ABSTRACT
Fr e q u e n c y o f p e r i o d o n t a l p a t h o g e n s a n d
Helicobact er pylori in t he m out hs and st om achs of
obese individuals subm it t ed t o bariat ric surgery:
a cross- sect ional st udy
André Luiz PATARO1, Sheila Cavalca CORTELLI20DXUR+HQULTXH1RJXHLUD*XLPDUmHV$%5(84, José Roberto
CORTELLI2, Gilson Cesar Nobre FRANCO2,3, Davi Romeiro AQUINO2, Luis Otavio Miranda COTA1, Fernando Oliveira
COSTA1
1- Universidade Federal de Minas Gerais, Departamento de Periodontia, Belo Horizonte, Minas Gerais, Brasil.
2- Universidade de Taubaté, Núcleo de Pesquisa Periodontal, Departamento de Odontologia, Taubaté, São Paulo, Brasil.
8QLYHUVLGDGH(VWDGXDOGH3RQWD*URVVD/DERUDWyULRGH)LVLRORJLDH3DWR¿VLRORJLD'HSDUWDPHQWRGH%LRORJLD*HUDO3RQWD*URVVD3DUDQi%UDVLO
4- Universidade Federal de Minas Gerais, Departamento de Odontologia Social e Preventiva, Belo Horizonte, Minas Gerais, Brasil.
Corresponding address: Sheila Cavalca Cortelli - UNITAU-NUPER - Rua Expedicionário Ernesto Pereira, 110 - Taubaté - SP - Brazil - 12020-330 - fax +55 12 3632-4968 - e-mail: [email protected]
6XEPLWWHG1RYHPEHU0RGL¿FDWLRQ0DUFK$FFHSWHG0DUFK
O
bj ectives: This cross- sectional study com pared the frequency of oral periodontopathogens and H. py lor i in t he m out hs and st om achs of obese indiv iduals w it h or w it houtSHULRGRQWLWLVVXEPLWWHGWREDULDWULFVXUJHU\0DWHULDODQG0HWKRGV2QHKXQGUHGDQG¿IW\
four m en and wom en aged 18- 65 were convenient ly dist ribut ed int o four groups. Two groups were com posed of individuals who underwent bariat ric surgery wit h ( BP) ( n= 40) and wit hout ( BNP) ( n= 39) periodont it is and t w o obese cont rol groups w it h ( CP) ( n= 35) and w it hout ( CNP) ( n= 40) periodont it is. The oral pat hogens Porphyrom onas gingivalis, Aggregat ibact er act inom ycet em com it ans, Parvim onas m icra, Treponem a dent icola, Tannerella forsyt hia,
Cam pylobact er rect us, and Helicobact er pylori were det ect ed by a polym erase chain react ion t echnique using saliva, t ongue and st om ach biopsy sam ples. Result s: St at ist ical analysis dem onst rat ed t hat periodont opat hogens were highly frequent in t he m out h ( up t o 91.4% ) . I n t he bariat ric surgically t reat ed group, orally, P. gingivalis, T. dent icola and T. forsyt hia
were m ore frequent in periodont it is, while C. rect us was m ore frequent in non- periodont it is
VXEMHFWV6WRPDFKELRSVLHVDOVRUHYHDOHGWKHKLJKIUHTXHQF\RI¿YHRUDOVSHFLHVLQERWK
candidat es for bariat ric surgery ( 91.6% ) and t he bariat ric ( 83.3% ) groups. H. pylori was frequent ly det ect ed in t he m out h ( 50.0% ) and st om ach ( 83.3% ) . I n t he st om ach, oral species and H. pylori appeared in low er frequency in t he bariat ric group. Conclusions: Obese individuals show ed high frequencies of periodont opat hogens and H. pylori in t heir m out hs and st om achs. Bariat ric surgery show ed an inverse m icrobial effect on oral and st om ach environm ent s by revealing higher oral and lower st om ach bact erial frequencies.
Ke yw or ds: Obesit y. Bariat ric surgery. Periodont al diseases. Bact eria.
