differentiation during mouse cerebral cortex development (2016) Cerebral Cortex . Juntamente com Themis Taynah, realizei experimentos no Instituto do Cérebro (UFRN) envolvendo análise morfológica e de sobrevivência celular após a inibição do CREB através de dois dominantes negativos (ACREB e M-CREB). É sabido que o CREB regula a expressão de diversos genes-alvo de forma dependente de atividade. Todavia, a função do CREB em estágios iniciais da diferenciação neuronal, antes do estabelecimento de contatos sinápticos funcionais, ainda é pouco explorada. Nossos dados mostraram que a inibição do CREB afeta a complexidade da arborização e sobrevivência dos neurônios in vitro, sem afetar a proliferação e neurogênese.
Cellular/Molecular
Proliferative Defects and Formation of a Double Cortex in
Mice Lacking
Mltt4 and Cdh2 in the Dorsal Telencephalon
Cristina Gil-Sanz,1Bruna Landeira,2Cynthia Ramos,1Marcos R. Costa,2and Ulrich Mu¨ller1
1Department of Molecular and Cellular Neuroscience, Dorris Neuroscience Center, The Scripps Research Institute, La Jolla, California 92037, and2Brain
Institute, Federal University of Rio Grande do Norte, Natal, Rio Grande do Norte 59056-450, Brazil
Radial glial cells (RGCs) in the ventricular neuroepithelium of the dorsal telencephalon are the progenitor cells for neocortical projection neurons and astrocytes. Here we show that the adherens junction proteins afadin and CDH2 are critical for the control of cell proliferation in the dorsal telencephalon and for the formation of its normal laminar structure. Inactivation of afadin or CDH2 in the dorsal telenceph- alon leads to a phenotype resembling subcortical band heterotopia, also known as “double cortex,” a brain malformation in which heterotopic gray matter is interposed between zones of white matter. Adherens junctions between RGCs are disrupted in the mutants, progenitor cells are widely dispersed throughout the developing neocortex, and their proliferation is dramatically increased. Major subtypes of neocortical projection neurons are generated, but their integration into cell layers is disrupted. Our findings suggest that defects in adherens junctions components in mice massively affects progenitor cell proliferation and leads to a double cortex-like phenotype.
Key words: afadin; CDH2; double cortex; neocortex; progenitor; radial glia
Introduction
Radial glial cells (RGCs) of the dorsal telencephalon are the pro- genitor cells for neocortical projection neurons and astrocytes. Newly born neurons and astrocytes migrate from their place of birth near the ventricle toward the meninges to form the neocor- tical cell layers (Kriegstein and Noctor, 2004;Ayala et al., 2007;
Franco and Mu¨ller, 2013;Greig et al., 2013). Defects in cell pro- liferation migration and differentiation lead to brain malforma- tions, such as periventricular heterotopia, lissencephaly, and subcortical band heterotopia (SBH;des Portes et al., 1998;Sheen et al., 2004;Ferland et al., 2009). In SBH, also known as “double cortex,” heterotopic gray matter is interposed between zones of white matter (Barkovich et al., 1994;Dobyns et al., 1999). The mechanisms that cause SBH have been proposed to involve de- fects in both the migration of neurons into the developing neo- cortical cell layers and the differentiation and proliferation of RGCs (Ross and Walsh, 2001;Bielas et al., 2004;Cappello et al., 2012).
RGCs project apical processes toward the ventricle and basal processes toward the meninges (Fishell and Kriegstein, 2003;Ra-
kic, 2003). The end feet of the apical processes are connected by adherens junctions that require for their formation CDH2, -catenin, and ␣E-catenin (Brault et al., 2001;Machon et al., 2003;Junghans et al., 2005;Lien et al., 2006;Woodhead et al., 2006;Kadowaki et al., 2007;Tang et al., 2009). Inactivation of the small GTPase RhoA in the dorsal telencephalon of mice results in the disruption of adherens junctions and the formation of a dou- ble cortex (Cappello et al., 2012), suggesting a mechanistic link between perturbation in the adhesive interactions between RGCs and cortical lamination defects.
