• Nenhum resultado encontrado

UNIVERSIDADE LUTERANA DO BRASIL

N/A
N/A
Protected

Academic year: 2021

Share "UNIVERSIDADE LUTERANA DO BRASIL"

Copied!
50
0
0

Texto

(1)

UNIVERSIDADE LUTERANA DO BRASIL

PROGRAMA DE PÓS-GRADUAÇÃO EM GENÉTICA E TOXICOLOGIA APLICADA

ANÁLISE DA PREVALÊNCIA DA DOENÇA DO RIM POLICÍSTICO (PKD) EM

FELINOS DA RAÇA PERSA E ASSEMELHADOS NO SUL DO BRASIL

Dissertação para obtenção do Título de

Mestre em Genética e Toxicologia Aplicada

Márcio Aurélio da Costa Teixeira

Orientador: Dr. Daniel Thompsen Passos

CANOAS

2007

(2)

Livros Grátis

http://www.livrosgratis.com.br

(3)

AGRADECIMENTOS

Aos proprietários que forneceram seus animais para que fosse possível realizar este trabalho.

Aos colegas do Laboratório de Biotecnologia, do Hospital Veterinário da ULBRA, principalmente ao Diego e Fábio, que foram fundamentais para a execução deste projeto.

Agradecimento à Drª Tania de Azevedo Weimer, pela colaboração na análise estatística e todo o apoio técnico oferecido.

Ao Prof. Dr. Daniel Thompsen Passos, meu orientador, que viabilizou este trabalho. Obrigado.

(4)

SUMÁRIO

1. Introdução...10

1.1 Base Genética da PKD...12

1.2 Possível Mecanismo de Formação do Cisto...15

1.3 Diagnóstico da PKD no Gato...16 1.3.1 Diagnóstico Ultra-Sonográfico...17 1.3.2 Diagnóstico Molecular...20 2. Justificativa e Objetivos...22 3. Materiais e Métodos...26 3.1 Amostras ...26 3.2 Exame Ultra-Sonográfico...26 3.3 Extração de DNA...27 3.4 Amplificação do Fragmento...27 3.5 Análise dos RFLPs...28 3.6 Análise Estatística...28 4. Resultados e Discussão...30 4.1 Análise Ultra-Sonográfica...30 4.2 Análise Molecular...33

4.3 Análise Comparativa entre PCR-RFLP e U.S...34

5. Conclusões...40

6. Referências Bibliográficas...41

(5)

LISTA DE ABREVIATURAS

ADPKD – Autosomal Dominante Policystic Kidney Disease (Doença Renal Policística Autossômica Dominante)

EDTA – Ácido Etilenodiaminotetracético kD - Quilodaltons

Kpb - Mil Pares de Bases Pb - Pares de Bases

PCR - Reação em Cadeia de Polimerase

PKD - Policistic Kidney Disease (Doença do Rim Policístico) SNP - Polimorfismo de Um Único Nucleotídeo

RFLP - Polimorfismo de Tamanho de Fragmentos de Restrição U.S. - Ultra-Som

(6)

LISTA DE FIGURAS

Figura 1 -Representação esquemática das proteínas policistina 1 e 2...14

Figura 2 -Ilustração da cistogênese...15

Figura 3 -Fotografia ilustrativa de Raio-X abdominal demonstrando renomegalia...17

Figura 4 -Fotografia ilustrativa de Ultra-Sonografia de rim normal...18

Figura 5 -Fotografia ilustrativa de Ultra-Sonografia demonstrando cisto na cortical renal..18

Figura 6 -Fotografia de Ultra-Sonografia demonstrando destruição do parênquima renal..19

Figura 7 -Representação da seqüência do éxon 29 do gene da PKD1...27

Figura 8 -Fotografia do experimento demonstrando múltiplos cistos...31

Figura 9 -Fotografia do experimento demonstrando formação cística única...31

Figura 10 -Fotografia de Ultra-Som do parênquima renal alterado...31

Figura 11 -Eletroforese em gel de poliacrilamida, identificando os produtos da amplificação e clivagem pela PCR – RFLP...33

(7)

LISTA DE TABELAS

Tabela 1 -Resultado dos exames Ultra-Sonográficos...30 Tabela 2 -Freqüência de heterozigotos para PKD, distribuídos por sexo e freqüência

alélica...34 Tabela 3 - Resultados comparativos entre o U.S. e a PCR...35

(8)

RESUMO

A doença do rim policístico (PKD) é uma anomalia renal progressiva que causa insuficiência renal crônica, devido à compressão parenquimal e à nefrite intersticial, sendo considerada uma importante causa de insuficiência renal nos gatos. A PKD, também conhecida como ADPKD (doença renal policística autossômica dominante), é a doença genética mais prevalente em gatos Persas e seus derivados e é caracterizada pelo desenvolvimento de cistos renais, com substituição de porções significativas do parênquima renal por múltiplos cistos. Até recentemente, o único método prático, não invasivo e disponível para o diagnóstico era a ultra-sonografia (U.S.). Com a identificação da mutação genética responsável pela ADPKD, é agora possível o uso de técnicas moleculares para o diagnóstico da doença. No Brasil, exames realizados utilizando U.S. detectaram uma taxa de prevalência semelhante à encontrada em outros países, porém os dados são escassos. Este trabalho avaliou a prevalência da PKD e comparou os resultados com aqueles obtidos através de ultra-sonografia renal, em uma amostra de gatos Persa do Sul do Brasil. Um total de 116 animais, com idades e sexos distintos, foram examinados através de imagem ultra-sonográfica e teste molecular (PCR-RFLP). Os resultados indicaram uma prevalência de 26% de indivíduos portadores da mutação, valor um pouco mais baixo que os índices de outros países, situados entre 30% e 40%. Nenhum homozigoto foi observado, embora dois fossem esperados de acordo com a freqüência alélica observada (0,13), o que confirma a hipótese de que homozigotos para PKD seriam letais embrionários. Somente 50% dos portadores da mutação foram diagnosticados através do U.S., o que salienta a ocorrência de falsos negativos. Vinte e dois por cento dos animais apresentaram alterações inconclusivas na análise por U.S., 23% dos quais foram heterozigotos para a mutação. Adicionalmente, 5% dos animais com resultado positivo por U.S. não apresentaram a mutação PKD, indicando a ocorrência de outras causas para o cisto renal. O diagnóstico molecular possibilitou a estimativa da prevalência real da PKD em gatos Persas, permitiu o diagnóstico precoce da PKD e a elaboração de um programa de seleção da raça para a eliminação da mutação genética responsável pela doença.

(9)

ABSTRACT

Polycystic kidney disease (PKD) is a progressive renal disorder that causes chronic renal failure, due to the compression of adjacent parenchyma and interstitial nephritis, being considered an important cause of renal failure in cats. PKD, also known as autosomal dominant polycystic kidney disease (ADPKD), is the most prevalent inherited disease of cats, particularly affecting Persians and its relatives. It is characterized by the development of renal cysts and displacement of significant portions of renal parenchyma by multiple cysts. Until recently, the disease has been diagnosed only by renal ultrasonography (U.S.), the only practical and non-invasive method available. With the identification of the genetic mutation responsible for PKD it is now possible to use molecular techniques to screen for the disease. In Brazil, the estimated prevalence by U.S. seems to be similar to that of other countries, but the data are scarce. This work was performed to establish the prevalence of PKD in a sample of Persian cats and its relatives, from South Brazil. A total of 116 cats, from different ages and sexes were examined through U.S. image and a molecular method (PCR-RFLP). Twenty six percent of the animals were heterozygous for the PKD mutation, values somewhat low in comparison with the data of other countries (30% to 40%). No homozygous was verified, although two were expected according to the observed PKD allele frequency (0.13), confirming the hypothesis that PKD homozygous would be lethal in the embryonic phase. Only 50% of the PKD heterozygous were identified through by U.S., indicating the occurrence of untrue negative results. Twenty two percent of the animals had unconcluded results through U.S., 23% of them being heterozygous for PKD mutation. Additionally, 5% of the animals with positive U.S. results did not present the mutation, indicating the occurrence of other reasons for the renal cysts. The molecular method allows obtaining the real prevalence of PKD in Persian cats from South Brazil, performing the early diagnosis of the susceptible animals as well as developing a breed improvement program to eliminate the disease in this cat population.

