ERWINIA AMYLOVORA-INDUCED CHANGES IN TWO APPLE SPECIES THAT DIFFER IN
SUSCEPTIBILITY TO FIRE BLIGHT
Submitted to Plant and Cell Physiology
ERWINIA AMYLOVORA-INDUCED CHANGES IN HOST PHYSIOLOGY OF TWO APPLE SPECIES THAT DIFFER IN
SUSCEPTIBILITY TO FIRE BLIGHT
RENATA MILČEVIČOVÁ1, CHRISTIAN GOSCH2, HEIDRUN HALBWIRTH2, KARL STICH2, MAGDA-VIOLA HANKE3, ANDREAS PEIL3, HENRYK FLACHOWSKY3, WILFRIED ROZHON4,5, CLAUDIA JONAK5,MOUHSSIN OUFIR6, JEAN FRANCAIS HAUSMAN6, ILDIKÓ MATUŠÍKOVÁ1,7, SILVIA FLUCH1, EVA WILHELM1
1Austrian Research Centers GmbH - ARC, Department of Health/Environment - Biogenetics, A-2444 Seibersdorf, Austria
2Vienna University of Technology, Institute of Chemical Engineering, Getreidemarkt 9, A-1060 Vienna, Austria
3Federal Research Centre for Cultivated Plants – Julius Kuehn Institute, Pillnitzer Platz 3a, D-01326 Dresden, Germany
4Max F. Perutz Laboratories, University of Vienna, Dr. Bohrgasse 9, 1030 Vienna, Austria 5Gregor Mendel Institute of Molecular Plant Biology, Austrian Academy of Sciences, Dr. Bohrgasse 3, 1030 Vienna, Austria
6Public Research Centre-Gabriel Lippmann, EVA Department 41, rue du Brill L- 4422 Belvaux, Luxenburg
7Institute of Plant Genetics and Biotechnology, SAS, Akademicka 2, P.O. BOX 39A, Nitra, 950 07, Slovakia
Corresponding author. Tel.: +43 50550 3596; Fax: +43 50550 3666; E-Mail address: renata.milcevicova@arcs.ac.at
Chapter 1
34 Abstract
Erwinia amylovora (Ea), the causal agent of fire blight, infects most members of the Maloideae including pear and apple. The defense responses of two apple species, of the susceptible Malus domestica Borkh. cv. 'Idared' (later on 'Idared') and the resistant Malus x robusta (Carrière) Rehder var. persicifolia Rehder (Mrp), were monitored after bacterial inoculation. Higher total salicylic acid (SA) levels were detected in all analyzed Mrp plants compared to the sensitive 'Idared'. On the other hand, high accumulation of free and total SA was observed three days post inoculation (dpi) with Ea in 'Idared'. In fire blight infected plants the genes for two isochorismate synthases as well as most of phenylpropanoid genes studied were repressed suggesting that SA and phenylpropanoid synthesis are repressed at gene expression level. However, the activity of the PAL was increased in infected susceptible plants supporting that SA might be synthetized via this enzyme upon Erwinia attack. Analyses showed that bacteria of fire blight do not alter the metabolism of most of carbohydrates tested. Significant change of ononitol content was only observed in infected 'Idared' that might indicate to secondary (drought) stress. Naturally occurring SA levels, contrasting behavior of PAL and F3GT enzymes and of the chi gene in the two apple species might partially be responsible for the susceptible/resistant phenotype.
Keywords: carbohydrates, cyclitols, enzymatic activity, gene expression, Malus, pathogen-related
Introduction
Fire blight is a disease of Maloideae of the family Rosaceae, e.g. apple (Malus spp.), pear (Pyrus spp.), and ornamentals such as Cotoneaster and Pyracantha spp. Infection occurs via natural plant openings such as nectaries in flowers and wounds on leaves or on succulent shoots. The causal bacterium Erwinia amylovora (Ea) multiplies and rapidly spreads through the plant via vascular tissues and can either cause cell dead (tissue necrosis) or can reside in symptomless tissue (Vanneste and Eden-Green, 2000). Erwinia harbors a
pathogenesis mechanism known as the Type III secretion system (Wei et al., 1992; Oh and Beer, 2005) required for both hypersensitive resistance in non-host plants and pathogenicity (Hrp-TTSS). In addition, it carries genes for enzymes involved in the synthesis of capsular exopolysaccharide (EPS) - amylovoran and genes facilitating the growth in host plants. The Hrp secretory operon of Erwinia amylovora is involved intranslocating virulence effector proteins into host cells where it interferes with regulation of many resistance genes following invasion.
