Distribution of
N-
acetyltransferase Type 1 (
NAT1
) genotypes and alleles in a
Turkish Population
Serdal Arslan, Naci Degerli and Fevzi Bardakci
Molecular Biology Research Group, Department of Biology, Faculty of Science and Literature,
Cumhuriyet University, Turkey.
Abstract
NAT1 is an intronless gene on chromosome 8p21.3 encoding a 290-amino-acid-long protein showing acetyltransferase activity. Some 26 alleles ofNAT1 gene have been identified in human populations. In the present study we determined the distributions ofNAT1 genotypes and alleles in a sample of 201 individuals from the Turkish population in Central Anatolia. The most frequent genotypes wereNAT1*4/NAT1*4 (51.74%), NAT1*10/NAT1*4 (22.39%),NAT1*11/NAT1*4 (7.46), NAT1*10/NAT1*10 (3.98%). Frequencies of NAT1*3, *4 (wild-type), *10 and *11 alleles were 3.73%, 69.6%, 17.66% and 7.2%, respectively. The frequency ofNAT1*11 was the highest amongst the populations studied so far, the other allele frequencies being close to those described in Caucasian populations. Key words: NAT1 gene, genetic polymorphism, molecular epidemiology, Turkish population.
Received: July 4, 2003; Accepted: December 16, 2003.
NAT1 and NAT2 are isoenzymes that catalyze the
N-acetylation of aromatic amine and hydrazine drugs.
While substrates of NAT2 enzyme are isoniazid, sulfa-methazine, 2-aminofluorene and 4-aminobiphenyl, NAT1 enzyme has para-aminosalicylic acid (PAS), para-amino-benzoic acid (PABA) and sulfanilamide as substrates (Deguchi et al., 1990; Grant et al., 1992).
The polymorphism of NAT1 gene was first described about a decade ago (Vatsis and Weber, 1993), and 26 al-leles have been identified in human populations (Hein et
al., 2000), NAT1*3, NAT1*4, NAT1*5, NAT1*10 and NAT1*11 being the most common alleles reported. A single
mutation or a combination of multiple nucleotide substitu-tions and insersubstitu-tions/delesubstitu-tions are responsible for the allelic variants of NAT1. While some variants (NAT1*11, *20 and
*23) do not lead to differences in activity (Hughes et al.,
1998; Lin et al., 1998), others result in increase (e.g.
NAT1*21, NAT1*24 and NAT1*25) (Lin et al., 1998),
de-crease or absence of activity (NAT1*14, *15, *17, *19 and
*22) (Hughes et al., 1998; Lin et al., 1998; Butcher et al.,
1998) with respect to the enzyme encoded by the wild-type allele (NAT1*4). In a German population, Bruhn et al. (1999) found that enzyme activity in carriers of NAT1*3, *4 and *10 did not differ. On the other hand, NAT1*11 and *14 appeared to be low-activity alleles while NAT1*15 was a null allele. In contrast, recent data suggest that the enzyme encoded by NAT1*11 allele exhibits higher NAT1 activity
relative to the product of the wild-type NAT1*4 allele (re-viewed in Zheng et al. 1999; de Leon et al. 2000; Loktionov
et al. 2002).
Much emphasis has been given to NAT1*10 allele, because a change in the consensus polyadenilation signal was suggested to be correlated with higher enzyme activity in colon, bladder and liver tissues (Bell, et al., 1995a; Zenser et al., 1996). Several studies have also demonstrated an association between NAT1*10 allele and colon, gastric, urinary bladder, laryngeal and head tumors as well as the development of environmental borne diseases (Bell et al., 1995a,b; Taylor et al., 1995; Katoh et al., 2000).
In this study we determined the distribution of NAT1 genotypes and alleles in a Turkish population sample using restriction fragment length polymorphism (RFLP) and sin-gle-strand conformation polymorphism (SSCP) assays.
Subjects: Venous blood was taken from 201
ran-domly selected non-cancer volunteers (116 females and 85 males) attending the Cumhuriyet University Hospital, Si-vas (Central Anatolia, Turkey) as outpatients, between Jan-uary and FebrJan-uary 2002. The mean ages of male and female individuals were 44.22 ± 14.80 (16-76) and 42.03 ± 13.96 (17-86) years, respectively. The study was carried out after approval of the hospital ethical committee.