(10)
(11)

1. INTRODUÇÃO

Nos últimos anos assistimos a um aumento progressivo na população de gatos domésticos, relacionado com a verticalidade das cidades, bem como com a mudança no estilo de vida das populações humanas. O gato, por ser um animal de menor porte e de maior independência, tornou-se mais adequado às necessidades de certos grupos sociais. Dentre as raças que mais ganharam espaço no Brasil, destacam-se persas, himalaios, híbridos de persa e siameses.

A doença do rim policístico (Polycystic Kidney Disease - PKD) é uma doença progressiva que causa insuficiência renal crônica, devido à compressão parenquimal e à nefrite intersticial sendo considerada uma importante patologia nos gatos (GONZALEZ e FROES, 2003; FERRANTE, 2004; RAH et al. 2006).

A PKD, também conhecida como ADPKD (Doença Renal Policística Autossômica Dominante), é uma doença hereditária dos gatos persas e raças aparentadas (PODDEL et al., 1992; MILLER et al., 1999; BILLER, 2003). É uma doença autossômica dominante, caracterizada pela substituição de porções significativas do parênquima renal por múltiplos cistos (LULICH et al., 1994; CARAKUSCHANSKY, 2001; FISCHER, 2004).

Esta enfermidade é muito semelhante a ADPKD que acomete os humanos, sendo o gato um ótimo modelo experimental (GONZALEZ e FROES, 2003). Tanto a PKD humana quanto a felina normalmente são acompanhadas de falha renal em idades tardias e apresentam intensa variação no curso clínico da doença (BILLER et al., 1996; IGARASHI e SOMLO, 2002; MCMILLAN et al., 2004).

Para LULICH et al. (1994), oito entre 10 gatos com rins policísticos bilaterais, avaliados nas Universidades de Minessota e Carolina do Sul (EUA), apresentavam pêlo longo, o que sugere uma tendência genética nesta raça. HARKIN et al. (2003) complementaram que essa classificação foi feita com base em estudos de nascimentos de afetados e análises de pedigree.

BECK e LAVELLE (1999) realizaram um estudo de prevalência da PKD na Universidade de Melbourne (EUA), obtendo como resultado uma prevalência de 45% nos gatos persas e 50% nos gatos exóticos. A prevalência encontrada nos Estados Unidos (EUA) no ano de 2001 foi de 45% para persas e 42% para exóticos (raça semelhante a

(12)

persa). Em 2003, a França revelou um índice de 41,8% para persas e 39,1% para exóticos (BARTHEZ et al., 2003).

No Brasil, parece haver uma prevalência semelhante à encontrada em outros países, porém os dados são escassos. Sobre o assunto, ALVES et al. (2006) realizaram um estudo de prevalência de PKD, através de avaliação ecográfica em gatis de Porto Alegre-RS, obtendo como resultado uma prevalência de 44,6% de animais afetados. Para BILLER (2003) e CHEW et al. (2004) não se trata de uma doença nova, pois tem sido relatada, esporadicamente, há cerca de 30 anos.

Nos últimos 10 anos, foi caracterizada como uma doença hereditária, irreversível e de progressão lenta, ocorrendo uma alta incidência de gatos assintomáticos (FERRANTE, 2004).

O tamanho dos cistos pode variar desde um milímetro até mais de um centímetro (FIGUEIREDO et al., 1998; NORSWOTHY, 2004). Embora esses autores afirmem que os cistos possam formar-se em decorrência de obstrução extra ou intra-luminal dos túbulos renais, a principal causa é de origem genética (FOWLER, et al., 2000).

O desenvolvimento e o crescimento de estruturas císticas em ambos os rins e, freqüentemente, no fígado são características da PKD (GONZALEZ e FROES, 2003). EATON et al. (1997) citam ainda que os cistos podem aparecer também no pâncreas e segundo GREEN (1996), a ocorrência concomitante no fígado foi relatada em gatos.

Os cistos múltiplos estão presentes bilateralmente, após o nascimento e aumentam lentamente de tamanho ao longo da vida, causando hipertrofia, o que leva a uma redução progressiva do parênquima renal (BILLER, 2003). Para FISCHER (2004), a doença é progressiva e na maioria dos gatos, a compressão parenquimal e a conseqüente nefrite intersticial resultam em insuficiência renal.

BILLER (2003) afirmou que em razão da evolução lenta da doença, nem todos os gatos que sofrem de PKD irão desenvolver a sintomatologia clínica. O ritmo de crescimento dos cistos renais é muito variável, variando de tamanho de um rim para o outro em um mesmo gato, entre os pais e os descendentes atingidos e entre as linhagens genéticas. Gatos afetados apresentam-se clinicamente normais por quase toda a vida e a falha renal ocorre tardiamente, acima dos sete anos de idade (EATON et al., 1997).

Segundo FIGUEIREDO et al. (1998), fatores ambientais podem estar envolvidos com infecções renais como medicamentos e substâncias químicas que favorecem a

(13)

hipertrofia e hiperplasia do epitélio tubular, promovendo obstrução e dilatações císticas. Cistos renais podem, assim, se desenvolver em pacientes que não carregam o gene para PKD.

Vários agentes (drogas, endotoxinas e hormônios) têm sido associados com o desenvolvimento de cistos renais em animais (ROSS et al.,1982; LULICH et al., 1994). Segundo LULICH et al. (1995), a ingestão de drogas como difeniltiazole, ácido nordihidroguaiarético, difenilamina e corticosteróides causam formação de cistos em rins normais. Cistos renais adquiridos têm sido identificados em cães e gatos com displasia renal, neoplasias, infecções e nefrite túbulo-intersticial (LULICH et al., 1995). Para GREEN (1996) a formação dos cistos pode se dar secundariamente à inflamação ou obstrução dos túbulos renais, que resulta em cistos cheios de urina. Os cistos congênitos, podem surgir de qualquer parte do néfron, são muito variáveis em número e, inicialmente, muito pequenos, mas tendem a crescer em tamanho com a idade (CANNON et al., 2001).

Segundo GONZALEZ e FROES (2003), o fluido acumulado no interior do cisto é derivado da filtração glomerular e/ou da secreção de fluidos dos eletrólitos a partir das células epiteliais da membrana dos cistos. Além disso, a redução da concentração da glicose no fluido cístico comparada ao soro é compatível com a reabsorção tubular de glicose; e a alta taxa da creatinina no fluido cístico comparado ao soro é compatível com a modificação tubular do filtrado glomerular.

1.1 Base Genética da PKD

A PKD é a doença genética mais prevalente em gatos. Até recentemente, o único método prático, não invasivo e disponível para o diagnóstico era a ultra-sonografia. Em 2004, a mutação genética responsável pela PKD foi identificada em um grupo de gatos persa nos Estados Unidos. Com a base genética elucidada, tornou-se possível o diagnóstico através de métodos moleculares, tais como a Reação em Cadeia da Polimerase (PCR), PCR em tempo real (Real-Time PCR) e PCR-RFLP (Polimorfismo de Tamanho de Fragmentos de Restrição) (HELPS et al., 2007).

A mutação no gene PKD1, localizado no cromossomo E3 de gatos, é polimorfismo de um único nucleotídeo (SNP), devido à transversão de uma citosina por uma adenosina (C/A). Esta alteração ocorre no éxon 29 do gene PKD1, causando uma anormalidade na

(14)

tradução da proteína com a troca do aminoácido cisteína (UGC), para um códon de terminação (UGA), tornando a proteína truncada a aproximadamente 33% do seu término. (MURPHY, 2000; IGARASHI e SOMLO, 2002; LYONS et al., 2004; HELPS et al., 2007).

A mutação é identificada em estado de heterozigose em todos os gatos afetados analisados e nenhum homozigoto foi identificado, sugerindo que a mutação em homozigose seja letal na fase embrionária (LYONS et al., 2004; HELPS et al., 2007).

Em humanos, esta desordem apresenta uma freqüência de 1 entre 1000 indivíduos; 85% dos casos da mutação humana ocorrem no gene PKD1, localizado no cromossomo 16 e 15% são causados por mutação no gene PKD2, localizado no cromossomo 4, responsáveis por glicoproteínas de membrana chamadas policistina 1 e policistina 2, respectivamente (TORRES e HARRIS, 2007).