Although several of the twelve TTSS secreted proteins identified so far shares homologies with avirulence proteins (Nissinen et al., 2007), no race-cultivar interaction that involves matching of a bacterial avirulence (avr) gene and the corresponding plant resistance (R) gene has been reported in this pathosystem.
After recognition of the bacteria, plants induce a range of defense responses. In primarily infected cells are generated different reactive oxygen molecules, lipid peroxidation is induced and affected are also ion fluxes (Venisse et al., 2001). These changes often lead to hypersensitive response (HR) expressed as necrotic lesions of plant tissue. Adjacent cells surrounding the infection site are associated with localized acquired resistance (LAR) that involves e.g. cell wall reinforcement, accumulation of phytoalexins and activation of different defense proteins such as antioxidant enzymes and pathogenesis-related (PR) proteins (Somssich and Hahlbrock, 1998; van Loon et al., 2006). PR proteins can also be synthesized throughout the plant and lead to systemic acquired resistance (SAR), which represents the third line of defense mediated by salicylic acid (Mauch-Mani and Mètraux, 1998; Venisse et al., 2002). Several authors have reported accumulation of different PR transcrips upon Erwinia amylovora attack (Venisse et al., 2002; Bonasera et al., 2006; Norelli et al., 2009).
Many immune responses in plants to microbial pathogens (e.g. basal resistance and even gene-for-gene resistance) are associated with accumulation of salicylic acid (SA) that functions as a signaling molecule. SA is synthesized in plants either via isochorismate synthase (Wildermuth et al., 2001) or though shikimate-phenylpropanoid pathway. However, Erwinia was shown to delay the expression of phenylpropanoid genes (Venisse et al., 2002) to overcome the plant defense. It is assumed that the phenylpropanoid pathway leads to the synthesis of defense-related compounds such as lignin and flavonoid phytoalexins as well as SA (Dixon et al., 2002) The importance of the key enzyme of this pathway, the
Chapter 1
36
phenylalanine ammonia-lyase (PAL), in disease resistance has been demonstrated e.g. by increased disease susceptibility of tobacco plants in which PAL activity is suppressed (Maher et al., 1994).
In this work we studied the molecular host responses induced by Ea in two apple species that differ in their susceptibility to this pathogen. We focused on changes in contents of salicylic acid and studied the possible ways of its synthesis. Further, changes in the phenylpropanoid pathway were monitored on the both transcriptional and protein level to evaluate its involvement in plant defense against E. amylovora. Levels of different carbohydrates were also analyzed to reveal the effect of fire blight bacteria on sugar metabolite contents.
Materials and methods Plant material
In vitro apple shoot cultures of Malus domestica Borkh. cv. ‘Idared’ (later on 'Idared') and Malus x robusta (Carrière) Rehder var. persicifolia Rehder (Mrp) were micropropagated via shoot tip and nodal cuttings on MS-medium (Murashige and Skoog, 1962) with 6-benzylaminopurine (BAP) and indole-3- butyric acid (IBA) (both 1 mg.l-1). Plants were cultivated in plastic containers with 40 ml media supplemented with 3 % sorbitol and 0.8 % Daishin agar (Duchefa, Netherlands) at a temperature of 18 °C with a 16-hour photoperiod. Plants were transferred to fresh medium one week before start of each experiment.