In epithelial cells, the localization and activity of cadherins is promoted by nectins, which are members of the Ig superfamily (Ikeda et al., 1999;Takahashi et al., 1999;Miyahara et al., 2000;
Sato et al., 2006). The adaptor protein afadin links nectins and cadherins by binding to the cytoplasmic domains of nectins and associating with p120-catenin and␣-catenin (Takahashi et al., 1999;Tachibana et al., 2000;Pokutta et al., 2002;Hoshino et al., 2005), which in turn interact with the cytoplasmic domains of cadherins (Ozawa et al., 1989,1990;Herrenknecht et al., 1991;
Nagafuchi et al., 1991;Hirano et al., 1992;Knudsen and Whee- lock, 1992;Reynolds et al., 1992). Without afadin, cadherin clus- tering is perturbed, leading to defects in the formation of adherens junctions (Ikeda et al., 1999;Sato et al., 2006). Although cadherins/catenins are required for adherens junction formation between RGCs, the role of afadin in this process is less clear. Afadin inactivation in RGCs at approximately E11.5 using
nestin–Cre leads to progressive loss of adherens junctions
(Yamamoto et al., 2013). The phenotype is restricted to some brain regions, and the severe hydrocephalus of the mutants has complicated mechanistic studies.
To further define the function of afadin in the neocortex, we generated a mouse line carrying a floxed allele of its gene (named
Received May 2, 2014; revised June 10, 2014; accepted June 13, 2014.
Author contributions: C.G.-S., B.L., M.R.C., and U.M. designed research; C.G.-S., B.L., and C.R. performed research; C.G.-S., B.L., and U.M. analyzed data; C.G.-S., B.L., M.R.C., and U.M. wrote the paper.
This work was supported by National Institutes of Health Grants NS046456 and HD070494 (U.M.), the Dorris Neuroscience Center (U.M.), the Skaggs Institute for Chemical Biology (U.M.), Ministry of Education Grant EX2009- 0416 (C.G.-S.), Generalitat Valenciana Grant APOSTD/2010/064 (C.G.-S.), California Institute of Regenerative Med- icine (C.G.-S.), and CAPES (Coordenação de Aperfeiçoamento de Pessoal de Nível Superior) Foundation/Ministry of Education Grant PDSE 7640-13-7 (B.L.).
Correspondence should be addressed to Ulrich Mu¨ller, Dorris Neuroscience Center, The Scripps Research Institute, 10550 North Torrey Pines Road, La Jolla, CA 92037. E-mail: [email protected].
DOI:10.1523/JNEUROSCI.1793-14.2014
Copyright © 2014 the authors 0270-6474/14/3410475-13$15.00/0
Mtll4 ). We then inactivated Mtll4 expression using Emx1–Cre
mice, which induces recombination in the dorsal telencephalon starting 1 day earlier than achieved with nestin–Cre (Gorski et al., 2002;Li et al., 2003;Dubois et al., 2006). The mutant offspring showed widespread disruption of adherens junctions between RGCs and a dramatic increase in progenitor proliferation, a phe- notype that was even more pronounced in mice lacking Cdh2 in the dorsal telencephalon. Adult mice with a dorsal telencephalon-specific inactivation of either Mttl4 or Cdh2 ex- hibited a double cortex-like phenotype. These findings suggest that adherens junctions are critical for the control of progenitor cell proliferation during neocortical development and that mu- tations that affect adherens junction proteins can lead to a double cortex-like phenotype in mice.