As informações sobre estrutura e funcionamento dos genes PKD1 e PKD2, referem-se a humanos, pois estes dados não estão disponíveis em felinos.

A policistina está envolvida em vários processos biológicos, como fertilização e translocação de íons. Ela está localizada em vários tecidos, incluindo os rins, cérebro, ossos e músculos. No rim, está localizada na membrana plasmática da célula epitelial tubular, especialmente no néfron distal e ductos coletores (IGARASHI e SOMLO, 2002).

Estes autores, ainda descrevem que o gene PKD1 humano (responsável pela policistina 1) é muito grande, e consiste de 46 éxons distribuídos em mais de 52 Kpb do DNA genômico. O gene codifica um RNAm de 14,1 kpb, que é traduzido em uma proteína composta de 4302 aminoácidos e peso molecular de 500 kD. De forma interessante, a região do gene que se estende do éxon 1 até o éxon 33 é duplicado em seis outros locais no cromossomo 16p.

O gene PKD1 fica próximo de outro gene que também está relacionado com lesões de esclerose nos túbulos renais o TSC 2, que produz sintomas semelhantes quando comparados com a doença do rim policístico. Mutações concomitantes no gene TSC2 e PKD1, também apresentarão como conseqüência a formação do rim policístico.

A explicação molecular para este fenômeno, está no fato de que o produto do gene TSC 2 (tuberina) é um importante co-fator para a translocação da policistina 1 do aparelho de Golgi para a membrana plasmática (GALLAGHER et al., 2002).

A policistina 1 apresenta três porções ou domínios: um extracelular com terminação amino (NH2) ligado a outros aminoácidos e imunoglobulinas, que provavelmente

(15)

funcionam como receptor para algum ligante; outra porção transmembrana e a última porção situada no citoplasma, apresenta um grupamento carboxil (COOH) que participa de interações entre outras proteínas por fosforilação (Figura 1). Um recente estudo mostrou que a policistina, através dos seus segmentos, funciona como uma proteína G, isto é, é responsável pela transdução de sinais (processo pelo qual um impulso é conduzido e amplificado para gerar uma resposta adequada). A super expressão de policistina 1 em células de ratos inibiu a proliferação celular e suprimiu a formação de cisto (GALLAGHER et al., 2002, IGARASHI e SOLMO, 2002).

O gene PKD2, codifica a proteína policistina 2 (Figura 1) que é composta por 968 aminoácidos, não apresenta segmento extracelular e a porção transmembrana é 50% igual à policistina 1. A policistina 2 está intimamente relacionada com a policistina 1, o que explica porque mutações de PKD1 ou PKD2 produzem doenças com manifestações clínicas idênticas. A policistina 2 é expressa em muitos tecidos, tais como: coração, ovário, testículo, músculo liso vascular e intestino delgado. Já no rim, a policistina 2 é expressa, assim como a policistina 1, em todos os segmentos do néfron (IGARASHI e SOLMO, 2002).

(16)

1.2 Possível Mecanismo de Formação do Cisto

Os cistos renais originam-se nos epitélios dos néfrons e sistemas coletores, que estão forrados por uma única camada de células que apresentam altas taxas de proliferação celular sendo a taxa de mutação somática, das células epiteliais do rim, de aproximadamente 2 x 10 - 4 (IGARASHI e SOLMO, 2002).

As estruturas tubulares do rim originam-se de dois tecidos: dos néfrons que são derivados do mesênquima metanefrogênico e dos túbulos coletores que originam de brotos uretéricos. A diferenciação do mesênquima metanefrogênico é especial, porque uma célula mesenquimal tem que se transformar em uma estrutura epitelial com lúmen. Para este processo deve haver um sinal que ative a formação do lúmen e outro para que o processo cesse, quando a formação do lúmen já estiver estabelecida, a expansão dos túbulos é finalizada e as células circunvizinhas são degradadas. A cistogênese (Figura 2), pode ser considerada como um processo de falha no sinal de parada de formação do lúmen. Este sinal é determinado pela policistina 1 e policistina 2; na presença da mutação não há sinal de parada e o processo não é interrompido, formando o cisto (GALLAGHER et al., 2002).

Figura 2: Cistogênese em humanos (GALLAGHER et al., 2002) Formação do lúmen controlado (tubulogênese)

Alta expressão de policistina

Formação do lúmen descontrolada (cistogênese)

Ausência de policistina

(17)

Embora todas as células no néfron carreguem a mesma mutação na sua linha germinativa, somente alguns cistos surgem, por néfron. Muitos néfrons aparecem completamente normais, definindo a doença policística como focal. Uma explicação para isto, está no fato é que um gene danificado é herdado de um genitor e outro gene selvagem (sem a mutação) é herdado do outro. Durante a vida do indivíduo, o gene selvagem sofre uma mutação somática e torna-se inativado, o gene mutante, então, começa a se manifestar. Estudos mostraram que cistos renais em pacientes, exibem perda de heterozigozidade devido à perda do alelo selvagem. Assim, enquanto o padrão da herança é dominante, a doença acontece por mecanismos moleculares recessivos (IGARASHI e SOLMO, 2002).

1.2 Diagnóstico da PKD no gato

Atualmente, nenhum exame clínico nem análises laboratoriais, são capazes de confirmar ou excluir um diagnóstico de PKD, já que nenhuma alteração sangüínea ou urinária é específica para essa doença. O diagnóstico baseia-se no exame diferencial das afecções que levam à nefromegalia e à insuficiência renal (CARVALHO, 2004).

As técnicas de diagnóstico por imagem são imprescindíveis para descartar outras causas de nefromegalia, como linfoma renal, nefrite granulomatosa por peritonite infecciosa felina, hidronefrose e pseudocisto renal. A radiografia não é um exame de rotina para o diagnóstico de PKD porque não fornece muitas informações e muitas vezes os rins de animais afetados têm aspecto normal nas radiografias abdominais. Os cistos são visualizados como pontos não uniformes de maior radiopacidade que devem ser diferenciados de neoplasias, abscessos, artefato e hidronefrose. A imagem mais sugestiva de doença cística na radiografia é a renomegalia (Figura 3), que consiste no aumento da silhueta renal (KELLY, 2005).

(18)

Figura 3: Renomegalia bilateral (a) rim direito, (b) rim esquerdo (KELLY, 2005)

1.3.1 Diagnóstico Ultra-Sonográfico (U.S.)

O ultra-som é um dos primeiros exames realizados para avaliação renal, pois importantes informações anatômicas são obtidas, como dimensões, forma, contorno e arquitetura interna, independentemente de sua função. Os rins são órgãos retroperitoneais, circundados por tecido adiposo. Na avaliação longitudinal, através do ultra-som, podemos identificar a cápsula renal que produz um fino eco brilhante quando a onda sonora incide perpendicularmente. A região cortical é mais ecogênica que a região medular porque é formada pelos glomérulos, possuindo uma quantidade maior de células que a região medular, esta última é composta pela maioria dos túbulos do sistema coletor, possuindo uma maior quantidade de fluido, o que a torna hipoecogênica, como observado na Figura 4 (CARVALHO, 2004).

a

(19)

Figura 4: Rim normal, (M) medular, (C) cortical, (setas) cápsula (NYLAND, 2005)

As características ecográficas dos cistos renais compreendem um perfil esférico, paredes lisas com margens nitidamente delimitadas, nenhum eco interno e presença de uma transmissão transversal que consiste em um enriquecimento acústico posterior, correspondente ao tamanho da lesão (BILLER, 2003). Para CARVALHO (2004) as características sonográficas dos cistos são, contorno arredondado ou ovalado, paredes finas e bem delimitadas, conteúdo anecogênico, presença de reforço acústico posterior e uma região anecogênica nas laterais do cisto estendendo-se distalmente (esse artefato é chamado de sombreamento das margens e resulta da refração do feixe sonoro quando passa pelas bordas arredondadas), com destruição do parênquima (Figura 5 e 6).