I N TROD UCTI ON
High prevalence of obesit y and it s com plicat ions h av e becom e a global h ealt h con cer n . Besides different syst em ic com orbidit ies16, obesit y has been OLQNHGWRRUDOVWDWXVDQGVSHFL¿FDOO\WRDQLQFUHDVHG
risk for t he developm ent and severit y of periodont al disease7 , 8 , 2 0 , 2 2 , 2 3 am on g t h e m ost pr evalen t or al
diseases in different populat ions. However, a recent
sy st em at ic r ev iew point ed out t hat ev idence on t his subj ect is st ill lim it ed21. Periodont it is t riggers
local and syst em ic variat ions in pat hophysiology
PHFKDQLVPVWKDWOHDGWRDFKURQLFLQÀDPPDWRU\
affect t he periodont al response and it can also be affect ed by periodont al infect ions20.
Periodont al disease is a m ult ifact orial infect ious disease associat ed wit h a m icrobiot a predom inant ly com p osed of Gr am - n eg at iv e sp ecies. Th e lin k bet w een obesit y and periodont al disease is based
RQLQÀDPPDWRU\FKDUDFWHULVWLFV$OWKRXJKVWDUWLQJ
agent s could be different , bot h show high levels of
LQÀDPPDWRU\PHGLDWRUV18,20. Despit e it s relevance,
t he num ber of sur v ey s t hat hav e at t em pt ed t o an aly ze t h e r elat ion sh ip b et w een ob esit y an d per iodont al m icr obiot a is st ill sm all. How ever, a few prelim inary st udies have found different oral
PLFURELDOSUR¿OHVDIWHUFRPSDULQJREHVHDQGQRQ
obese groups10,11, t herefore indicat ing t he need for
furt her st udies in t his area. Alt hough Belst røm , et al.3 ( 2014) failed t o est ablish an associat ion bet ween ERG\PDVVLQGH[DQGVDOLYDU\EDFWHULDOSUR¿OHVWKH
Hum an Microbiom e proj ect has shown t hat shift s in our m icrobiot a are associat ed w it h m any diseases such as obesit y14. Recent ly, a cross- sect ional st udy
perform ed in Japan revealed an associat ion bet ween Por phyr om onas gingivalis, Tr eponem a dent icola, and Tannellera forsyt hia and obesit y17.
Alt hough m icrobial st udies focusing on obesit y and periodont al st at us are lim it ed, w hen obesit y and bact erial frequency are m ent ioned, Helicobact er pylori undoubt edly plays a key role. Oral sit es could represent a reservoir for H. pylori9,28and, in t heory,
t he m out h- st om ach rout e used by t his pat hogen can also be u sed by per iodon t al pat h ogen s t o access ot her part s of t he body. Bariat ric surgery is a com m only recom m ended t reat m ent opt ion for severely obese subj ect s19. Aft er surgery, several
personal changes can be observed; how ever, t he
RUDOPLFURELDOSUR¿OHRIEDULDWULFVXUJHU\SDWLHQWV
r em ain s con t r ov er sial2 4 , 3 0. Alt h ou gh t h er e h av e
been report s on t he possible associat ion bet w een
REHVLW\DQGSHULRGRQWDOGLVHDVHVSHFL¿FGDWDRQ WKH LQÀXHQFH RI REHVLW\ DQGRU EDULDWULF VXUJHU\
on st om ach fr equency of per iodont al pat hogens had not been gat hered yet . Moreover, t here are no r epor t s in t he lit erat ur e descr ibing w het her per iodont al pat hogens can t ranslocat e fr om t he m out h t o colonize t he gast ric m ucosa. Therefore, t he pr esent st udy w as per for m ed w it h t he aim of evaluat ing t he oral, and especially st om ach, presence of cert ain t arget periodont al pat hogens and H. pylori in bariat ric surgically t reat ed obese individuals.