Inoculation
The Erwinia amylovora strain 295/93 was isolated from Austrian Agency for Health and Food Safety (AGES) and grown overnight in King’s B medium broth at 28 °C in a rotary shaker. Stems above growth media of in vitro plants were inoculated once using a sterile toothpick dipped into the bacterial suspension (108 cfu.ml-1).Control was mock treated with sterile King’s B medium. The experiments include five plants for each time point and were repeated 3 times.
Microshoots were sampled after 6 hours, 1, 2 and 3 days and immediately frozen in liquid nitrogen and stored at –80 °C until analyses.
Growth of bacteria in host tissue quantification via qRT-PCR
For quantification of Ea, inoculated microstems (~9 mm) were cut into three parts of similar sizes and used for detection of present bacteria. Tissue was eluted in 100µl PCR water. Dilutions of 1:10 and 1:50 were subjected to qRT-
PCR analyses. A bacterial culture of measured optical density (OD600 = 0.9;
8.9x109cfu.ml-1) was used for calibration of number of bacterial cells by qPCR.
The experiments comprised three plants for each time point and were repeated 3 times according to (Salm and Geider, 2004).
RNA isolation and cDNA transcription
From three pools of 5 in vitro grown plants each (leaves and stems) the total RNA was isolated according to (Chang et al., 1993). RNA integrity and purity was verified by agarose gel electrophoresis and determination of the A260/A280 absorption ratio which was found to be higher than 1.85. Contaminating DNA was removed from RNA samples using DNA-free kit (Ambion, Austin, TX, USA) according to the manufacturer’s protocol. 5 µg of total RNA were reverse transcribed with Super Script TM II Reverse Transcriptase (Invitrogen) using 0.5 µg oligo dT primer (Invitrogen) in a total volume of 20 µl as recommended by the manufacturer. The cDNAs were diluted 1:5 with nuclease-free water. Aliquots of the same cDNA sample were used for real-time PCR.
Real–time PCR
Real–time PCR was carried out using an iCycler iQTM Multicolor Real- Time Detection System (BIO-RAD). For Light Cycler reactions a master mix of following reaction components was prepared: 0.75 µl forward primer (10 µM), 0.75 µl reverse primer (10 µM), 12.5 µl iQ TM SYBR Green Supermix (BIO- RAD), 10 µl water and 1 µl sample. For transcript analysis a 1:5 diluted cDNA was used. The PCR program started with polymerase activation at 95°C for 3 min followed by 40 cycles of 15 s at 95 °C for denaturation and 45 s at 55 °C for annealing and extension. Primer design and optimization in regard to primer dimer, self priming formation and primer melting temperature was done with the Primer 3 software (Rozen and Skaletsky, 1999). The primers (Table 1) were purchased from MWG Biotech (Ebersberg, Germany).
For quantification of E. amylovora, 1 µl of a 1:10 or 1:50 diluted eluates of infected plants was used (see above). The PCR program started with an initial step at 95°C for 3 min, followed by 40 cycles of 95 °C for 30 s and 60 °C for 45 s. For
Chapter 1
38
samples were measured in triplicates. The products were further analysed with a melting program after an initial denaturation step at 95 °C for 1 min followed by 100 cycles at 95 °C to 50 °C for 10 s each.
Table 1. Primer sequences used for expression analyses in qRT-PCRs.