Figura 5: (seta) Cisto na cortical (NYLAND, 2005)

C

C C

(20)

Figura 6: Destruição do parênquima (seta) (NYLAND, 2005)

Segundo GREEN (1996) e BECK e LAVELLE (2001), o padrão ultra-sonográfico de múltiplas cavidades anecóicas, com reforço distal é altamente específica de PKD.

O ultra-som detecta com segurança o cisto, entretanto sua precisão e confiabilidade, dependem da experiência dos operadores que realizam e interpretam o exame (BILLER, 2003; FISCHER, 2004).

O diagnóstico pode ser complicado, pois o tamanho dos cistos é imperceptível na fase precoce e seu crescimento é variável, os grandes podem alterar o contorno do rim. Em seres humanos e em gatos com um grande número de cistos muito pequenos, tem-se observado um padrão sonográfico hiperecogênico ou complexo, graças à presença de múltiplas interfaces refletoras. Este padrão pode ser confundido com outras lesões renais. O U.S. oferece 95% de confiabilidade quando realizado em gatos com pelo menos 10 meses de idade (CARVALHO, 2004; PRATS, 2005).

Recomenda-se empregar um transdutor de alta freqüência, com pelo menos 7,5MHz e aparelhos com boa resolução de imagem (GONZALEZ e FROES, 2003). Os rins afetados apresentam junção córtico-medular indistinta, o que está associado com a degeneração crônica e inflamação. A sombra distal hiperecóica é devida a áreas de mineralização, o que é confirmado pela histopatologia (REICHLE et al., 2002).

Os testes genéticos apresentam mais especificidade para o diagnóstico de PKD, entretanto, isto não significa o fim da exploração diagnóstica por ultra-som, pois ele ainda

(21)

positivos para PKD e detecção de outras causas para a formação do cisto renal (HELPS, 2007).

1.3.2 Diagnóstico Molecular

LYONS (2004) identificou a mutação genética responsável pela PKD nos gatos persas e raças relacionadas, utilizando técnica de ultra-som e o método de PCR-RFLP, nos EUA. Foram utilizados 81 animais, destes 48 apresentavam cistos no exame ultra-sonográfico e 33 eram considerados normais. A análise pela PCR -RFLP foi realizada pela amplificação de um fragmento de 559 pb, correspondendo à uma porção da seqüência do gene onde ocorre a mutação, no éxon 29. A clivagem do amplicon com a enzima de restrição Mly I, produz dois fragmentos de 316 e 243 bp (pares de bases).

Todos os 48 animais que apresentaram cistos no exame de U.S. apresentaram a mutação, porém nove animais dos 33 considerados normais, apresentaram também a mutação, sendo, portanto, potencialmente afetados.

HELPS et al. (2007) realizaram a identificação do SNP causador da PKD em gatos persa do Reino Unido, utilizando a análise pela Real-Time PCR. O objetivo do trabalho foi comparar a técnica da Real-Time PCR, PCR-RFLP e Ultra-sonografia. Para o estudo foram utilizados 72 gatos da raça persa e exótico. Foram identificados alelos do tipo selvagem, sem a mutação (43 animais) e o alelo responsável pela PKD (29 animais). Os métodos moleculares detectaram 100% dos animais positivos para a mutação. A análise ultra-sonográfica indicou dois animais positivos no grupo de animais selvagens, demonstrando a presença de cisto por outro motivo, não relacionado com o gene da PKD.

Recente estudo realizado por HELPS et al. (2007), utilizou 506 gatos persa e raças relacionadas, destes 149 gatos foram identificados como positivos para PKD, sendo todos heterozigotos, apoiando a hipótese que filhotes homozigotos apresentariam morte embrionária.

O uso da raça persa no desenvolvimento de outras raças pode ter introduzido o gene mutado nas mesmas, porém tem sido demonstrado que o gene para PKD não segrega com os genes responsáveis por produzir pêlos longos ou aspecto braquicefálico (CANNON et al., 2001).

(22)

A realização de pesquisas mais extensas, para avaliar a presença da mutação em gatos de diferentes regiões do mundo deveria ser uma preocupação. Investigações das causas da PKD serão valiosas para a saúde felina e também para as perspectivas da doença em humanos. Os humanos, assim como os gatos apresentam diferentes características na progressão e severidade da doença, que podem ser relacionados com outros fatores genéticos e ambientais. Embora, os criadores sejam aconselhados a não procriar animais positivos para PKD, a criação é feita indiscriminadamente, já que os sinais clínicos nem sempre estão presentes, além de falta de informação do criador e indisponibilidade do exame e/ou custo elevado (LYONS, 2004).

(23)
(24)

2. JUSTIFICATIVA E OBJETIVOS

A PKD é uma doença hereditária dos gatos persas e raças aparentadas. Há cerca de 30 anos tem sido objeto de relatos esporádicos na literatura veterinária. Nos últimos anos tem recebido uma maior importância no meio científico, em virtude do aumento da incidência e prevalência na população dos gatos (BILLER et al., 1996).

Vários trabalhos têm sido publicados com objetivo de definir a prevalência da PKD em vários países, utilizando principalmente o diagnóstico ultra-sonográfico (BILLER et al., 1996, BECK e LAVELLE, 1999, CANNON et al., 2001, BARTHEZ et al., 2003). Atualmente, tem sido utilizado o exame ultra-sonográfico e o diagnóstico molecular para identificar os gatos portadores de cistos e da mutação, respectivamente, definindo a prevalência da doença e do alelo mutante na população (LYONS et al., 2004, e HELPS et al., 2007). Os estudos estão demonstrando diferentes resultados, entre as técnicas de diagnóstico.

No Brasil, ALVES et al. (2006), identificaram através do ultra-som, uma prevalência semelhante à encontrada em outros países. Na região sul o exame ultra-sonográfico é a técnica de diagnóstico mais utilizada para pesquisa de PKD pelos criadores de gatos.

Exames moleculares são realizados, porém a dificuldade e o custo, já que atualmente, o material para o diagnóstico molecular é enviado principalmente para laboratórios na Austrália, impede uma maior utilização deste meio para detectar a real taxa de prevalência do alelo mutante na população de gatos.

Dentro deste contexto, este trabalho teve como:

2.1 Objetivo geral:

Estabelecer a prevalência da doença do rim policístico em felinos da raça persa e assemelhados no sul do Brasil, utilizando técnicas de ultra-sonografia e PCR-RLFP

.

(25)

2. 2 Objetivos específicos:

1) Verificar as freqüências genotípicas e alélicas para o polimorfismo de um único nucleotídeo (SNP) do gene PKD1 em animais da raça persa ou assemelhados;

2) Comparar os genótipos verificados e as imagens ultra-sonográficas dos animais; 3) Elaborar um programa de melhoria genética, através da manutenção do exame da PCR-RLFP, para os criadores de gatos das raças afetadas.

(26)
(27)

3. MATERIAIS e MÉTODOS

3.1 Amostras

Amostras de sangue foram obtidas de gatis de Porto Alegre e região metropolitana, totalizando 116 animais, entre fêmeas e machos, com idades distintas, variando de 2 meses a 10 anos, clinicamente sadios. Todos os animais foram examinados por ultra-sonografia no momento da coleta de sangue.

O tamanho da amostra foi estimado, através do programa do Laboratório de Epidemiologia e Estatística Vinculado à Faculdade de Medicina da Universidade de São Paulo, prevendo de prevalência 35% e fixando o nível de significância entre 1 e 5%. (http://lee.dante.br/cgi-bin/uncgi/calculo_amostra).

3.2 Exame Ultra-sonográfico (Ecografia)

Os exames ultra-sonográficos foram realizados no Hospital Veterinário da Universidade Luterana do Brasil (HV-ULBRA), localizado em Canoas, e no Hospital de Clínicas Veterinárias do Rio Grande do Sul, localizado na rua Dr. Murtinho 324, bairro Bom Jesus, em Porto Alegre.

Para realização dos exames ultra-sonográficos, foram utilizados dois aparelhos: um equipamento modelo GPS 5000, equipado com transdutor de 7,5 MHz e outro modelo ALOKA 500 equipado com transdutor de 7,5 MHz.

Os rins foram examinados nos planos longitudinal, sagital e transverso, através de abordagem lateral e ventral.