M ATERI AL AN D M ETH OD S
Pa r t icipa n t s
2QHKXQGUHGDQG¿IW\IRXUREHVHDGXOWLQGLYLGXDOV
( 121 fem ales and 33 m ales, 37.58± 11.36 years of age) r ecr uit ed fr om t w o healt h cent er s for t he t reat m ent of obesit y ( Traum a One Clinic locat ed
i n Be l o Ho r i zo n t e , Mi n a s Ge r a i s, Br a zi l a n d Dent al Medic Clinic locat ed in Lorena, São Paulo, Br azil) com posed t h e popu lat ion of t h is st u dy. All of t h em u n der w en t a com plet e per iodon t al clinical exam inat ion bet w een Decem ber 2009 and Decem ber 2 0 1 3 . I n clu sion cr it er ia w er e adu lt s bet w een 18 and 65 years of age, bot h genders, w ho had been bariat ric surgically t reat ed by t he gast ric bypass Roux- en-Y – Fobi- Capella t echnique, and obesit y ( BMI > 30 and < 4 0) for t he cont r ol groups. I n addit ion, t he diagnosis of periodont it is ( described a post eriori) was a requirem ent for t w o groups w hile a non- periodont it is diagnosis was an inclusion crit erion for t he ot her t w o groups. The exclusion crit eria w ere: t hose aged under 18 or over 65; underw eight Body Mass I ndex ( BMI < 19 for surgically t reat ed pat ient s) or m orbid obesit y ( BMI > 40) ; possession of few er t han 15 nat ural t eet h; pregnancy; ant ibiot ic int ake or regular use of chlorhexidine w it hin t he t hree m ont hs previous t o t he exam inat ion.
Part icipant s w ere carefully inform ed about t he obj ect ives of t he st udy and aft er t heir approval t hey signed a consent form . This st udy was approved by t he Federal Universit y of Minas Gerais Research Com m it t ee ( ETI C 57807) and Universit y of Taubat é Et hics Research Com m it t ee ( prot ocol 52210) .
T h e s t u d y p o p u l a t i o n w a s c o n v e n i e n t l y
GLVWULEXWHGLQIRXUGLVWLQFWJURXSV7KH¿UVWLQFOXGHG
t he bariat ric surgically t reat ed groups com posed of pat ient s t hat under gone t he sur ger y at least 2 4 m o n t h s l at er ( 3 9 . 3 7 ± 1 5 . 8 0 m o n t h s af t er su r ger y ) . Th is gr oup w as subdiv ided accor ding t o t h e pr esen ce of per iodon t it is ( bar iat r ic w it h per iodon t it is - BP) or absen ce of per iodon t it is ( bar iat r ic w it h no per iodont it is - BNP) and w as com posed of 40 and 39 individuals, respect ively. Th e seco n d i n cl u d ed t w o o b ese g r o u p s: o n e com p osed of ob ese p at ien t s sh ow in g sig n s of periodont it is ( cont rol w it h periodont it is - CP) and t h e ot h er com posed of obese pat ien t s w it h ou t signs of periodont it is ( cont rol w it h no periodont it is - CNP) . These groups w ere com posed of 35 and 4 0 in div idu als, r espect iv ely. Th e n u m ber of 3 2 indiv iduals per gr oup, as t he m inim um needed, was det erm ined based on result s from a pilot st udy, which included sam pling and laborat orial processing of 10 obese individuals. St at ist ics revealed t hat t his num ber w ould be enough t o ident ify a m inim um
VLJQL¿FDQWGLIIHUHQFHRI,QDGGLWLRQD
safet y m argin was adopt ed.
t rain ed an d calibrat ed pr ofession al n u t r it ion ist . These m easurem ent s w ere used t o calculat e BMI ( Kg/ m2) and classify obesit y29. Twent y individuals
h ad t h ei r h ei g h t an d w ei g h t r e- m easu r ed t o det erm ine BMI reproducibilit y values. The Kappa t e st sh o w e d v a l u e s g r e a t e r t h a n 0 . 9 0 , t h u s indicat ing good reproducibilit y.