Gene GeneBank Accession
Forward primer (5´- 3´)
Reverse primer (5´- 3´)
Size (bp)
anr DQ139835 GTTGCAACCCCTGTCAACTT CTTTCACGCACGACTTCAGA 100 ans DQ156905 TGGTGACATCTTCGAACAAGAG CCCTGCATTTTGCTCTCACT 117 chi AF494398 CATCGTTACAGGTCCGTTTG TTTCAATGGCTTTGCCTTCT 152 chs AF494401 AACGAGGCCTTCAAGCCTAT GGGTGTGCAATCCAGAAGAG 108
ics1 CN996953 GCATTAGTCAAAAAGGTAAACCA CGACCGTAGAATCCAGAAGG 114
ics2 CN996091 CGTAAATTCCCTCGAGTCCA TGGAAATCCACAAACTGCTG 120
dfr AF494392 TGCCAAAGAAAACAACATTGA GTGAACATACTGCCCCTGCT 160 f3gt AB 074489 GAAAACATCCGGAGGAGCTT AACTCGTCAGCCAAGTGGAC 110 fht AY691918 TGGAGGAGCCGATGACTTAC AGTTGCTCCTTTGCATGCTT 94 fls AF494389 CATGTCCTCGCCCTGATCT TGACAAGGGCATTAGGGATG 157 pal AF494403 TGACAAATGGCGAGAGTGAG CTCTTCCTCGAAAGCTCCAA 79 pEA29a - CACTGATGGTGCCGTTG CGCCAGGATAGTCGCATA 112 pr-1 A507974 CTTGACGTGGGATGACAATG AGTGCTCATGGCAAGGTTTT 118 Ubqb CX023931 TCTTTGTGAAAACCCTCACC ATCCCTTCCTGGTCCTGGAT 117
a harbours the ESP-encoding region on the bacterial chromosome (Bereswill et al., 1992).
b housekeeping gene used for normalization (Bereswill et al., 1992)
At each sample (plants as well as plant eluates, the cycle numbers at which the fluorescence passed the cycle threshold (Ct) were further analyzed using the
∆∆Ct-method and REST software (Pfaffl et al., 2002). Triplicate samples were analyzed, while for the ratio calculations the mean values were used. Changes were considered at a significance level of P<0.05.
Enzymatic measurements
Enzyme assays were performed according to (Halbwirth et al., 2002).
Pools of five in vitro plants per treatment and repeat were frozen in liquid nitrogen and homogenized. Aliquots (0.5 g) were homogenized in a mortar with 0.25 g quartz sand, 0.25 g Polyclar AT, and 3 ml of 0.1 M Tris/HCl (containing 0.4 % Na-ascorbate, pH 7.25). The homogenate was centrifuged for 10 min at 4 °C and 10000 g. To remove low molecular compounds, 400 µl of the supernatant were passed through a gel chromatography column (Sephadex G25). Protein content was determined by a modified Lowry procedure (Sandermann and Strominger, 1972) using crystalline BSA as a standard. PAL, CHS/CHI, FHT and DFR assays were performed according to Halbwirth et al. (2002). In a final volume of 100 µl the FLS assay contained 0.046 nmol [14C]-dihydrokaempferol (108 Bq), 40 µl enzyme preparation (4.3-8.7 µg total protein), 5 µl 3.48 mM 2-oxoglutarate, 5 µl 2.01 mM FeSO4.7 H2O, and 50 µl buffer 3. The assays were incubated for 30 min at 30 °C and were terminated by addition of 70 µl ethyl acetate, 10 µl of acetic acid and 10 µl of a 0.1 mM EDTA aqueous solution. The organic phases were transferred to a precoated cellulose plate (Merck, Germany). After developing the TLC plates in acetic acid, conversion rates were determined with a LB2842 TLC linear analyzer (Berthold, Wildbad, Germany). In a final volume of 50 µl the F3GT assay contained 2.5 µl [14C]-UDPG (30 nmol, 2300 Bq), 15 nmol quercetin (dissolved in 2.5 µl ethylene glycol monomethyl ether), 25 µl enzyme preparation (15.8-25.4 µg total protein), and 20 µl 0.1 M KPi + 0.4% Na-ascorbate, pH 7.5.
The P2’GT assay contained 2.5 µl [14C]-UDPG (30 nmol, 2300 Bq), 15 nmol phloretin (dissolved in 2.5 µl DMSO), 20 µl enzyme preparation (4.2-8.7 µg total protein), and 25 µl 0.1 M Tris/HCl + 0.4% Na-ascorbate, pH 7.25. The assays were incubated for 30 min at 30 °C and terminated by addition of 10 µl acetic acid and 30 µl methanol. The mixture was chromatographed on Schleicher and Schüll, 2043b paper using 30 % acetic acid (F3GT) and water (P2’GT) as solvent system.