Foram estabelecidos três critérios de diagnóstico ultra-sonográfico, que foram tabulados da seguinte forma:

a) animais positivos para a PKD: receberam um sinal de ( ++ ) b) animais negativos: sinal de ( - )

(28)

c) animais duvidosos: um sinal positivo ( + ). Foram considerados duvidosos, os animais que apresentaram alterações parenquimatosas como: cortical heterogênea, pobre definição córtico-medular e hidronefrose.

3.3 Extração do DNA

Amostras de DNA foram obtidas a partir da retirada de sangue periférico, através de seringas de 3 ml com agulhas 25 x 7, armazenados em tubos contendo anticoagulante (EDTA); após a coleta o sangue era refrigerado e encaminhado para o Laboratório de Biotecnologia da ULBRA, no Hospital Veterinário. A extração foi realizada através do método de extração descrito por MILLER et al. (1988).

3.4 Amplificação do Fragmento

A PCR foi realizada utilizando os oligonucleotídeos iniciadores descrito por HELPS et al. (2007).

PKD1 F (5’ – GACAAGCATCTCTGGCTCTCC – 3’ ) PKD1 R (5’ – ACGACCCCGTACCACACAG – 3’ )

O programa de amplificação teve uma desnaturação inicial de 94°C por 3 min. Seguidos de 35 ciclos a 94°C por 30 seg., 62°C por 30 seg., 72°C por 30 seg e uma extensão final a 72°C por 10 min. O fragmento amplificado foi de 131 pares de bases, representado uma porção do gene da PKD1, como demonstrado na Figura 7.

Figura 7: Seqüência do éxon 29 do gene da PKD1

5´GCTGTCGGTGGAGACTGAGGCCAATGGCGGCCTCGTGGAGAAGGAGG

TGCTGGCAGCAAGTAAGGGCCTGGGCCCGTCCCTGCCCGGGCTGGCCGA

GGGGTGGCCTGTGCCACTGGCCTCCTGAAGCCAGCTGTGCCCTTTCTGC

AGGCGACGCGGCTGTGCGGCGGTTCCGGCGCCTCCTGGTGGCCGAGCTG

CAGCGTGGCTTTTTT

GACAAGCATCTCTGGCTCTCC

CTCTGGGACCGGC

CTCCTCGGAGCCGCTTCACCCGCGTCCAGCGGGCCACCTGTT

G

A

GTC

CT

CCTCGTCTGCCTCTTCCTGGGCGCCAATG

CTGTGTGGTACGGGGTCGT

G

GGAGACGCCGCCTACAGGTGGGTGCCCGAGGGGGGCCCGATGATCTCCT

CCTGCCCGACCCCTCCTACCCCCCACAGCCTCTCCCAGCCCGGGTCTCT

CTCCTCTCCTGCCACACAGCGCGGGGCCCGTGTCCGGTCTGATCCCGCT

Sítio de Clivagem para a enzima. Mly I. Seqüência do Primer PKD1 F Seqüência complementar do Primer PKD1 R Mutação C/A

(29)

3.5 Análise dos RFLPs

O produto da PCR foi clivado com a enzima de restrição Mly I. Os fragmentos obtidos foram de 86 pb e 45 pb, no alelo mutante (A), enquanto que no alelo normal (C), o fragmento de 131pb não sofre clivagem (Figura 11).

Os produtos da amplificação da PCR foram analisados por eletroforese em gel de agarose 1,5% corado com brometo de etídeo, exposto à luz ultravioleta e os produtos de clivagem foram analisados em gel vertical de poliacrilamida 10,5%, não desnaturante, com tampão de TBE (pH 8,3). Após a coloração com nitrato de prata, os fragmentos foram identificados por comparação com marcadores de peso molecular (SAMBROOK e RUSSEL, 2001).

3.6 Análises Estatísticas

As freqüências alélicas e genotípicas foram computadas por contagem direta. As comparações entre grupos (sexo, idade e tipo de diagnóstico) foram realizadas pelo teste do χ2, através do pacote estatístico SPSS para Windows.

(30)
(31)

4. RESULTADOS E DISCUSSÃO 4.1 Análise Ultra-Sonográfica

A Tabela 1 apresenta a prevalência de PKD, por avaliação ultra-sonográfica, nos animais examinados. Dos 116 animais (59% fêmeas), 61,21% foram negativos, 16,38% foram positivos para presença de cisto e 22,41% apresentaram parênquima alterado, sem visualização do cisto. Não foram verificadas diferenças entre os sexos (dados não tabulados).

Tabela 1: Resultado dos exames Ultra-Sonográficos

Exame Ultra-sonográfico

N

º

Negativo 71 (61,21%)

Positivo (presença de cisto) 19 (16,38%)

Parênquima alterado 26 (22,41%)

Total 116 (100%)

As Figuras 8 e 9, representam imagens de rins com a presença de cistos. Foram observadas formações anecóicas, encapsuladas, distribuídas através do parênquima renal, com graus variados de destruição parenquimatosa. A Figura 10, representa os casos indefinidos, caracterizados pela alteração parenquimatosa, sem a visualização do cisto.

(32)

As principais alterações ecográficas são: pobre definição córtico-medular, dilatação da pelve e aumento da ecogenecidade cortical.

Figura 8: Múltiplos cistos Figura 9: Cisto isolado

Figura 10: Perda da relação córtico-medular

A interpretação das imagens ecográficas, como cistos, seguiu o mesmo padrão ultra-sonográfico, descrito por NYLAND e MATTOON (2005), contorno circular a ovóide, conteúdo sem eco, paredes finas, lisas e nitidamente demarcadas com uma parede distinta e um forte reforço de eco distal. Ao contrário de massas sólidas de aparência similar, os cistos permanecem anecóicos, apesar do aumento dos padrões encontrados na varredura. A parede proximal do cisto não aparece lisa. De acordo com CARVALHO (2004), isto se deve à sobreposição dos artefatos de reverberação.

(33)

Foi possível observar a deformidade do contorno renal, em alguns rins que apresentavam cistos grandes (2 cm). Para NYLAND (2005), cistos grandes podem deformar o contorno renal, sendo mais proeminente a alteração quando múltiplos cistos são identificados no mesmo rim. O autor também descreve que pode ocorrer deslocamento, distorção e dilatação do sistema coletor, devido à obstrução parcial.

O número de cistos encontrados foi variado, desde um até múltiplos cistos (4-5) no mesmo parênquima e com característica uni e bilateral. BILLER (2003) descreve que a variação do tamanho dos cistos é algo freqüente e muito importante para definir a gravidade da lesão no parênquima renal. Mais tarde, com o desenvolvimento da doença, os ecos do sino renal central podem ser deformados por cistos maiores. Para BARRS et al. (2001), BARTHEZ et al. (2003) e FERRANTE (2004) os rins policísticos são caracterizados pelo número variável de cistos presentes no parênquima renal, variando em tamanho e consistência. Ambos os rins estão invariavelmente comprometidos.

As alterações parenquimatosas encontradas foram: heterogenecidade da cortical, identificando-se áreas de hipoecogenecidade e áreas de hiperecogenecidade sem limitação evidente, pouca definição córtico-medular e graus de hidronefrose. Para CANNON et al. (2001), dependendo da localização e tamanho, os cistos podem não ser visualizados. Cistos dentro da córtex renal são mais facilmente identificados, devido ao aumento de contraste entre o fluido anecóico do cisto e a relativa ecogenecidade do cortical. Cistos medulares são mais difíceis de identificar, devido à sua característica hipoecóica. Estes autores descrevem que a junção córtico-medular pode demonstrar numerosas áreas de hipoecogenecidade e hiperecogenecidade dificultando a identificação do verdadeiro cisto renal. Nesse estudo, um animal de dois anos de idade foi examinado através da ultra-sonografia e considerado afetado, devido ao padrão encontrado (múltiplas áreas de hipoecogenecidade na cortical). Entretanto, cinco meses após, este gato foi eutanasiado sem relato de doença renal. No exame pós-mortem não foi identificada formação de cisto renal. A origem das múltiplas regiões de hipoecogenecidade dentro da cortical não foi esclarecida.

