cholelithiasis, need for cholecystectomy and increased morbidity72,73,74. In addition, the response to hydroxyurea treatment was found to be blunted by the presence of GS in some SCD patients75. These further highlight the deleterious roles GS could play in modulating the SCD phenotypic expression. Studies on GS behaviour among Africans and Brazilians are scanty and no specific study has been found from Nigeria. However, a brief report by Fertrin et al76 found increased rate of hyperbilrubinemia and possible risk for early onset of symptomatic gallstone disease that may warrant cholecystectomy among Brazilian SCD patients. These observations raise the need for more studies to explore the roles of GS in the clinical expression of SCD patients.
Although several hypotheses have been proposed for the phenotypic diversity found in sickle cell disease, these factors do not fully explain the clinical heterogeneity observed in SCD patients. Therefore, efforts are on-going in search of new markers that can be used to better characterize sickle cell disease. The present study aims to establish a link between markers of hemolysis and some genetic modifiers, and clinical phenotypes of patients with sickle cell disease. These may be useful for predicting severity as well as influencing therapeutic decisions in SCD.
3. OBJECTIVES
3.1. General objective
To determine the influence of some hemolysis and genetic markers on the phenotypic expression of patients with sickle cell disease.
3.2 Specific objectives are to:
• Quantify red blood cell microparticles, plasma hemoglobin, heme, hemopexin, and haptoglobin in plasma samples from Brazillian adult patients with sickle cell disease treated with or without hydroxyurea, and control subjects
• To correlate the clinical, hematologic and biochemical results of patients with sickle cell disease with the above quantified markers.
• To evaluate the influence of hydroxyurea treatment on the levels of free plasma hemoglobin, heme, hemopexin, haptoglobin, and red blood cell microparticles of SCD patients.
• Identify and try to establish any association between the polymorphisms of G6PD, UGT1A1, BCL11A, haptoglobin genes and alpha thalassemia trait with clinical events and laboratory markers of Nigerian children with SCD.
Some recent studies have shown that hemolysis and genetic markers play important roles in the progression of sickle cell disease. The aim of this study is to establish whether some hypothesized biologic and genetic markers have any link with the laboratory and clinical expressions of patients with sickle cell disease as these may be useful in predicting severity as well as influencing therapeutic decisions in SCD.
5. PATIENTS AND METHODS
5.1. Type of study
This was a cross-sectional descriptive study
5.2. Place of research
The research was carried out at the Hemoglobin and Genome Laboratory of the Hematology and Hemotherapy Center of UNICAMP and the pediatrics hematology unit of the Ekiti State University Teaching Hospital (EKSUTH) Ado Ekiti, Ekiti State Nigeria. Institutional ethical approvals were obtained (EKSUTH/A67/2016/03/003 and UNICAMP CAAE 54031115.9.0000.5404).
5.3. Selection of patients and control subjects
The study included patients with sickle cell disease treated at the hematology and hemotherapy centre, UNICAMP and EKSUTH with diagnostic testing by high pressure liquid chromatography (HPLC) (Bio-Rad, Hercules, CA, USA) and genetic studies.
UNICAMP
For the hematology and hemotherapy centre arm of the study, the study participants included patients of both sexes, aged 18 – 60 years and are on regular follow up. The patients were stable state, i.e, absence of any acute event such as painful crisis, and or infection, within a month and without blood transfusion for at least three months to recruitment period. 12mL of each participant's blood were collected for plasma separation and other analyses.The control group consisted of healthy volunteers, and staff members at the Hemoglobin and Genome Laboratory of the Hematology and Hemotherapy Center of UNICAMP, aged 18-60 years. All the controls had HbAA genotype and this was confirmed by high performance liquid chromatography (HPLC). The determination of clinical sequale and complications of sickle cell disease in all patients, were as previously described by Ballas et al77
EKSUTH
The EKSUTH participants consisted of children and adolescents diagnosed with SCD and aged 2 -21 years of both sexes in steady state. Children who accompanied their siblings to the EKSUTH to the outpatients` well-child clinic served as controls.
the pediatric hematology unit. The determination of clinical sequale and complications of sickle cell disease in all patients, were as previously described by Ballas et al77.
5.4. Exclusion Criteria:
1. Lack of consent of the patient, or parents or accompanying family members / caregivers.
2. Patients in crisis or pain crisis in the last month before the study.
3. Patients hospitalized for any medical condition in the last three months prior to the study.
4. Patients on chronic blood transfusion or those who have received blood transfusion in the last three months.
5. Patients with other chronic medical conditions. 6. Pregnancy
5.5. Sample size:
A total of 358 people participated in the study. They comprised of 138 patients with SCD and 39 controls from hematology and hemotherapy centre, UNICAMP, Brazil and 110 children with SCD alongside 68 controls from the EKSUTH in Nigeria.