Pe r iodon t a l clin ica l e x a m in a t ion
For each part icipant , a full- m out h periodont al exam inat ion was perform ed in a hospit al gurney w it h a phot ophore. Two periodont ist s ( A.L.P. and S. C. C) , t rained and calibrat ed at t he beginning of t he st udy, m easur ed pr obing dept h ( PD) and clinical at t achm ent level ( CAL) . Aft er seven days, t he per iodont al ex am inat ions of 10 par t icipant s w ere repeat ed, show ing int ra- and int er- exam iner reproducibilit y scores t hat w ere higher t han 0.85 ( Kappa t est ) for PD and CAL clinical param et ers. I nt ra- class correlat ion t est s show ed scores higher t han 0.90. The follow ing periodont al param et ers w ere regist ered w it h a m anual periodont al probe ( Nor t h Car olina Univer sit y m odel – UNC – # 15, Hu - Fr ied y ; Ch icag o, I L, USA) at six sit es p er t oot h: bleeding on pr obing ( BOP) , PD and CAL.
3HULRGRQWLWLVZDVGH¿QHGDVWHHWKZLWKVLWH VKRZLQJVLPXOWDQHRXVO\DSURELQJGHSWKPP
DQGFOLQLFDODWWDFKPHQWOHYHOPP15. Oral hygiene
was assessed using plaque index ( PI )26.
M icr obiologica l a sse ssm e n t
Sam ples of saliva6 and from t he dorsum of t he
t ongue5 w ere collect ed from t he t ot al populat ion
( n = 1 5 4 ) . Saliva sam ples w er e collect ed in t h e m orning, bet w een 8: 00 and 11: 00. The pat ient s were inst ruct ed not t o eat or drink prior t o sam pling. I m m ediat ely befor e sam pling, indiv iduals r insed t heir m out hs w it h wat er. Dur ing collect ion, t hey r em ained seat ed w it h t heir heads t ilt ed for war d ( approxim at ely 45° ) and 2.0 m L of unst im ulat ed, w h ole saliv a w er e collect ed in t o st er ile Falcon t ubes. Sam ples w ere cent rifuged for 10 m inut es at 15,000× g at 4° C, and t he supernat ant s w ere im m ed iat ely st or ed at - 8 0 ° C. Scr ap in g s f r om t h e t on g u e d or su m w er e t ak en f r om ar eas of approxim at ely 1 cm2 using a cot t on swab dipped
in r educed Ringer ’s solut ion, r ot at ed six t im es. Each swab was t ransferred int o a m icrot ube also cont aining reduced Ringer ’s solut ion ( 1 m L) .
A c c o r d i n g t o s y s t e m i c m e d i c a l n e e d s , addit ional st om ach biopsies w ere collect ed from a represent at ive subgroup of 49 subj ect s requiring endoscopy. Follow ing t he prot ocols of t he m edical cent er s, a gast r oent er ologist phy sician collect ed t he st om ach biopsies using an endoscope. Tissue sam ples w ere insert ed int o Eppendorf m icrot ubes cont aining 1 m L of reduced Ringer ’s solut ion and w ere im m ediat ely placed in a polyst yrene box w it h
ice and t hen st ored at low t em perat ures ( - 20° C) unt il processing.
Microbial processing procedures were perform ed as pr ev iously descr ibed5. Each collect ed sam ple
was im m ediat ely condit ioned in a St yrofoam box w it h ice an d t h en st or ed at low t em p er at u r es ( - 8 0 ° C) u n t il pr ocessin g. Th e gen om ic DNA of each sam p l e w as ex t r act ed u si n g Pu r eLi n k ™
*HQRPLF'1$3XUL¿FDWLRQ.LW,QYLWURJHQ&DUOVEDG
CA , USA ) a c c o r d i n g t o t h e m a n u f a c t u r e r ’ s
LQVWUXFWLRQV 3ULRU WR VSHFL¿F PLFURELDO DQDO\VLV