Materials and Methods
Mice. Experiments using mice were performed under the oversight of
an institutional review board. Mice carrying a floxed Mllt4 gene were generated using ES cell clones from European Conditional Mouse Mutagenesis Program (EUCOMM; HEPD0591_8_E01) with knock- out first mutation (HEPD0591_8_E01;Ryder et al., 2013; http://www. mousephenotype.org/martsearch_ikmc_project/martsearch/ikmc_project/ 79371). ES clones were injected into C57BL/6J blastocysts, and the resulting chimeras were mated to C57BL/6J females to obtain germ-line transmission. Offspring were genotyped by PCR using the following primers: G5arm, CATGTTTATT CTTGGTTTCAGCTGGG; G3arm, AACGACTTCACACCTTGACTAAGG; and LAR3, CAACGGGTTCTTCTG TTAGTCC. The sizes of the PCR products are 549 bp (WT band) and 411 bp (mutant band). Heterozygous F1 mice (Mllt4KO-flox/⫹) were mated with B6.Cg-Tg(ACTFLPe) mice (stock #005703; The Jackson Laboratory) to
remove the promoter-driven selection cassette of the knock-out first mutation, and the resulting offspring (Mllt4flox-FLP/⫹) were subsequently
mated to C57BL/6J mice to segregate the FLPe transgene. Heterozygous offspring (Mllt4flox/⫹) were crossed to generate Mllt4flox/floxmice, and
genotyping was performed by PCR (G5arm, CATGTTTATTCTTG- GTTTCAGCTGGG; and G3arm, AACGACTTCACACCTTGACTAA GG). The sizes of the PCR products are 549 bp (WT band) and 650 bp (flox band). Mllt4flox/floxmice were mated to EMX1Cretransgenic mice
(Gorski et al., 2002) to generate Mllt4flox/⫹EMX1Cre/⫹mice, which were
crossed with Mllt4flox/floxmice to obtain the animals used in the experi-
ments. The presence of CRE was analyzed by PCR using previously pub- lished methods (Gorski et al., 2002). Cdh2flox/floxmice (stock #007611;
The Jackson Laboratory) were crossed with Emx1Cremice to generate Cdh2flox/⫹Emx1Cre/⫹, which were crossed with Cdh2flox/floxto generate
the animals used in the experiments.
Histology and immunostaining. Nissl staining and immunohistochem-
istry was performed as described previously (Franco et al., 2011,2012;
Gil-Sanz et al., 2013). Embryonic brains were dissected and fixed in 4% paraformaldehyde (PFA) overnight at 4°C. Adult brains were transcar- dially perfused with 4% PFA, and brains were dissected and postfixed in 4% PFA overnight at 4°C. Brains were sectioned coronally at 50 or 100 m with a vibrating microtome (VT1200S; Leica) or at 12 m with a cryostat (CM 3050S; Leica). Sections used for 5-bromo-2⬘-deoxyuridine (BrdU) immunostaining were first treated with 2N HCl for 20 min and washed twice with borate buffer, pH 8.0, to equilibrate. Antibodies used for immunostaining are as follows: anti-␣E-catenin rabbit polyclonal (Cell Signaling Technology), anti-afadin rabbit polyclonal (Sigma), anti- -catenin mouse monoclonal (BD Biosciences), anti-BrdU mouse monoclonal (BD Biosciences), anti-BrdU rat monoclonal (AbD Sero- tec), anti-CDH2 mouse monoclonal (Sigma), anti-Ctip2 rat monoclonal (Abcam), anti-Cux1 rabbit polyclonal (Santa Cruz Biotechnology), anti- GFAP rabbit polyclonal (Dako), anti-Ki67 rabbit polyclonal (Abcam), anti-Ki67 rat monoclonal (AbD Serotec), anti-L1 rat polyclonal (Milli- pore), anti-NeuN mouse monoclonal (Millipore), anti-Pax6 rabbit poly- clonal (Covance), anti-phospho-Histone 3 (pH3) rabbit polyclonal (Cell Signaling Technology), anti-TAG1 mouse monoclonal (Developmental Studies Hybridoma Bank, National Institute of Child Health and Human
Development, and University of Iowa Department of Biology), anti-Tbr2 chicken (Millipore), anti-Tbr2 rabbit polyclonal (Abcam), and anti-Tuj1 mouse monoclonal (Covance). Nuclei were stained with DAPI (Thermo Fisher Scientific) and sections were mounted on slides with Prolong Gold mounting medium (Thermo Fisher Scientific). Images were captured using a Nikon-C2 or a Nikon-A1 laser-scanning confocal microscope and an Olympus AX70 microscope for bright-field images.