5.6. Study Procedure and data collection
After obtaining the consent of participants, parents and or assent as applicable, peripheral venous blood samples approximately 12 mL (4ml into EDTA tube for hematological and DNA studies, 4ml into EDTA tube for plasma extraction, and 3.5ml into Sodium citrate tube for red blood cell microparticle studies), were collected by venipuncture from the patients.
Blood samples were processed to obtain plasma and stored in freezer at -80 ° C until analysis as applicable.
5.7. Clinical history and events
A detailed history with special attention to the frequency of acute events such as pain episodes, and acute chest syndrome in the past 12 months were obtained from the records. In addition, frequency of other chronic events complicating SCD such as, cerebrovascular disease, avascular necrosis of the head of femur, leg ulcers, priapism,
SCD retinopathy, pulmonary complications and kidney disease, were verified through past hospital records, and were defined according the SCD co-operative study group77. A brief description of few of the events by Ballas et al are as follows77.
1. Painful crisis: Acute significant painful episode will be described as painful event(s) requiring a hospital visit or disruption of normal daily activities and requiring the use of oral or parenteral analgesics.
2. Avascular necrosis: This will be defined as osteonecrosis or aseptic necrosis of the head of femur or humerus confirmed by radiography as irregularity of the articular surfaces of the head of femur/humerus
3. Severe bacterial infections: These will be defined by the presence of one or more of pneumonia, sepsis, meningitis, osteomyelitis, septic arthritis, confirmed by positive blood culture and or radiograph as appropriate.
4. Acute chest syndrome: An acute illness characterised by fever, and respiratory symptoms (dyspnea, chest pain) accompanied by low pulse oxymetry and new pulmonary infilterates on chest radiodragh
5. Stroke (cerebro-vascular disease): Acute neurologic symptoms or signs secondarytoocclussion of and orhemorrhage from cerebral vessels confirmed on computerized tomography (CT) scan or magnetic resonance imaging (MRI) 6. Chronic leg ulcer: Ulceration of the skin and underlying tissue of the lower
extremeties, especially the media or lateral surface of the ankle. 7. Priapism: Sustained, unwanted and painful penile erection.
8. Cholelithiasis: Confirmed cholelithiasis on abdominal USS with or without abdominal pain.
However, due to the lack of right heart catetherisation to diagnose pulmonary hypertension the tricuspid regurgitation velocity (TRV) obtained from Doppler echocardiography was used to categorise patients into two groups based on risk for pulmonary hypertension. Patients with TRV < 2.5m/sec were categorised as having normal TRV and those with TRV ≥2.5m/sec were categorised as having elevated TRV and at risk of pulmonary hypertension78. Urinary albumin-creatinine ratio (UACR) of less than 30mg/g was taken as no albuminuria (i.e. normal), between 30mg/g and 300mg/g as microalbuminuria and greater than 300mg/g was classified as macroalbuminuria79. Patients were also classified into
retinopathy.
Routine laboratory investigations: All laboratory tests were done by standard
procedures.
5.8. Haematological tests:
These included haematocrit; haemoglobin concentration; WBC - total and differential counts; MCV; MCHC, RDW, reticulocyte count and platelet count and fetal Haemoglobin level measurements using automated hematology analyzer and HPLC respectively.
5.9. Biochemical tests: These were done by standard laboratory procedures and they
included serum bilirubin – total and unconjugated, lactate dehydrogenase (LDH) and urinalysis to determine microalbuminuria.
5.10. Colorimetric Assays:
5.10.1. Plasma hemoglobin: This was done on frozen plasma samples with the
QuantiChromTM Hemoglobin Assay Kit (DIHB-250), BioAssay Systems USA. This assay is based on an improved Triton/NaOH method, in which the haemoglobin present in a sample is concerted to a uniform coloured end-product, and the intensity of colour measured at 400nM is directly proportional to the haemoglobin concentration present in the plasma80. 5.10.2. Heme: This was done on frozen plasma samples with the QuantiChromTM
Heme Assay Kit (DIHM-250), BioAssay Systems USA. The Assay Kit is based on an improved aqueous alkaline solution method, in which the heme is converted into a uniform coloured form. The intensity of colour, measured at 400 nm, is directly proportional to the heme concentration in the sample81.