a poly m erase chain r eact ion ( PCR) w as car r ied ou t u sin g u n sp ecif ic “ Un iv er sal p r im er s” ( 1 6 S r RNA) ( 5 ’- GATTAGATACCCTGGTAGTCCAC- 3 ’ and 5’- CCCGGGAACGTATTCACCG- 3’) t o det ect bact erial DNA in the sam ples. After this procedure, the presence of P. gingivalis ( 5’- AGGCAGCTTGCCATACTGCG- 3’ a n d 5 ’ - A C T G T T A G C A A C T A C C G A T G T- 3 ’ ) , A g g r e g a t i b a c t e r a c t i n o m y c e t e m c o m i t a n s ( 5 ’ - A T G C C A A C T T G A C G T T A A A T - 3 ’ a n d 5’-AAACCCATCTCTGAGTTCTTCTTC- 3’) , Parvim onas m i cr a ( 5 ’ - GTAATGATGGGGACTCTGGA- 3 ’ a n d 5 ’- CTTCCTCCTTGCGGTTAGAT - 3 ’) , T. dent icola ( 5 ’ - TA ATA CCGA ATGTGCTCATTTA CAT- 3 ’ a n d 5 ’- TCAAAGAAGCATTCCCTCTTCTTCTTA - 3 ’) , T. f or sy t h ia ( 5 ’- GCGTATGTAACCTGCCCGCA- 3 ’ an d 5’-TGCTTCAGTGTCAGTTATACCT- 3’) , Cam pylobact er r ect u s ( 5 ’-TTTCGGAGCGTAAACTCCTTTTC- 3 ’ an d 5’-TTTCTGCAAGCAGACACTCTT- 3’) , and H. py lor i ( 5 ’ - GAGCGCGTAGGCGGGATAGTC- 3 ’ a n d 5 ’ - CGTTAGCTGCATTACTGGAGA - 3’) was est ablished
XVLQJVSHFL¿FSULPHUVXQGHUVWDQGDUGFRQGLWLRQV
PCR was perform ed using a Mast ercycler Gradient ( Eppendorf, West bury, NY, USA) t herm ocycler as
follow s: one cycle at 94° C for 5 m inut es; 35 cycles at 94° C for 30 seconds, 55- 60° C for 30 seconds,
DQG&IRUPLQXWHDQGD¿QDOF\FOHRI&IRU
5 m inut es. Aft er elect rophoresis in 1.5% agarose gel, t he DNA fragm ent s w ere st ained w it h SYBR Safe ( I nvit rogen, Carlsbad, CA, USA) and visualized
E\ 89 LOOXPLQDWLRQ 7KH 3&5 DPSOL¿FDWLRQV ZHUH
com pared wit h bot h posit ive and negat ive cont rols. A m olecular weight m arker ( Ladder 100, I nvit rogen, Car lsbad, CA, USA) w as added in each set . To ensur e PCR r epr oducibilit y, 20% of t he sam ples
ZHUHUHDPSOL¿HG
St a t ist ica l a n a lysis
The frequency of each bact erium was separat ely evaluat ed in t he sam ples t aken fr om t he saliva and dorsum of t he t ongue. The occurrence of each bact erium in a given subj ect in at least one of t hese sit es was also checked. This last evaluat ion was referred t o as oral represent at ion. An addit ional analysis considering t he red com plex oral bact erial species was also perform ed, t hereby indicat ing t he sim ult aneous presence of P. gingivalis, T. dent icola
The com parison of t he frequencies of bact eria
YHUL¿HGLQWKLVVWXG\ZDVPDGHXVLQJWKH3HDUVRQ
Chi- squar e and Fisher ’s t est . To det er m ine t he si g n i f i ca n ce b e t w e e n g r o u p s, t h e Bo n f e r r o n i cor r ect ion w as ap p lied . Th e ch ar act er ist ics of t he par t icipant s’ var iables w er e descr ibed using f r equ en cy dist r ibu t ion f or cat egor ical v ar iables an d m edian , m ean an d st an dar d dev iat ion f or cont inuous variables. Norm alit y dat a dist ribut ion w as v er if ied by t h e Kolm ogor ov - Sm ir n ov t est . The ANOVA t est was used for variables of norm al dist ribut ion and t he Kruskal-Wallis t est was used for t hose of non- norm al dist ribut ion, follow ed by t he Tukey ’s t est and t he Mann- Whit ney t est for com par isons bet w een gr oups. Test s of accuracy t est ed t he relat ionships bet w een t he st om ach and oral frequencies of each t arget bact erial species.