Quantifications and cell cycle analysis. At least three histological sec-
tions from three different animals at three distinct rostrocaudal levels for each genotype were analyzed for each immunostaining. Confocal optical sections were used for quantification. Cells were counted in columns from the ventricular zone (VZ) to the marginal zone (MZ). Values are mean⫾ SEM. To measure the density of Pax6, Tbr2, or Ki67 cells, the number of positive cells was determined in an area including a column of the cortical primordium (from MZ to VZ) and normalized to 104m2.
For quantifications in Cdh2 conditional knock-out (Cdh2-cKO) attrib- utable to the severe hyperplasia that generates a dramatic increase of the thickness of the cortex, we evaluated the differences in the number of Pax6, Tbr2, or Ki67 cells in radial columns of the same thickness as in controls from the VZ to the MZ. To follow proliferating cells, we injected pregnant females intraperitoneally with BrdU (Sigma) at 150g/g. Em- bryos were collected 30 min after the injection (to label cells during S-phase) and 24 h after the injection (to label cells in S-phase and some postmitotic neurons). pH3 labels cells in M-phase. Ki67 labels the cells in any phase of the cell cycle. For cell cycle quantifications, three parameters were analyzed: (1) quitting fraction, the proportion of BrdU-positive/ Ki67-negative (BrdU⫹/Ki67⫺) cells among all BrdU⫹cells, 24 h after the injection; (2) BrdU labeling index, the proportion of BrdU⫹cells among all dividing Ki67⫹cells, 30 min after the injection; and (3) mitotic index, proportion of the pH3⫹cells among all dividing Ki67⫹cells. Cells were counted using the count tool of Adobe Photoshop 6. Statistical analysis was performed using GraphPad Prism software 5.01.
Results
Double cortex-like phenotype in adult Afadin-cKO mice
Mice with a null mutation in the Mttl4 gene die at approximately E10 (Ikeda et al., 1999), preventing an analysis of afadin function in neocortical development with a simple knock-out mouse line. To evaluate genetically the role of afadin during the development of the neocortex, we generated a mouse line carrying a floxed allele of the Mttl4 gene (Fig. 1A). To inactive Mttl4 expression, we
crossed Mttl4-flox mice with Emx1-Cre mice that induced recom- bination as early as E10.5 in progenitor cells of the dorsal telen- cephalon (Gorski et al., 2002;Iwasato et al., 2004). For simplicity, we will refer to the mutant offspring (Mttl4flox/fox;EmxCre/⫹) as
Afadin-cKO mice. For all experiments, we compared the pheno-
type of Afadin-cKO mice with the phenotype of littermates that did not express Cre or contained only one floxed Mttl4 allele.
Afadin-cKO mice were born in the expected Mendelian fre-
quency and survived into adulthood. In whole mounts, the dis- sected brain of the mutant mice at P25 appeared larger than in controls (data not shown). In Nissl stainings of cortical sections at several histological levels along the rostrocaudal axis of the brain, the most obvious difference was the increased size and severe disorganization of the neocortex in the Afadin-cKO mice (Fig. 1B). In control animals, cells in the neocortex were orga-
nized into cell layers above the cell-sparse white matter that con- tains axonal projections (Fig. 1B). In contrast, the cortex of Afadin-cKO mice contained a thin layer of cells near the meninges
and a disorganized mass of cells heterotopically localized deeper within the cortex (Fig. 1B). This mass of heterotopic
cells was flanked above and below by relatively cell sparse regions (Fig. 1B). Hippocampal structure was overall pre-
served but less well organized.