5.11. ELISA Tests:
5.11.1. Hemopexin: This was done on frozen plasma samples with the Abcam
Human Hemopexin (ab171576) ELISA kit. This assay employs an affinity tag labelled capture antibody and a reporter conjugated detector antibody which immunocaptured the samples analyte in solution. This entire complex
(capture antibody/analyte/detector antibody) is in turn immobilised via immunoaffinity of an anti-tag antibody coating the well. Briefly, to perform the assay, a Hemopexin specific antibody has been precoated onto 96-well plates. Standards or test samples were added to the wells and subsequently biotinylated Hemopexin (antibody mix) was added and incubated on a plate shaker then followed by washing with wash buffer. After washing away any unbound substances, an enzyme linked polyclonal antibody specific for hemopoxin was added to the wells and a substrate solution was then added to the wells and colour change develops in proportion to the amount of hemopexin bounded by in the initial step. The development of colour was stopped by adding stop solution. The density of yellow coloration was proportional to the amount of Hemopexin captured in the plate. The intensity was measured at 450nM82. The minimal detectable limit of the kit is 1.44ng/ml.
5.11.2. Haptoglobin: This was done on frozen plasma samples with the Quantikine
Human Haptoglobin (DHAPGO) ELISA kit, R & D Systems USA. The assay employs the quantitative sandwich enzyme immune assay technique in which a Haptoglobin specific antibody has been precoated onto 96-wellplates and immobilised. Standards or test samples were added to the wells and any Haptoglobin present was bounded by the immobilised antibody. After washing away any unbound substances, an enzyme linked polyclonal antibody specific for haptoglobin was added to the wells. This was followed by a repeat wash to remove any unbound antibody-enzyme reagent, a substrate solution was then added to the wells and colour develops in proportion to the amount of haptoglobin bounded by in the initial step. The development was stopped by adding stop solution. The density of coloration was proportional to the amount of Haptoglobin captured in the plate. The intensity of the colour was measured at 450nM83. The minimum detectable limit of the kit ranged from 0.031 – 0.529ng/ml and the mean minimal detectable limit is 0.192ng/ml.
5.12. Flow Cytometry:
5.12.1. Red blood cell microparticles quantification: Flow cytometry was used
to characterise and quantify the red blood cells microparticles (RMP). The processes involved differential centrifugation followed by staining and
processes are briefly described below.
5.12.2. Sample collection and plasma separation for RMP analysis: 3.5ml of
citrated venous sample collected by 21gauge syringe were drawn from each participants after taking the first 8ml of blood into two EDTA sample tubes (4mL each) for plasma separation and the other for hematological analysis with very light tourniquets applied. The citrate samples were not mixed or rocked and were transported securely in upright positions inside the sample carrier to the laboratory immediately and the plasma separation was done within 30 minutes of collection. To obtain the plasma, the topmost 1ml of the citrated whole blood sample was pipetted out and discarded and the remaining was processed through a two stage centrifuging, the first at 2,500g x 15min at 22 °C thereafter the topmost 1ml of the plasma from this first centrifugation was pipetted out and the remaining discarded. A second centrifugation at 13,000g x 5mins at 22 °C was done for the topmost 1ml plasma obtained from the first centrifugation. The topmost 700µl of the product of the second centrifugation was pipetted out into a separate polypropylene tube and the platelet count of the plasma was checked using Beckman Coulter hematologic counter (Model 8246-EN, SN- AN37824), USA, to ensure it was platelet depleted. Thereafter, the samples were aliquoted into polypropylene tubes and frozen at -80 °C until analysis.
5.12.3. Red blood cell microparticle staining and quantification: The staining
reagents (a. Calcein violet AM (Molecular probes-Invitrogen: 3,125µg (5µL), b. Bovine Lactadherin FITC (Haematologic Technologies, Inc. 0.83µg (10µL), c. Anti-CD235a R-PE (Life Technologies: 2µL), d. Sterile filtered PBS 2 x 0.22 µm membrane) and aliquoted frozen platelet poor plasma were brought to room temperature. The reagents were prepared according to manufacturers` specifications. The antibodies (Calcein AM, Anti-CD235a and Lactadherin were also subjected to a high speed centrifugation at 20,000g x 5minutes at room temperature to remove false positive events at analysis. After preparing fresh polypropylene tubes, 10µl of each sample was stained with 5µL, 10µL, 2µL & 5µL of calcein, lactadherin, anti-CD235a and filtered sterile PBS buffer respectively. The resultant solution was gently vortexed and incubated in the dark at 37 ° C, -5%CO2 for 60mins initially. Thereafter,
500µL of sterile filtered PBS was added and then incubated for the second time in the dark at 37 ° C, -5%CO2 for 30mins. Immediately after the second incubation, the resultant solution was further diluted with 3,468µL of sterile filtered PBS to make a final dilution of 1:400 with a resultant solution totaling 4000µL. This resultant solution was immediately analysed on a calibrated flow cytometer, the Beckman Coutler`s CytoFLEX Flow Cytometer, (Model A00 -1-1102) USA, using the staining buffer as negative control. Each sample was aspirated and read for 10mins by the Cytoflex machine. The RMP events were expressed per mL.