The zones containing the labeled products were cut out and radioactivity was quantified on a Winspectral 1414 scintillation counter (Perkin Elmer, Wien, Austria).
Chapter 1
40 Carbohydrate profiling
Sugars and polyols were extracted from microshoots (0.1 g plant material ground to a fine powder and lyophilized) according to (van Huylenbroeck and Debergh, 1996). Analyses were carried out using high performance anion exchange chromatography coupled with pulsed amperometric detection HPAEC- PAD (Dionex ED 40, Dionex Corp., USA) according to (Wilson et al., 1995).
HPAEC-PAD analyses for carbohydrates were conducted on a Dionex HPLC ICS2500-BioLC (Sunnyvale, CA) with an AS50 autosampler and thermal compartment, a GS50 quaternary gradient pump, an EG50 eluent generator and an ED50 pulsed amperometric detector. The mobile phase was on-line generated KOH at a flow rate of 0.5 ml·min-1. The analytical column was a Dionex Carbopac PA-20 (3 mm x 150 mm) with a PA-20 guard column (3 mm x 50 mm) kept at 30 °C.
HPAEC-PAD analyses for polyols were conducted on Dionex DX-500 chromatograph (Sunnyvale, CA) constituted by a Spark Midas autosampler (Spark Holland B.V., Netherlands), a GP40 gradient pump and an ED40 pulsed amperometric detector. The analytical column was a Dionex Carbopac MA-1 (4 × 250 mm) with a MA-1 guard column (4 × 50 mm). Water and NaOH (500 mM) were used as eluents. The flow rate was 0.3 ml min−1 and the column was kept at 48 ºC.
Carbohydrates and polyols were quantified using calibration curves with standard solutions, ranging from 5 to 100 µmol.l−1 and 10 to 1000 µmol.l-1, respectively.
Salicylic acid
The content of total and free SA was determined according to the method of Rozhon et al. (2005).
Statistical analysis
Three samples of each treatment with three repetitions were statistically analyzed by Student’s t-test with a significance level of P<0.05.
Results
Disease symptoms such as wilting and necrotic tissue was observed in microstems of 'Idared' after 2-3 dpi, while no signs of infection were visible on Mrp plants. Quantification measurements revealed significantly (P<0.0039) higher bacterial growth- and multiplication rates in tissue of 'Idared' (Fig. 1)
compared to Mrp plants. In microscopic observations (data not shown) bacteria were observed in intracellular space of collapsed cells of 'Idared' tissue, in contrast to Mrp plants in that colonization was restricted at given time point to extracellular space.
Figure 1 Extent of bacterial spreading in infected 'Idared' (black lines, triangle) and Mrp (grey lines, square). The amount of the bacterial plasmid pEa29 in plant tissue was quantified by qRT-PCR.
To the end of the experiment the difference observed between the two species was statistically significant at P<0.0039
Carbohydrates
The levels of thirteen saccharides (rhamnose, arabinose, galactose, glucose, sucrose, fructose, stachyose, maltose) and sugar alcohols (sorbitol, inositol, pinitol, manitol, ononitol) were analysed during the time course of infections in microshoots of Mrp and 'Idared'. The carbohydrate levels were generally higher in 'Idared' compared to Mrp plants ( Fig. 2, Apendix Fig. 1).
Figure 2 Levels of some of sugar alcohols in susceptible 'Idared' (black lines, triangle) and resistant Mrp (grey lines, square) after inoculation with E.
amylovora (filled lines) and mock treatment (dashed lines). The concentration of the carbohydrates is indicated in nmol/g per fresh weight (y axis) and the time
Chapter 1
42
post infection in days (x axis). Results were obtained from three biological replicates per treatment. The level of ononitol in Mrp was bellow detection limit.
Although at the end of the experiment (3 days) the levels of several saccharides tended to increase in infected 'Idared' plants, these differences were not significant except for pinitol that accumulated up to 1,28 fold. This suggests that these free cyclitols might be components of the defense mechanism against Erwinia in 'Idared'. In contrast, no bacteria-related change was detected in Mrp plants, while the amount of ononitol was below the detection limit of the method used.