PCR-SSCP analysis of the NAT1 gene: A 1216 bp
long fragment of the NAT1 gene, consisting of the 870 bp intronless coding region, the 278 bp 3’UTR and the 68 bp 5’UTR, was amplified by PCR of genomic DNA obtained from peripheral blood leukocytes. PCR was accomplished in a total of 25 µL volume containing 0.2 mM each primer Genetics and Molecular Biology, 27, 2, 162-164 (2004)
Copyright by the Brazilian Society of Genetics. Printed in Brazil www.sbg.org.br
Send correspondence to Assoc. Prof. Dr. Fevzi Bardakci. Cumhuri-yet University, Faculty of Science and Literature, Department of Bi-ology, 58140 Sivas, Turkey. E-mail: [email protected].
(sense 5’TAAAAGTAAAATGATTTTGCTTTCG3’ and
anti-sense 5’GCTTTCTAGCATAAATCACCAA3’),
75 mM Tris-HCI (pH 8.8 at 25 °C), 20 mM (NH4)2SO4,
0.01% Tween 20 and 1.5 mM MgCl2, 0.2 mM each dNTP
(MBI Fermentas), 0.6 units Taq DNA polymerase (MBI Fermentas) and 250 ng genomic DNA. The mixture was subjected to 2 min initial denaturation at 94 °C followed by 32 cycles of 1 min at 94 °C, 1 min at 61 °C and 1.5 min at 72 °C with a 5 min-extension step at 72 °C, in a thermal cycler (Techne, UK). The SSCP protocol described by Lo-Guidice et al. (2000) was followed, with some modifi-cations. PCR products were digested by TfiI (New England Biolabs, Beverly, MA, USA). Electrophoresis was per-formed on an 8% non-denaturing polyacrylamide gel, and the patterns analyzed after silver staining.
PCR-RFLP Analysis of the NAT1 gene: A
RFLP-assay was used to confirm the presence of NAT1*11 alleles, allowing to distinguish a T (NAT1*4) from a G (NAT1*11) at the nucleotide 640, as described by Lo-Guidice et al. (2000). The PCR products were digested with AlwNI (Fer-mentas). This enzyme cleaves NAT1*11 into three frag-ments (241, 451 and 496 bp), but other alleles into two fragments (451 and 746 bp). Therefore, restriction diges-tion produces three fragments (241, 451 and 496 bp) for
NAT1*11/NAT1*11 genotype, and four fragments (241,
451, 496 bp and 746 bp) for NAT1*11/any other allele ge-notypes.
The NAT1 genotype distribution of the 201 individu-als from the Turkish population is shown in Table 1. The ten most frequent described genotypes, as well as eight rare genotypes involving alleles not identifiable by SSCP analy-sis (NAT1*4/others) were found. NAT1*4/NAT1*4 (53.89%), NAT1*4/NAT1*10 (22.39%) and NAT1*4/
NAT1*11 (7.46%) were the most common ones. The
fre-quencies of the different alleles are shown in Table 2. The wild-type allele NAT1*4 had a frequency of 69.65%. The frequencies of NAT1*10, *11, *3 and of the non-identi-fiable alleles were 17.41%, 7.21%, 3.73% and 2%, respec-tively.
The frequencies of NAT1*3, NAT1*4 and NAT1*10 alleles observed were close to those found in German
(Henning et al., 1999), Canadian (Hughes et al., 1998), and
French (Lo-Guidice et al., 2000) populations. A striking difference in the Turkish population was the highest
NAT1*11 frequency (7.2%). Although this allele was not
found in the French population (Lo-Guidice et al., 2000), it has been reported with a lower frequency in German (2.7% by Henning et al., 1999 and 3.34% by Bruhn et al. 1999) and in Canadian (2.1% by Hughes et al., 1998) populations. These populations differ from the Japanese who present the
NAT1*10 allele as the most frequent, and among whom NAT1*3 and *11 alleles were never found (Yang et al.,
2000). In Indian, Malay and Chinese populations, Zhao et
al. (1998) reported a much higher NAT1*10 and NAT1*3
allele frequencies than those found in Caucasians.
A small departure (significant at the 5% level) from Hardy-Weinberg genotype proportions was observed (chi-squared = 12.31; d.f. = 4; p = 0.015). Only the defi-ciency of NAT1*3/NAT1*4 heterozygotes seems to contrib-ute significantly to the obtained chi-squared figure. Both the sample size and its heterogeneous ethnic composition are the best explanation for this finding.