5.13. Genetic Studies:
The DNA of the Nigerian patients extracted from each participant by Qiagen QIAamp DNA (Blood Mini Kit Cat No. 51104 Germany), was used to confirm the diagnosis of SCD by polymerase chain reaction (PCR) at the genetic laboratory at the Hematology and Hemotherapy centre, Hemocentro-Universidade Estadual de Campinas (UNICAMP) Brazil. All DNA studies were carried out blinded regarding the clinical and laboratory parameters of the participants.
5.13.1. Alpha thalassemia determination: Alpha-thalassemia (α3.7Kb deletion)
was investigated by GAP-PCR according to Dodé et al., 1993. The PCR was performed in 25 μL reaction volume containing 100ng of DNA sample; 1X α- Buffer (Tris-HCl 2M (pH 8.6), (NH4)2 SO4 1M, MgCl2 1M, Na2EDTA 0.2M, BSA and β-mercaptoetanol 14.3M); 1X DMSO; 0.3mM of dNTP mix; 0.2 µM of each primer (C2:CCATGCTGGCACGTTTCTGAandC10: GATGCACCCACTGGACTCCT); 1U of GoTaq® Flexi DNA Polymerase (Promega Corporation, Madison, USA). Thermal cycle conditions were as follows: preheating at 94°C by 5 minutes, followed by 35 cycles of 94°C for 45 seconds, 56°C for 1 minute, and 72°C for 2 minutes and a final extension at 72°C for 7 minutes was performed. After electrophoresis in a 1.2% agarose gel a fragment of 2.1Kb could be observed for normal alleles and 1.9Kb fragment for deleted alleles (-α3.7Kb).
Alpha-thalassemia (α4.2Kbdeletion) was investigated by Multiplex-PCR.
The PCR was performed in 25 μL reaction volume containing 100ng of DNA sample; 1X α- Buffer (Tris-HCl 2M (pH 8.6), (NH4)2 SO4 1M, MgCl2 1M,
dNTP mix; 0.4 µM of primer (P71: TACCCATGTGGTGCCTCCATG and 0.3 µM of each of primer P72:TGTCTGCCACCCTCTTCTGAC and P52: CCTCCATTGTTGGCACATTCC; 1U of Taq DNA Polymerase (Invitrogen, Carlsbad,CA). Thermal cycle conditions were as follows: preheating at 94°C by 5 minutes, followed by 35 cycles of 94°C for 45 seconds, 60°C for 1 minute, and 72°C for 2 minutes and a final extension at 72°C for 7 minutes was performed. After electrophoresis in a 1.2% agarose gel a fragment of 1596 bp could be observed for deleted alleles (-α4.2Kb) and 233 bp as an internal control to verify the quality of DNA sample.
5.13.2. Uridine diphosphate glucuronosyl transferase 1A (UGT1A1) promoter polymorphism (rs8175347): DNA samples were used for
genotyping of the (TA)nTAA UGT1A1 promoter polymorphism (GenBank accession NG_002601). The rs8175347 identification was performed by Polymerase Chain Reaction (PCR) using a forward primer 5'- (6-FAM) labelled (*) for detection by fragment analysis in capillary electrophoresis system. The PCR reaction was prepared in 30 µL volume with 100ng of genomic DNA; 1X Reaction Buffer (BIOTOOLS B&M Labs, Spain); 2.16mM MgCl2; 1.33 mM of dNTP mix; 133 nM of each primer (Integrated DNA Technologies, Coralville, Iowa) named: UGT1A1_*F:
GTCACGTGACACAGTCAAAC and UGT1A1_R:
CAACAGTATCTTCCCAGCATG; and 1 U Taq DNA Polymerase (BIOTOOLS B&M Labs, Spain). Thermal cycle conditions were as follows: preheating at 96°C by 2 minutes, followed by 25 cycles of 96°C for 30 seconds, 58°C for 40 seconds, and 72°C for 40 seconds. An ended step at 72°C for 30 min was performed to promote adenylation of the PCR products. The PCR product (1 μL) was added to 8.7 μL Hi-Di Formamide (Applied Biosystems, Carlsbad, CA) and 0.3 μL of a GeneScan™ 500 LIZ™ size standard (Applied Biosystems, Carlsbad, CA) and the fragments ranged from 197 - 203 bp, corresponding to (TA)5 - (TA)8 repeats, respectively, were separated by capillary electrophoresis on a ABI3500 Genetic Analyzer and analysed by Gene Mapper v 4.1 Software (both Applied Biosystems, Carlsbad, CA). The UGT1A1 genotypes were further classified into three
subgroups namely: low, intermediate and high activity group based on their activities and number of TA repeats.