(34)

4.2 Análise Molecular

A Figura 11 representa a eletroforese em gel de poliacrilamida demonstrando alguns produtos da PCR–RFLP. As canaletas 1 a 6 e 8 a 12, representam a identificação do fragmento de 131pb, indicando o genótipo selvagem, sem a mutação. A canaleta nº 7 representa o heterozigoto mutante com a presença dos fragmentos de 86 pb e 45 pb, além daquele de 131pb.

Figura 11: Eletroforese em gel de poliacrilamida, identificando os produtos da amplificação e clivagem pela PCR–RFLP. Canaleta 5: marcador de peso molecular de 25 pb

Foram verificados 26% de animais heterozigotos para a mutação do gene PKD, não ocorrendo diferenças significativas entre machos e fêmeas (Tabela 2), como esperado, já que trata de uma herança autossômica. Esta freqüência foi similar à descrita por HELPS et al. (2007) que obtiveram uma taxa de 27,5%.

45 pb 2 3 4 5 6 7 8 9 10 11 12 131pb 86 pb 1 300 pb 275 pb Marcador de peso molecular 25 pb

(35)

Tabela 2: Freqüência de heterozigotos para PKD, distribuídos por sexo e freqüência alélica na amostra total, detectados pela técnica da PCR-RFLP

Amostras Heterozigotos % Machos 13 27% 48 Fêmeas 17 25% 68 Total 30 26% Freqüência alélica 0,129 116

4.3 Análise comparativa entre PCR-RFLP e U.S.

A comparação entre os resultados da PCR-RFLP e os do ultra-som (Tabela 3), indica que, dos animais negativos no ultra-som, 30% foram positivos do exame molecular e 5% dos positivos no ultra-som foram negativos na PCR-RFLP. CARVALHO (2004) descreve que o diagnóstico ultra-sonográfico pode ser complicado, pois o tamanho dos cistos é imperceptível na fase precoce e seu crescimento é variável. O U.S. oferece 95% de confiabilidade quando realizado em gatos com mais de 10 meses de idade, mas não descarta a possibilidade de aparecimento tardio do cisto.

Outro dado importante foi que, dos exames indefinidos no ultra-som, 23% dos animais foram identificados como portadores por PCR-RFLP, indicando que a grande maioria dos indivíduos em U.S. alterado tinham outra causa para as alterações observadas. Assim, 50% do total de indivíduos portadores da mutação apresentaram, no

(36)

U.S., resultados falsos negativos ou alteração inespecífica do parênquima demonstrando a inespecificidade do exame ultra-sonográfico, quando comparado com o molecular.

Tabela 3: Resultados comparativos entre U.S. e PCR

Exames

Ultra-som

Positivo Negativo Alterado Total

PCR

Mutante (CA) 15 (50%) 9 (30%) 6 (20%) 30 Selvagem (CC) 4 (5%) 62 (72%) 20 (23%) 86

Total 19 71 26 116

X² = 34,58. 2D.F. P>0,001.

Dos animais positivos no exame de ultra-som 4 (5%) não apresentaram a mutação, indicando outra causa para a formação do cisto. ROSS et al. (1982) e LULICH et al. (1994) relacionaram vários agentes (drogas, endotoxinas e hormônios) como causadoras do desenvolvimento de cistos renais, em animais. Por exemplo, a ingestão das drogas difeniltiazole, ácido nordihidroguaiarético, difenilamina e corticosteróides causam formação de cistos em rins normais. Os autores também afirmam que cistos renais adquiridos têm sido identificados em cães e gatos com displasia renal, neoplasias, infecções e nefrite túbulo-intersticial. Segundo GREEN (1996) e BECK e LAVELLE (2001), o padrão ultra-sonográfico de múltiplas cavidades anecóicas, com reforço distal é altamente específica para o diagnóstico do cisto renal, mas não específica para diagnóstico de PKD.

Para LYONS et al. (2004) e HELPS et al. (2007) o teste genético além de ser altamente específico para detectar a mutação da PKD, gera outras vantagens em relação ao ultra-som, como a comodidade de não necessitar da presença do animal e

(37)

principalmente o fato de o resultado independer da idade. Isto no entanto, não significa o fim da exploração diagnóstica por ultra-som, que ainda necessitará ser utilizada para o monitoramento da lesão, para avaliação da severidade da doença nos animais positivos para PKD e para identificação de cisto renal de outra origem.

Em humanos, TORRES e HARRIS (2007) afirmaram que 15% dos cistos são causados por mutação no gene PKD2, localizado no cromossomo 4, responsáveis pela tradução da policistina 2. Assim é possível que, também em gatos, outras causas genéticas, diferentes da AD-PKD, expliquem a ocorrência de cistos. Desta forma, não se pode excluir que os indivíduos positivos por U.S., mas negativos por PCR-RFLP, tenham de fato PKD, mas por mutações em outro gene. Vale salientar que, até o presente, o gene PKD2, não foi descrito em felinos.

Nenhum animal do estudo apresentou homozigose para a mutação, embora com a freqüência observada do alelo PKD + (13%), esperar-se-iam encontrar 2 homozigotos, neste tamanho amostral; este dado reforça a hipótese de que animais homozigotos não completam o desenvolvimento (LYONS et al., 2004 e HELPS et al., 2007).

Prevalência no Rio Grande do Sul x Prevalências Mundiais

As freqüências observadas neste trabalho diferem das encontradas por outros pesquisadores, mesmo considerando que a maioria dos trabalhos tenham estimado as prevalências apenas por exame ultra-sonográfico.

BARRS et al (2001) encontraram uma prevalência de 45% de PKD em gatos em Sydney, Austrália.

Em estudo realizado no Reino Unido, CANNON et al. (2001) encontraram uma prevalência de 49,2% de PKD em 146 animais, entre 6 meses e 15 anos, incluindo animais sadios e doentes e também exames pós-mortem.

BARTHEZ et al. (2003) determinaram uma prevalência de 39,1% de PKD nos animais examinados. Nesse estudo, foram excluídos animais com sinais clínicos ou

(38)

histórico de falha renal. O estudo evidenciou a similaridade da prevalência da PKD entre vários países como: Austrália, Reino Unido, Estados Unidos e Alemanha.

Em recente estudo realizado por BONAZZI et al. (2007) a prevalência da PKD encontrada foi de 41%. Os animais foram divididos em grupos, conforme a idade, menos de 9 meses e mais de nove meses. Foram considerados positivos para PKD, animais que apresentavam pelo menos um cisto, em um dos rins, no exame ultra-sonográfico. Também foram considerados outros sinais ecográficos como sinal medular; foi comparada a imagem encontrada na zona medular quando havia ou não presença de cisto, determinando uma alteração no parênquima renal. Os resultados obtidos não evidenciaram diferença significativa entre os grupos de idades diferentes e nem nos resultados dos parênquimas alterados com sinais medulares.

No entanto, conforme outros pesquisadores, a idade do animal é um fator importante para a identificação dos cistos, havendo maior dificuldade na identificação do cisto, por U.S., em gatos com até 10 meses de idade (GRENN, 1996, BECK e LAVELLE, 2001, PRATES, 2005). BARRS et al. (2001), em um estudo da prevalência da doença na Austrália, reafirmaram que a sensibilidade do exame ultra-sonográfico aumenta com a idade, devido ao aumento progressivo do tamanho cisto. O cisto pode ser identificado em filhotes de seis ou sete semanas, mas a ausência de cisto, nesta idade, não pode ser definitiva, pois a visualização do cisto pode ocorrer mais tardiamente.

Em estudo realizado por BILLER (2003), foi obtida uma sensibilidade de 75% na identificação de cisto renal em filhotes de quatro meses e de 91% em filhotes com 9 meses de idade. Devido a estes resultados foi recomendado que para ser considerado negativo, através do ultra-som a gato deverá ter no mínimo 10 meses. Entretanto, este autor define que esta idade mínima é muito frustrante para os criadores, já que estes precisam decidir quais dos filhotes ficarão para reprodução e quais serão comercializados.