Salicylic acid
In Mrp the levels of total SA (tSA) were five times higher compared to 'Idared' (Fig. 3A). During the time course of infection the content of tSA in microshoots of Mrp remained relatively stable. In contrast, significant accumulation of tSA was observed 3 dpi in 'Idared' indicating SA synthesis.
A higher level of free SA (fSA) was detected in plants of Mrp. High accumulation of fSA (five-fold) was observed in 'Idared' within 3 dpi (Fig. 3B), whereas changes in the resistant Mrp were not significant (P<0.05).
Figure 3 Comparison of total (A) and free (B) salicylic acid levels in tissue of (black lines, triangle - 'Idared', grey lines, square - Mrp) Results from mock- inoculated plants are indicated with dashed lines, those from Erwinia-infected ones with filled lines.
Expression of genes related to SA synthesis
The two known alternative ways for SA synthesis include the conversion of phenylalanine to benzoic acid and the synthesis through isochorismic acid. In the first case, expression of the pal gene was studied encoding a key enzyme for
SA synthesis. In both apple genotypes the expression of this gene decreased upon infection with Erwinia (Fig 4).
To analyze the second path, two genes for apple isochorismate synthase (ics) were studied and quantified for their expression with respect to bacterial infection. The basic levels of the ics1 (accession number CN996953) were different between two apple species (P<10-7) that is in disagreement with the SA levels detected. The second isoform ics2 (CN996091) was of similar level in both 'Idared' and Mrp (Fig. 4). After infection with bacteria, expression of both synthases was significantly (P<0.03) repressed in 'Idared' but not in Mrp plants.
These observations suggest that Erwinia represses the expression of genes leading to de novo synthesis of SA trough both isochorismate synthase as well as phenylammonium lyase in infected plants. The expression levels of the gene for PR1 as potential SA-marker (Uknes et al. 1993) were monitored in apple plants.
In the tissue of the susceptible 'Idared' a significant increase (P<0.05) was observed 3 dpi (Fig. 4) in contrast to resistant plants that coincides with elevated levels of free SA measured in 'Idared' after inoculation with fire blight.
Figure 4 Analyses of transcript levels for pr1, pal, ics1 and ics2 genes encoding for PR1 protein, phenylammonium lyase and two isochorismate synthases, respectively. Quantitative RT-PCR was carried out on samples from mock- and Erwinia-inoculated apple plants from both cultivars at different time points (up to 3 days post infection, dpi). Target gene is up- or down regulated by the factor to mock-inoculated plants (axis y). Black lines connecting triangles - 'Idared', grey
Chapter 1
44
lines connecting squares – Mrp. Significant changes are indicated by asterisks (P<0.005**, P<0.05*).
Expression of genes involved in the phenylpropanoid pathway
Expression levels of selected genes of the phenylpropanoid pathway (Fig.
5) were analyzed in Erwinia- and mock-challenged plants in both apple species using qRT-PCR (Table 1). The results showed that most genes of the phenylpropanoid pathway studied were repressed during infection by Erwinia. We observed significant expression changes of only pal (P<0.006)(Fig. 3) and chs (P<0.008) (Fig. 6) that were both strongly down-regulated in 'Idared' plants at 1 dpi. Similar but less pronounced changes were observed in Mrp plants. The gene for chi revealed up-regulated expression in attacked 'Idared' plants for the whole duration of the experiment, however it was rapidly down-regulated in Mrp already 6 h after infection.
Figure 5 Scheme of the phenylpropanoid pathway part analyzed in this study. The transcript level and activity of the enzymes indicated were measured and compared between the two apple species. phenylalanine ammonia-lyase (PAL), chalcon synthetase (CHS), chalcone isomerase (CHI), flavanon 3-hydraxylase (FHT), flavonol synthase (FLS), dihydroflavonol reductase (DFR), anthocyanidin synthase (ANS), anthocyanidinreduktase (ANR), flavonoid 3-O- glukosyltransferase (F3´GT).