Yang et al. (2000) reported a higher activity of the en-zyme encoded by NAT1*10 allele in a Japanese population, with NAT1*4/NAT1*10 female heterozygotes having higher enzyme activity than NAT1*4/NAT1*4 females. Wikman et al., (2001) considered individuals with
NAT1*10 allele as rapid acetylators unless when combined
with a slow allele. In contrast, Bruhn et al. (1999) did not detect increased enzyme activities in association with
NAT1*4/*4, NAT1*4/*10 and NAT1*10/*10 genotypes in a
German population. Jourenkova-Mironova et al. (1999) have also found low frequencies of NAT1 homozygous rapid acetylator genotypes (NAT1*10/*11 and NAT1*10/
*10). Associations between the NAT1*10 allele and a high
enzyme activity with oral (Katoh et al., 1998), colon (Bell
et al., 1995b), urinary bladder (Taylor et al., 1995), head
and neck (Olshan et al., 2000) and gastric (Katoh et al.,
Arslan et al. 163
Table 1 - Distribution of observed and expected numbers of NAT1 genotypes in a sample from the Turkish population.
Genotypes Number of individuals Observed Expected NAT1*3/NAT1*3 NAT1*3/NAT1*4 NAT1*4/ NAT1*4 NAT1*10/ NAT1*3 NAT1*10/NAT1*4 NAT1*10/NAT1*10 NAT1*11/NAT1*3 NAT1*11/NAT1*4 NAT1*11/NAT1*10 NAT1*11/NAT1*11 NAT1*4/other NAT1*3/other NAT1*10/other NAT1*11/other 2 4 104 5 45 8 2 15 4 4 8 0 0 0 0.262 10.474 97.407 2.619 48.878 6.022 1.085 20.250 5.062 1.013 5.586 0.299 1.397 0.579
Table 2 - Frequencies of NAT1 alleles in a sample from the Turkish population.
Alleles Mutations N. of alleles (%)
NAT1*3 1095C > A 15 (3.73) NAT1*4 Wild-type 279 (69.65) NAT1*10 1088T > A, 1095C > A 71 (17.41) NAT1*11 -344C > T, -40A > T, 445G > A, 459G > A, 640T > G, 1095C > A, 1065-1090del 29 (7.21) Others 8 (1.99)
2000) cancers have been described. In addition, linkage disequilibrium between NAT1*10 and NAT2 alleles has been reported in a German population, with half of the
NAT1*10 alleles being linked to mutant NAT2 alleles
(Henning et al., 1999). NAT1*11 allele, with the highest frequency reported thus far in the Turkish population, has been considered as a putative rapid allele in Caucasians and Black South Africans (Zheng et al. 1999; Loktionov et al. 2002). A possibility deserving investigation is of an associ-ation between NAT1*11 allele and certain cancers as shown for NAT1*10, another rapid acetylator.
Acknowledgments
This work was supported by grants from the Scien-tific Research Fund of Cumhuriyet University, Sivas to Fevzi Bardakci (Grant n. F-122).
References
Bell DA, Badawi AF, Lang NP, Ilett KF, Kadlubar FF and Hir-vonen A (1995a) Polymorphism in the N- acetyltransferase 1 (NAT1) polyadenilation signal: association of NAT1* 10 allele with higher N-acetylation activity in bladder and colon tissue. Cancer Res 55:5226-5229.
Bell DA, Stephens EA, Castranio T, Umbach DM, Watson M, Deakin M, Elder J, Hendrickse C, Duncan H and Strange RC (1995b) Polyadenylation polymorphism in the acetyltrans-ferase 1 gene (NAT1) increases risk for colorectal cancer. Cancer Res 55:3537-3542.
Bruhn C, Brockmöller J, Cascorbi I, Roots I and Borchert HH (1999) Correlation between genotype and phenotype of the human arylamine N-Acetyltransferase Type 1 (NAT1). Biochem Pharmacol 58:1759-1764.
Butcher NJ, Ilett KF and Minchin RF (1998) Functional polymor-phism of the human arylamine N-acetyltransferase type 1 gene caused by C190T and G560A mutations. Pharmaco-genetics 8:67-72.
Deguchi T, Mashimo M and Suzuki T (1990) Correlation between acetylator phenotypes and genotypes of polymorphic aryla-mine N-acetyltransferase in human liver. J Biol Chem 265:12757-12760.
de Leon JH, Vatsis KP and Weber WW (2000) Characterization of naturally occurring and recombinant human N-acetyl-transferase-1 gene variants encoded by NAT1*. Mol Phar-macol 58:288-299.
Grant DM, Vohra P, Avis Y and Ima A (1992) Detection of a new polymorphism of human arylamine N-acetyltransferase NAT1 using p-aminosalicylic acid as an in vivo probe. J Ba-sic Clin Physiol Pharmacol 3(suppl.):244.
Hein DW, Grant DM and Sim E (2000) Update on consensus arylamine N-acetyltransferase gene nomenclature. Pharma-cogenetics 10:291-292.