5.13.3. Haplotypes (β globin chain): The βs-haplotypes were determined by by TaqMan SNP genotyping assay of three single nucleotide polymorphisms (SNPs); Xmn I-rs7482144, Hinc II-rs968857, and Hinf I-rs16911905 as follows.
Haplotypes linked to the βS mutation provided important anthropological information regarding the multiple origins of the HbS allele. TaqMan® Genotyping Assays (Applied Biosystems, Carlsbad, CA) were used for screening of 3 polymorphic sites located at β-globin gene cluster and to determine the different haplotypes: SENEGAL, BENIN, CAR (Central African Republic), ARAB-INDIAN, CAMEROON. The assays related to restriction sites were analysed: Xmn I (customized - rs7482144) at position - 158 of the γG gene promoter; Hinc II (C_9599121_10 - rs968857 ) located at 3' region of ψβ gene; and Hinf I (C_32838989_10 - rs16911905) at 5’ to the β gene. DNA samples were prepared at 50ng/μL of concentration and the SNP Genotyping assay was diluted to 5X concentrated, then the reaction mixture contained: 2.5 μL TaqMan Genotyping MasterMix (2X); 1.0 μL of diluted assay (5X) and 1.5 μL of DNA sample. The reaction was carried out using allelic discrimination protocol in ABI7500 FAST and StepOne Plus Real Time PCR systems (Applied Biosystems, Carlsbad, CA), following the cycling conditions: 30 seconds at 60°C, 10 minutes at 95°C followed by 45 cycles of 15 seconds at 95°C and 1 minute at 60°C, and a final step named post-PCR at 60°C for 30 seconds with automated allele calling settings for the SDS 2.1 software (Applied Biosystems, Carlsbad, CA). The figure below shows how the haplotypes could be identified.
Figure 3: The βs-haplotypes.
5.13.4. Glucose 6 phosphate dehydrogenase deficiency (G6PD): The
Identification of mutations: G6PD G202A - African (rs1050828), G6PD A376G-(rs1050829), G6PD A542T-(rs5030872), G6PD G680T-(rs137852328) and C563T - Mediterranean (rs5030868) was as follows. TaqMan® Genotyping Assays (Applied Biosystems, Carlsbad, CA) were used for screening of African and Mediterranean mutations of G6PD, respectively identified as rs1050828 and rs5030868 DNA samples were prepared at 50ng/μL of concentration and the SNP Genotyping assay was diluted to 5X concentrated, then the reaction mixture contained: 2.5 μL TaqMan Genotyping MasterMix (2X); 1.0 μL of diluted assay (5X) and 1.5 μL of DNA sample. The reaction was carried out using allelic discrimination protocol in ABI7500 FAST and StepOne Plus Real Time PCR systems (Applied Biosystems, Carlsbad, CA), following the cycling conditions: 30 seconds at 60°C, 10 minutes at 95°C followed by 45 cycles of 15 seconds at 95°C and 1 minute at 60°C, and a final step named post-PCR at 60°C for 30 seconds with automated allele calling settings for the SDS 2.1 software (Applied Biosystems, Carlsbad, CA). PCR-RFLP was performed in aleatory samples to confirm G6PD G202A genotypes. The PCR reaction was prepared in 25 µL volume with 100ng of genomic DNA; 1X Colorless GoTaq® Flexi Reaction Buffer (Promega Corporation, Madison, USA); 2 mM MgCl2; 0.2 mM of dNTP mix; 0.2 µM of each primer (Integrated DNA Technologies,
Haplotype Name Xmn I (1) rs7482144 Hinc II (2) rs968857 Hinf I (3) rs16911905 Sequence
Senegal + (A) + (T) + (G) ATG
Arab-Indian + (A) + (T) - (C) ATC
CAR - (G) - (C) - (C) GCC
Benin - (G) + (T) - (C) GTC