All st at ist ical t est s w ere perform ed using SSPS ( St at ist ical Pack age for Social Sciences, ver sion 16 for Window s) soft ware ( SPSS I nc., Chicago, I L,
86$DQGFRQVLGHUHGVLJQL¿FDQWIRUSYDOXHV
RESULTS
As ex p ect ed , BMI w as g r eat er am o n g t h e cont rols w hen com pared w it h t he bariat ric groups. I n addit ion, w it hin t he per iodont al gr oups ( w it h
or w it hout periodont it is) , BMI values w ere sim ilar ( Table 1) .
7KH¿UVWVHWRIUHVXOWVGHULYHGIURPWKHPLFURELDO
analysis of oral sam ples. I n periodont it is subj ect s,
P. gingiv alis and T. dent icola ZHUH VLJQL¿FDQWO\
higher in t he saliva sam ples t aken from t he bariat ric group com pared wit h t he cont rol group, suggest ing t hat bariat ric surgery was accom panied by higher salivar y fr equency of t hese t w o species in t his
VSHFL¿F SHULRGRQWDO VWDWXV 7KH %3 JURXS DOVR
showed higher frequency of a t hird periodont opat hic species, T. for sy t hia, but in t he t ongue dor sum inst ead ( Table 2) .
I n t er est in g ly, ev en in t h e n on - p er iod on t it is groups, t he BNP group exhibit ed a higher frequency of C. rect us t han t hat w hich usually precedes t he colon izat ion of t h e m ou t h by t h e r ed com plex species. This bact er ium w as again obser v ed in higher frequency in t he saliva and t ongue sam ples t aken from t he bariat ric group. I ndividuals w it hout
SHULRGRQWLWLV DOVR VKRZHG WKH RQO\ VLJQL¿FDQWO\
r ed u ced f r eq u en cy w h en b ar iat r ic an d con t r ol g r ou p s w er e com p ar ed : P. m icr a ap p ear ed in low er frequency in t he saliva t aken from bariat ric subj ect s.
Fu r t h e r m o r e , t h e a n a l y s i s o f t h e o r a l represent at ion brought a new perspect ive t o t he
CP CNP BP BNP TOTAL p-value
n=35 n=40 n=40 n=39 n=154
Body mass index 41.65±4.70a 40.4 39.89±7.08a 39.6 26.89±4.48b 26.4 26.53±4.23b 25.2 33.53±8.77 32.4 Ȗ Bleeding on probing 28.64±12.08 29 20.33±19.43 14.9 30.26±20.37 23 24.67±22.57 18.7 25.90±19.39 21.75 0.102Ȗ
Plaque index 1.09±0.34 1.04±0.72 1.04±0.48 1.02±0.43 1.05±0.51 0.212*
1.00 0.83 1.00 1.00 1.00
6LWHV3' mm 10.75±5.70c 9.61 1.33±1.27d 0.92 12.72±9.95c 9.72 0.68±0.85d 0.00 6.26±7.93 3.2 6LWHV3' mm 3.44±3.34c 2.67 0.19±0.56d 0.00 4.75±5.52c 1.85 0.12±0.39d 0.00 2.10±3.81 0.00 6LWHV&$/ mm 15.53±10.45c 13.39 3.72±6.73d 1.82 16.31±14.56c 11.25 3.52±5.57d 1.78 9.62±11.66 5.35 6LWHV&$/ mm 6.60±7.49c 3.7 1.99±5.98d 0.00 7.19±9.16c 2.82 0.99±2.09d 0.00 4.13±7.19 0.94 .UXVNDO:DOOLVȖ$QRYDDEORZHUFDVHHTXDOLQWKHVDPHOLQHLQGLFDWHVVWDWLVWLFDOO\VLPLODUGDWDE\7XNH\WHVWFG lowercase equal in the same line indicates statistically similar data by Mann-Whitney test; Bonferroni correction PD – periodontal pocket depth; CAL – clinical attachment level
CP - control group with periodontitis CNP - control group without periodontitis BP - bariatric group with periodontitis BNP - bariatric group without periodontitis
saliva/ t ongue isolat ed result s, since each individual pat ient was considered t hrough posit ive bact erial presence in at least one of t he t w o sam pled sit es. Thus, t he oral represent at ion analysis corroborat ed t he dat a separat ely found in t he saliva and t ongue sam ples for P. gingivalis, T. dent icola, T. forsyt hia, C. rect us, and P. m icra. The bariat ric periodont it is group show ed a higher frequency of P. gingivalis, T. dent icola, T. forsyt hia, and C. rect us. The red
FRPSOH[DQDO\VLVFRQ¿UPHGWKLVRYHUDOOWHQGHQF\
of a higher frequency of t he t arget species in t he m out hs of post operat ive bariat ric subj ect s.