Os valores mais baixos de PKD encontrados neste estudo (16% por U.S. e 26% por PCR-RFLP), podem estar evidenciando a melhoria genética dos animais criados no Rio Grande do Sul. Os criadores estão demonstrando uma constante preocupação com a PKD; há pelo menos 8 anos, estão sendo realizados cruzamentos entre animais que não apresentam o problema, identificados através de exames ultra-sonográficos e/ou por

(39)

Este trabalho, além de permitir conhecer a prevalência real da PKD em gatos persa e seus híbridos, possibilitou o estabelecimento de um programa de melhoramento genético da raça, através da disponibilização do exame molecular, para os criadores de gatos das raças afetadas. Os exames serão realizados, através do credenciamento do veterinário responsável pela solicitação do exame, conforme Anexo 1. Esta estratégia permitirá a eliminação da doença em nosso Estado, pois de acordo com HELPS et al. (2007) um programa bem elaborado de teste genético e acasalamentos direcionados podem erradicar a mutação da população felina.

(40)
(41)

5. CONCLUSÕES

A análise da prevalência de PKD em 116 gatos assintomáticos do Rio Grande do Sul por duas metodologias (ultra-sonografia e diagnóstico molecular) permitiu as seguintes conclusões:

● A taxa de prevalência encontrada nos animais neste estudo, foi de 26% para PCR-RFLP e 16% para o U.S. Independente da metodologia, esta prevalência foi menor do que a relatada em outros países, o que, provavelmente, reflete o cuidado que vem sendo tomado por criadores de gatos da raça persa do Rio Grande do Sul, que, há pelo menos 8 anos, estão realizando cruzamentos entre animais sem o problema.

● O método molecular foi mais eficiente para a detecção da PKD, pois somente 50% dos animais portadores do alelo mutante, foram diagnosticados através do exame de ultra-som.

● O U.S. é um método eficiente para detectar o cisto renal, porém ele não define a causa da formação cística;

● O exame ultra-sonográfico não descarta a possibilidade de desenvolvimento de cisto renal mais tardiamente;

● Apesar do ultra-som não poder definir a origem da formação do cisto, ele é extremamente útil para monitorar a severidade da lesão parenquimatosa;

● A possibilidade da realização do exame molecular para a comunidade de criadores, que não necessitará mais enviar amostras para o exame, no exterior, facilitará o controle e a tentativa de erradicação da doença.

(42)

6. REFERÊNCIAS BIBLIOGRÁFICAS

ALVES, L.C, TEIXEIRA, M.A.C., FISCHER, C., GRÜN, R. Prevalência da doença renal policística em gatis de porto Alegre e grande Porto Alegre. In: XVII CONGRESSO ESTADUAL DE MEDICINA VETERINÁRIA. II CONGRESSO DA ANCLIVEPA. IV ENCONTRO DE ESPECIALISTAS DE PEQUENOS RUMINANTES DO CONE SUL. Gramado-RS. 2006.

BARRS, V.R, GUNEW, M., FOSTER, S.F, BEATTY, J.A, MALIK, R. Prevalence of autosomal dominant polycystic kidney disease in persan cats and related breeds in Sydney and Brisbane. Australian Veterinary Journal,, v. 79, p 257–259. 2001.

BARTHEZ, P.Y, RIVIER, P., BEGON, D. Prevalence of polycystic kidney disease in Persian and Persian related in France. Journal of Feline Medicine and Surgery, v. 5, p 345–347. 2003.

BECK, C., LAVELLE, R.B. Feline polycystic kidney disease in persian and other cats: a prospective study using ultrasonography. Australian Veterinary Journal, v. 79, p 181–184. 2001.

BILLER, D.S. Doença Policística dos Rins. In: Impresso Royal Canin. Gráfica O Comércio,. 2003. 22p.

BILLER, D.S., DIBARTOLA, S.P., EATON, K.A, WELLMAN, M.L., RADIN, M.J. Inheritance of Polycystic Kidney Disease In Persian Cats. Journal of Heredity, v. 87, p.1–5. 1996.

BONAZZI, M.; VOLTA, A.; GNUDI, G.;BOTTARELLI, E.; GAZZOLA, M.; BERTONI, G. Prevalence of the polycystic kidney disease and renal and urinary bladder ultrasonographic abnormalities in Persian and exotic Shorthair cats in Italy. Journal of Feline Medicine & Surgery, v.9, p. 387-391. 2007

(43)

CANNON, M.J., MACKAY, A.D., BARR, F. J., RUDORF, H.,BRADLEY, T. J. Prevalence of polycystic kidney disease in Persian cats in the United Kingdom. Veterinary Record, v. 149, p. 409–411, 2001.

CARAKUSCHANSKY, G. Herança Mendeliana. In: Doenças Genéticas em Pediatria. Rio de Janeiro: Guanabara Koogan S.A., 2001. 44p.

CARVALHO, C. F. Sistema Urinário: Rins, Ureteres, Bexiga Urinária e Uretra. In: Ultra-Sonografia em Pequenos Animais. São Paulo: Roca, 2004. 133p.

CHEW, D.,SCHENK, P.A., BUFFINGTON, C.A.T. Feeding the Aging Cat with Chronic Renal Failure. Supplement to Compendium on Continuing Education for the Practicing Veterinarian. v. 26, p. 24–28, 2004.

CROWELL, W.A., HUBBEL, J.J., RILEY, J.C. Polycystic renal disease in related cats. Journal of American Veterinary Medical Association . v. 175, p 286–288, 1979.

EATON, K. A, BILLER, D.S., DIBARTOLA, S.P., WELLMAN, M.L., RADIN, M.J Autossomal Dominant Polycystic Kidney Disease in Persian and Persian cross Cats. Veterinary Pathology. v. 34, p. 117–126, 1997.

FERRANTE, T. Doença Renal Policistica em Felinos. Nosso Clinico, v. 42, p. 6–10, 2004.

FIGUEIREDO, L.M.A, BANDARRA, E.P., SEQUEIRA, J.L. Doença Renal Policística em Gato. Revista Cães e Gatos, v. 77, p. 14-18, 1998.

FISCHER, J.R. Doença Policística dos Rins. In: LAPPIN, M. R. Segredos em Medicina Interna de Felinos: Respostas ao dia-a-dia em rounds, na clínica, em exames orais e escritos. Porto Alegre: Artmed, 2004.

FOWLER, K.J., SAHHAR, M.A., TASSICKER, R.J. Genetic Counseling for Cat and Dog Owners and Breeders Managingthe Emocional Impact. Journal of American Veterinary Medical Association, v. 216, p. 498–501, 2000.

(44)

GALLGHER, A.R., HIDAKA, S., GRETZ, N., WITZGALL, R. Molecular basis of autosomal dominant polycystic kidney disease. Cellular and Molecular Life Sciences, v. 59, p. 682– 693, 2002.

GONZALES, J.R.M., FRÓES, T.R. Doença Renal Autossômica Dominante. In: SOUZA,H. J. M. Coletâneas em Medicina e Cirurgia Felina. Rio de Janeiro: L.F. Livros de Veterinária, 2003. p.171.

GREEN, R.W. Kidneys. In: GREEN, R.W. Small Animal Ultrassound. Philadelphia: Lippincott-Raven, 1996. p 210.

HARKIN, K.R., BILLER, D.S, BALANTINE, H.L. Glomerulocystic Kidney Disease in a Kitten. Journal of American Veterinary Medical Association, v. 223, p. 1780–1782, 2003.

HELPS, C.R., TASKER, S., BARR, J.B., WILLS, S.J., TIMOTHY, J. Detection of the single nucleotide polymorphism causing feline atosomal dominant plycystic kidney disease in Persians from the UK using a novel real–time PCR assay. Molecular and Cellular Probes, v. 21, p. 31–34, 2007.

HELPS, C.R., TASKER, S., HARLEY, R. Correlation of the feline PKD diagnosed by pathological examination. Experimental and Molecular Pathology, v. 83, p. 264-268, 2007.

IGARASHI, P., SOMLO, S. Genetics and pathogenesis of polycystic kidney disease. Journal of the American Society of Nephrology, v. 13, p. 2384–2398, 2002.

LULICH, J.P., OSBORNE, C.A., WALTER, P.A. The compendium Collection: Renal Disease in Small Animal Practice. New Jersey: Veterinary Learning Systems, 1994.