Henning S, Cascorbi I, Münchow B, Jahnke V and Roots I (1999) Association of arylamine N-acetyltransferases NAT1 and NAT2 genotypes to laryngeal cancer risk. Pharmacogenetics 9:103-111.
Hughes NC, Janezic SA, MacQuen KL, Jewett MAS, Castranio T, Bell DA and Grand DM (1998) Identification and character-ization of variant alleles of human N-acetyltransferase NAT1 with defective function using p-aminosalicylate as in-vivo and in-vitro probe. Pharmacogenetics 8:55-66.
Jourenkova-Mironova N, Wikman H, Bouchardy C, Mitrunen K, Dayer P, Benhamous S and Hyrvonen A (1999) Role of arylamine N-acetyltransferase 1 and 2 (NAT1 and NAT2) ge-notypes in susceptibility to oral/pharyngeal and laryngeal cancers. Pharmacogenetics 9:533-537.
Katoh T, Boissy R, Nagata N, Kitagawa K, Kuroda Y, Itoh H, Kawamoto T and Bell DA (2000) Inherited polymorphism in the N-actyltransferase 1 (NAT1) and 2 (NAT2) genes and susceptibility to gastric and colorectal adenocarcinoma. Int J Cancer 85:46-49.
Katoh T, Kaneko S, Boissy R, Watson M, Ikemura K and Bell DA (1998) A pilot study testing the association between N-acetyltransferases 1 and 2 and risk of oral squamous cell car-cinoma in Japanese people. Carcinogenesis 19:1803-1807. Lin HJ, Probst-Hensch NM, Hughes NC, Sakamato GT, Louie
AD, Kau IH, Lin BK, Lee DB, Lin J, Frankl HD, Lee ER, Hardy S, Grant DM and Haile RW (1998) Variants of N-acetyltransferase NAT1 and a case-control study of cole-rectal adenomas. Pharmacogenetics 8:269-281.
Lo-Guidice J-M, Allorge D, Chevalier D, Herve D, Fazio F, Lafitte JJ and Broly F (2000) Molecular analysis of the N-acetyltransferase 1 (NAT1) using polymerase chain reac-tion-restriction-fragment single strand conformation poly-morphism assay. Pharmacogenetics 10:293-300.
Loktionov A, Moore W, Spencer SP, Vorster H, Nell T, O’Neill IK, Bringham SA and Cummings JH (2002) Differences in N-acetylation genotypes between Caucasians and Black South Africans: implications for cancer prevention. Cancer Detect Prev 26:15-22.
Olshan AF, Wiessler M, Watson MA and Bell DA (2000) GSTM1, GSTT1, GSTP1, CYP1A1, and NAT1 polymor-phism tabacco use, and the risk of head neck cancer. Cancer Epidemiol Biomarkers Prev 9:185-191.
Taylor JA, Umbach D, Stephan E, Paulson D, Robertson C, Mohler JL and Bell DA (1995) Role of the N-acetylation polymorphism at NAT1 and NAT2 in smoking-associated bladder cancer. Proc Am Assoc Cancer Res 36:282. Vatsis KP and Weber WW (1993) Structural heterogeneity of
Caucasian N-acetyltransferase at the NAT1 gene locus. Arch Biochem Biophys 301:71-76.
Wikman H, Thiel S, Jäger B, Schmezer P, Spiegelhalder B, Edler L, Dienemann H, Kayser K, Schulz V, Drings P, Bartsch H and Risch A (2001) Relevance of N-acetyltransferase 1 and 2 (NAT1, NAT2) genetic polymorphisms in non small cell lung cancer susceptibility. Pharmacogenetics 11:157-168. Yang M, Katoh T, Delongchamp R, Ozowa S, Kohshi K and
Kawamoto T (2000) Relationship between NAT1 genotype and phenotype in a Japanese population. Pharmacogenetics 10:225-232.
Zenser TV, Lakshmi VM, Rustan TD, Doll MA, Deitz AC, Davis BB and Hein DW (1996) Human N-acetylation of benzi-dine: role of NAT1 and NAT2. Cancer Res 56: 3941-3947. Zhao B, Lee EJ, Yeoh PN and Gong NH (1998) Detection of
mu-tations and polymorphism of N-acetyltransferase 1 gene in Indian, Malay and Chinese populations. Pharmacogenetics 8:299-304.
Zheng W, Dietz A, Chambell D, Wen W-Q, Cerhan J, Sellers T, Folsom A and Hein DW (1999) N-Acetyltransferase 1 ge-netic polymorphism, cigarette smoking, well-done meat in-take, and breast cancer risk. Cancer Epidemiol Biomarkers Prev 8:233-239.
Editor Associado: Francisco Mauro Salzano