Staining with NeuN confirmed that the thin band of cells near the meninges and the heterotopia contained differentiated neu-
Figure 1. Afadin deletion from cortical progenitors causes SBH or double cortex. A, Afadin-cKO generation. Schematic diagram of wild-type (⫹), knock-out first mutation with conditional potential (KO-flox), floxed ( flox), and Cre-recombined alleles of the Mllt4 gene. The EUCOMM “knock-out first” allele (KO-flox) contains an IRES:lacZ trapping cassette and a (Figure legend continues.) Gil-Sanz et al.• Double Cortex in Mice Lacking Mltt4 and Cdh2 J. Neurosci., August 6, 2014•34(32):10475–10487 • 10477
rons (Fig. 1C). Immunostaining with the astrocyte marker GFAP
that labels fibrous astrocytes within the white matter revealed the accumulation of GFAP⫹cells in the relatively cell-sparse regions flanking the heterotopia (Fig. 1D). The histological features in Afadin-cKO mice resemble the phenotype described for SBH/
double cortex, a defect originally associated with defects in neu- ronal migration (Ross and Walsh, 2001;Bielas et al., 2004) but more recently also linked to alterations in the function of RGCs (Cappello et al., 2012).
Next we used immunohistochemistry to analyze the distribu- tion of Cux1⫹upper layer neurons and Ctip2⫹lower layer neu- rons in Afadin-cKO mice. Cux1⫹cells were abundant in both the thin layer of cells close to the meninges and the heterotopia that were situated deeper in the neocortex (Fig. 1E). Ctip2⫹cells were prominently present in the thin band of cells close to the menin- ges and scattered throughout the ectopia (Fig. 1F ). These find-
ings suggest that at least some subtypes of cortical projection neurons are generated in Afadin-cKO mice but that their assem- bly into neocortical cell layers is perturbed. The histological fea- tures of the neocortex in Afadin-cKO mice are similar to those observed in SBH/double cortex caused by mutations in other genes, such as DCX in humans (des Portes et al., 1998;Gleeson et al., 1998) and RhoA in mice (Cappello et al., 2012).
Disruption of adherens junctions in Afadin-cKO mice
To define the mechanism by which afadin affects neocortical development, we analyzed its expression pattern in the develop- ing dorsal telencephalon. Using immunohistochemistry on sec- tions of E13.5 mice, we confirmed that afadin is expressed throughout the developing dorsal telencephalon, with highest expression levels near the ventricle in which the end feet of RGCs are connected by adherens junctions (Fig. 2A, B). At the ventricle,
afadin was colocalized with CDH2,-catenin, and ␣E-catenin (Fig. 2B, C), suggesting that it cooperates with these proteins in
the formation of adherens junctions. In Afadin-cKO mice, ex- pression of afadin was maintained in the VZ of the ganglionic eminence but not in the VZ of the dorsal telencephalon in which
Emx1–Cre is expressed (Fig. 2D, E). However, afadin expression
was maintained in blood vessels within the neocortex of the mu- tant mice (Fig. 2D, arrows).
To determine the extent to which lack of afadin in the neuro- epitelial cells disrupted adherens junctions between RGCs, we analyzed the distribution of three additional junctional proteins (CDH2,-catenin, and ␣E-catenin) at E13.5. Unlike in control mice, the distribution of the three proteins was severely per-
turbed (Fig. 2E, F ). Afadin expression was no longer detectable
(Fig. 2E), CDH2 and -catenin were distributed more evenly
around the cell surface (Fig. 2E, F ), and␣E-catenin was distrib-
uted diffusely throughout the cell (Fig. 2F ). This redistribution of
proteins is consistently observed when adherens junctions are disrupted (Junghans et al., 2005;Lien et al., 2006;Sato et al., 2006;
Rasin et al., 2007; Yamamoto et al., 2013), suggesting that, in
Afadin-cKO mice, adherens junctions were not properly formed
or maintained.
