Spliced Leader
Minimum free energy predicted base pairing in the 39 nt spliced leader and 5’ UTR of calmodulin mRNA from Trypanosoma cruzi: influence of the multiple trans-splicing sites
... the spliced leader (forward primer based on the first 25 bases of the 39 nt spliced leader: 5’ AACTAACGCTATTATTGATACAGTT 3’) and calmodulin 3’ UTR common to all copies (reverse primer: 5’ ...
6
A directed approach for the identification of transcripts harbouring the spliced leader sequence and the effect of trans-splicing knockdown in Schistosoma mansoni
... that spliced leader (SL) trans-splicing could play an important role in the biology of these ...trans- spliced transcripts in sporocysts resulted in a systemic reduction of the expression levels of ...
44
Spliced Leader (SL) RNA: análises de genes e regiões intergênicas com aportes na filogenia, taxonomia e genotipagem de Trypanosoma spp. de todas as classes de vertebrados.
... do Spliced Leader impossibilita o uso de estratégias baseadas em homologia que permitam entender sua evolução e assim determinar qual das duas hipóteses é a mais ...
44
Spliced Leader (SL) RNA: análises de genes e regiões intergênicas com aportes na filogenia, taxonomia e genotipagem de Trypanosoma spp. de todas as classes de vertebrados.
... “Spliced Leader” (SL) de SL-RNAs especializados, não codificadores e conservados, continua sendo um fenômeno enigmático que acontece em um grande grupo de animais filogeneticamente não relacionados, ...
187
Actively transcribing RNA polymerase II concentrates on spliced leader genes in the nucleus of Trypanosoma cruzi
... the spliced leader RNA, which are capped, exported to the cytoplasm, processed, and reimported into the nucleus before they are used as splicing donors to form mRNAs from pre-mRNA polycistronic ...and ...
11
Minimum free energy predicted base pairing in the 39 nt spliced leader and 5’ UTR of calmodulin mRNA from Trypanosoma cruzi: influence of the multiple trans-splicing sites
... the spliced leader (forward primer based on the first 25 bases of the 39 nt spliced leader: 5’ AACTAACGCTATTATTGATACAGTT 3’) and calmodulin 3’ UTR common to all copies (reverse primer: 5’ ...
6
Spliced leader trapping reveals widespread alternative splicing patterns in the highly dynamic transcriptome of Trypanosoma brucei.
... Base calling was performed using the Genome Analyzer Pipeline (Illumina). Linker sequences were removed while separating reads according to identified barcodes. Only sequence reads of inserts with a length of at least 24 ...
13
Footprints of a trypanosomatid RNA world: pre-small subunit rRNA processing by spliced leader addition trans-splicing
... Trypanosomatids are a remarkable group of early branching protozoa that have developed unusual strate- gies to become efficient eukaryotic parasites (Simpson et al. 2006). Although data on the regulation of gene ...
10
The identification of two Trypanosoma cruzi I genotypes from domestic and sylvatic transmission cycles in Colombia based on a single polymerase chain reaction amplification of the spliced-leader intergenic region
... disease, has been divided into six discrete taxonomic units (DTUs) named T. cruzi I-VI (Zingales et al. 2009). Recently, many authors have attempted to determine the geographical distribution of T. cruzi DTUs and their ...
4
Retrieval of missing spliced leader in dinoflagellates.
... Spliced leader (SL) trans-splicing has recently been shown to be a common mRNA processing mechanism in dinoflagellates, in which a short (22-nt) sequence, DCCGUAGCCAUUUUGGCUCAAG (D = U, A, or G), is ...
5
Leader´s attitudes towards corruption - empirical evidence from Northern Mozambique
... The variables used as dependent are already mentioned above. The ones with two declarations choice are related to the perception of corruption and attitudes of violence. In terms of trust, we built an index of ...
25
Análise dos efeitos do programa de iniciativa comunitária LEADER na região Alentejo, entre 1991 e 2006
... programas LEADER +» também indicava que apesar das “recomendações relativas à metodologia, os avaliadores e a autoridade de gestão [eram] livres de optar por uma metodologia diferente, caso considerem que ...
101
Análise da Mortalidade das Empresas Apoiadas por Políticas Públicas. O Caso do Programa LEADER+
... RESUMO. Esta comunicação tem como objetivo comparar a região Alentejo e a região Norte, no que ...
11
Democracia participativa na construção de políticas públicas regionais: o caso da abordagem LEADER
... experiência LEADER, existe gente com mentalidade pouco recetiva em trabalhar em ...abordagem LEADER, é a elevada autonomia que possuem as entidades, são financiadas através de contratos de subvenção e de ...
166
Research in Angora goats under the LEADER II in Portugal
... under LEADER II, it will be possible to assess the value to farmers of the introduction of this new goat breed and supply concrete information on production parameters and appropriate management techniques not ...
8
Zara’s case study : the leader in the fast fashion concept
... a leader in the fast fashion concept and in the industry because the brand began to change the fashion industry with a new concept: instead of designers predicting what the customer will want, the customer chooses ...
64
Algoritmo Multiswarm Spiral Leader Particle Swarm Optimization para a estimação dos parâmetros PV
... Enhanced Leader Particle Swarm Optimization (ELPSO) [98], Guaranteed Convergence Particle Swarm Optimization (GCPSO) [34], Improved Shuffled Complex Evolution (ISCE) [99], Genetic Algorithm with Convex Combination ...
136
Leader succession: the impact of leaders’ background characteristics on organizations’ performance
... (e.g. Grusky, 1964). Moreover, scholars as Datta and Guthrie (1994) suggested that hiring an insider’s replacements would result in a cost reduction of the company’s selections process, socialization activities and ...
30
A DNMT3B alternatively spliced exon and encoded peptide are novel biomarkers of human pluripotent stem cells.
... alternatively spliced variants of many genes that play important roles in signaling pathways that have been implicated in development and differentiation ...alternatively spliced variants as unique markers ...
10