LULICH, J.P., OSBORNE, C.A., POLZIN, D.J. Cystic Diseases of the Kidney. In: OSBORNE, C.A., FINCO, D.R. Canine and Feline Nephrology and Urology. Philadelphia: Williams and Wilkins, 1995. 252p

(45)

LYONS, L.A., BILLER, S.D., ERDMAN, C.A., LIPINSKI, M.J., YOUNG, A.E., ROE, B. AGRAHN, R.A. Feline polycystic kidney disease mutation identified in PKD1. Journal of the American Society of Nephrology, v. 15, p. 2548– 555, 2004.

MCMILLAN-SCOTT, S. Genetic Test for Polycystic Disease in Cats. Veterinary Record, v. 34, p. 381–382. 2004.

MILLER, R.H., LEHMKUHL, L.B., SMEAK, D.D., DIBARTOLA, S.P., RADIN, J. Effect of Enalapril on Blood Pressure, Renal Function, and the Renin-angiotensinaldosterone System in Cats whit Autosomal Dominant Polycystic Disease. American Journal of Veterinary Research, v. 60, n.12, p.1516–1525, 1999.

MURPHY, W.J. Radiation hybrid map of the cat genome: implications for comparative mapping. Genome Research, v. 10, p. 691–702, 2000.

NORSWORTHY, G.D. Doença Renal Policística. In: NORSWORTHY, G.D., CRISTAL, M. A., GRACE, S.F., TILLEY, L.P. O Paciente Felino: tópicos essenciais de diagnóstico e tratamento. Barueri: Manole, 2004. 483p.

NYLAND, G. T.; MATTOON, S. J. Ultra-som diagnóstico em pequenos animais. São Paulo: Roca, 2 ed. 2005. 357p.

PODDEL, M, DIBARTOLA, S.P., ROSOL, T.J. Polycystic Kidney Disease and Renal Lymphoma in a Cat. Journal of American Veterinary Medical Association. n. 6, p. 906–909, 1992.

PRATS, A. Afecções do filhote até a puberdade. In: Neonatologia e pediatria canina e felina. Cap.11. São Paulo, Interbook. 2005.

RAH, H., MAGGS, J. D. Lack of genetic assiciation among coat colors, progressive retinal atrophy and polycystic kidney disease in persian cats. Journal of Feline Medicine and Surgery, v. 8, p. 357– 60. 2006.

(46)

REICHLE, J.K., DIBARTOLA, S.P., LEVEILLE, R. Renal ultrassonographic and computed tomographic appearence, volume, and function of cats with autossomal dominant polycystic kidney disease. Veterinary Radiology & Ultrasound, v. 43, p. 368-373, 2002.

ROSS, L.A., FINCO, D.R, CROWEL, W.A. Effect of dietary phosphorus restriction on the kidneys of cats with reduced renal mass. American Journal of Veterinary Research, v. 43, p. 1023–1026. 1982.

TORRES, V.E., HARRIS, P.C. Polycystic kidney disease: genes, proteins, animal models, disease mechanisms and therapeutic opportunities. Journal of Internal Medicine, v. 261, p. 17–31, 2007.

(47)
(48)

CREDENCIAMENTO DE MÉDICO VETERINÁRIO

PARA REALIZAÇÃO DE EXAMES DE PCR-RLFP PARA PESQUISA DE PKD HOSPITAL VETERINÁRIO DA ULBRA - LABORATÓRIO DE BIOTECNOLOGIA

Atribuições do Médico Veterinário credenciado:

a) Realizar a coleta do material ( anexo instrução de coleta )

b) Identificar o animal ( resenha, nº de registro, proprietário,anexo modelo )

c) Enviar material com requisição específica para o exame ao hospital veterinário da ULBRA. d) Caso seja de seu interesse o proprietário poderá conduzir o animal ao HV-ULBRA, para coleta de sangue, com requisição específica para o exame, emitida pelo veterinário credenciado, cujo os dados serão de responsabilidade do mesmo.

Atribuições do Laboratório de Biologia Molecular do HV-ULBRA

a) Realização do Exame, desde que, a qualidade do material o permita. b) Elaboração do laudo conforme os dados constantes na requisição c) Envio do laudo ao endereço constante na requisição

d) O prazo de entrega do laudo será de cinco a vinte dias úteis , dependendo da rotina laboratorial.

Instrução de coleta de material:

a) Sangue com anticoagulante ( EDTA ou Citrato de sódio ), sem heparina. Volume de sangue: mínimo 1 ml.

b) Conservação : refrigerado

c) Tempo da coleta até a chegada no laboratório: 12 horas d) Identificação do animal no frasco de coleta

Modelo de Requisição:

Solicito realização de PCR- RLFP, para pesquisa de PKD do animal abaixo identificado: Nome: Idade: Raça: Sexo:

N° de registro: Pelagem: Proprietário/ Criador:

Endereço completo para envio do laudo:

Data da solicitação e assinatura do veterinário credenciado.

Eu,_________________________________,médico veterinário,CRMV______. Estou de acordo com as normas estabelecidas acima.

Canoas____ de _________ de 200__

_________________________________________ _________________________ Resp. Laboratório de Biotecnologia do HV- ULBRA Méd. Veterinário credenciado

(49)

Livros Grátis

(

http://www.livrosgratis.com.br

)

Milhares de Livros para Download:

Baixar livros de Administração

Baixar livros de Agronomia

Baixar livros de Arquitetura

Baixar livros de Artes

Baixar livros de Astronomia

Baixar livros de Biologia Geral

Baixar livros de Ciência da Computação

Baixar livros de Ciência da Informação

Baixar livros de Ciência Política

Baixar livros de Ciências da Saúde

Baixar livros de Comunicação

Baixar livros do Conselho Nacional de Educação - CNE

Baixar livros de Defesa civil

Baixar livros de Direito

Baixar livros de Direitos humanos

Baixar livros de Economia

Baixar livros de Economia Doméstica

Baixar livros de Educação

Baixar livros de Educação - Trânsito

Baixar livros de Educação Física

Baixar livros de Engenharia Aeroespacial

Baixar livros de Farmácia

Baixar livros de Filosofia

Baixar livros de Física

Baixar livros de Geociências

Baixar livros de Geografia

Baixar livros de História

Baixar livros de Línguas

(50)

Baixar livros de Literatura

Baixar livros de Literatura de Cordel

Baixar livros de Literatura Infantil

Baixar livros de Matemática

Baixar livros de Medicina

Baixar livros de Medicina Veterinária

Baixar livros de Meio Ambiente

Baixar livros de Meteorologia

Baixar Monografias e TCC

Baixar livros Multidisciplinar

Baixar livros de Música

Baixar livros de Psicologia

Baixar livros de Química

Baixar livros de Saúde Coletiva

Baixar livros de Serviço Social

Baixar livros de Sociologia

Baixar livros de Teologia

Baixar livros de Trabalho

Baixar livros de Turismo

Referências

Documentos relacionados

Sendo os resultados experimentais (verde) obtidos nas amostras sem desvolatilizacão da Figura 37, fizeram-se a descrição feita acima onde a media final serviu

1- Indica com P, se a frase estiver na voz passiva e com A se estiver na ativa. Depois, passa-as para a outra forma. a) Vimos um cisne moribundo.. Assinala com um X o

Este trabalho buscou, através de pesquisa de campo, estudar o efeito de diferentes alternativas de adubações de cobertura, quanto ao tipo de adubo e época de

No entanto, maiores lucros com publicidade e um crescimento no uso da plataforma em smartphones e tablets não serão suficientes para o mercado se a maior rede social do mundo

O valor da reputação dos pseudônimos é igual a 0,8 devido aos fal- sos positivos do mecanismo auxiliar, que acabam por fazer com que a reputação mesmo dos usuários que enviam

A partir da análise dos questionários, utilizados como instrumento de pesquisa referente à atividade desenvolvida em sala de aula com o auxílio da cartilha “Sensoriamento Remoto: os

O enfermeiro, como integrante da equipe multidisciplinar em saúde, possui respaldo ético legal e técnico cientifico para atuar junto ao paciente portador de feridas, da avaliação

Dessa distância, é impossível errar, e a criatura tomba sobre a mesa. Um burburinho junto à porta indica que você foi observado, e o que quer que estivesse espiando você,