Dispersion of proliferating progenitor cells in
Afadin-cKO mice
To determine the temporal progression of the neocortical phe- notype in Afadin-cKO mice, we analyzed histological sections of control and mutant mice at E13.5 and E16.5. At E13.5, the thick- ness of the developing neocortex was substantially increased in
Afadin-cKO mice compared with controls as revealed by staining
of nuclei with DAPI (Fig. 3A). Consistent with defects in the
integrity of adherens junctions, the ventricular surface was dis- rupted and irregular in the mutants (Fig. 3A). At E16.5, the neo-
cortex of the Afadin-cKO mice was severely disorganized and appeared hyperplastic (Fig. 3F ).
We next used molecular markers to determine the distribu- tion of progenitor cells and neurons within the developing neo- cortex of Afadin-cKO mice. We used Pax6 as a marker for RGCs, Tbr2 as a marker for intermediate progenitors, and TuJ1 as a marker for differentiated neurons (Caccamo et al., 1989;Lee et al., 1990a,,b;Go¨tz et al., 1998;Englund et al., 2005). Staining with Ki67 at E13.5 and E16.5 revealed that proliferating cells were primarily confined to the VZ and subventricular zone (SVZ) of control mice but broadly distributed throughout the entire thick- ness of the nascent neocortex in Afadin-cKO mice (Fig. 3B, G).
Consistent with this finding, in controls at E13.5, Pax6⫹RGCs were primarily concentrated in the VZ (Fig. 3C), Tbr2⫹interme- diate progenitors in the SVZ (Fig. 3D), and Tuj1⫹neurons in the nascent cortical plate (Fig. 3E). In contrast, Pax6⫹RGCs and Tbr2⫹intermediate progenitors in the mutants were dispersed throughout the entire developing neocortex (Fig. 3C,D); Tuj1⫹
neurons were distributed irregularly with some of them occupy- ing positions within the VZ and SVZ (Fig. 3E). At E16.5, a simi-
larly abnormal distribution of Pax6⫹ and Tbr2⫹progenitors throughout the entire thickness of the developing neocortex was observed in Afadin-cKO mice (Fig. 3H, I ). In addition, staining
with Tuj1 revealed an abnormally thin cortical plate and accumu- lations of neurons at the surface of the ventricle and below the intermediate zone in which they formed rosette-like structures (Fig. 3J ).
To further ascertain the distribution of Pax6⫹ RGCs and Tbr2⫹ intermediate progenitors, we also performed double- immunofluorescence microscopy (Fig. 4A). The two markers
were still primarily expressed in distinct cell populations, indicat- ing that deletion of afadin did not lead to the generation of a progenitor with a mixed RGC/intermediate progenitor identity. Finally, we anticipated that the gross disruption of the laminar structure of the neocortex would affect the organization of axonal tracts in the mutant mice. Staining with antibodies to TAG1 and L1 revealed massive perturbations in axonal tracts (Fig. 4B). Al-
though these perturbations are likely at least in part a secondary consequence of defects in cell numbers and cell position, we can- not exclude that afadin also plays a more direct role in axonal outgrowth or pathfinding.
4
(Figure legend continued.) floxed promoter-driven neo cassette inserted into an intron of the targeted gene. Engrailed (En2) splice acceptor disrupts gene function, resulting in a lacZ fusion for studying gene expression. Flp recombinase removes the gene trap cassette, converts the “knock-out first” allele to a conditional allele ( flox). Cre recombinase deletes the floxed exon of the conditional allele resulting in a frame shift and null mutation (modified fromRyder et al., 2013). Numbered boxes represent exons. Red box represents the critical exon. PCR primers for