A high oral frequency of H. pylori was observed in t he periodont it is and non- periodont it is groups, bot h in t he saliva and dorsum of t he t ongue, ranging from 40.0% t o 50.0% am ong t he cont rols. Com parisons bet w een t he bariat ric and cont rol group w it h t he sam e periodont al st at us did not reveal st at ist ically
CP CNP BP BNP Total
n=154
p-value
Q Q Q Q Q
Saliva Hp 42.86 (15) 50.00 (20) 35.00 (14) 35.90 (14) 40.91 (63) 0.493*
Pg 5.71 (2)a 7.50 (3) 30.00 (12)a 15.38 (6) 14.94 (23) 0.011*
Aa 2.86 (1) 5.00 (2) 2.50 (1) 0.00 2.60 (4) 0.742Ȗ
Pm 77.14 (27) 65.00 (26) 67.50 (27) 56.41 (22) 66.23 (102) 0.308*
Td 20.00 (7) 7.50 (3)a 35.00 (14)a 25.64 (10) 22.08 (34) 0.027*
Tf 48.57 (17) 47.50 (19) 60.00 (24) 53.85 (21) 52.60 (81) 0.671*
Cr 91.43 (32)a 57.50 (23)a.b 90.00 (36)b 76.92 (30) 78.57 (121) 0.001*
Red Complex 2.86 (1) 2.50 (1) 17.50 (7) 10.26 (4) 8.44 (13) 0.074Ȗ Tongue Hp 40.00 (14) 42.50 (17) 30.00 (12) 23.08 (9) 33.77 (52) 0.239*
Pg 0.00 2.50 (1) 10.00 (4) 10.26 (4) 5.84 (9) 0.120Ȗ
Aa 0.00 2.50 (1) 5.00 (2) 0.00 1.95 (3) 0.619Ȗ
Pm 82.86 (29)d 57.50 (23) 72.50 (29) 51.28 (20)d 65.58 (101) 0.017Ȗ
Td 11.43 (4) 5.00 (2) 17.50 (7) 10.26 (4) 11.04 (17) 0.354Ȗ Tf 45.71(16) 32.50 (13)a 67.5 (27)a 40.00 (16) 46.75 (72) 0.013*
Cr 88.57 (31)a 50.00 (20)a.b 72.50 (29) 82.05 (32)b 72.73 (112) 0.001*
Red Complex 0.00 2.50 (1) 5.00 (2) 2.56 (1) 2.60 (4) 0.903Ȗ
Saliva and Tongue
Hp 42.86 (15) 55.00 (22) 35.00 (14) 41.03 (16) 43.51 (67) 0.330*
Pg 5.71 (2)a 7.50 (3)b 32.50 (13)a.b 20.51 (8) 16.88 (26) 0.005*
Aa 2.86 (1) 5.00 (2) 5.00 (2) 0.00 3.25 (5) 0.654Ȗ Pm 91.43 (32)a 77.50 (31) 87.50 (35) 66.67 (26)a 80.52 (124) 0.031*
Td 20.00 (7) 10.00 (4)a 37.50 (15)a 25.64 (10) 23.38 (36) 0.032*
Tf 60.00 (21) 52.50 (21) 75.00 (30) 58.97 (23) 61.69 (95) 0.204*
Cr 97.14 (34)a 62.50 (25)a.b.c 95.00 (38)b 92.31 (36)c 86.36 (133) Ȗ
Red Complex 2.86 (1) 2.50 (1) 17.50 (7)d 12.82 (5) 8.44 (14) 0.010Ȗ
7HVWFȖ)LVKHUVWHVW5HGFRPSOH[DEFORZHUFDVHHTXDOLQWKHVDPHOLQHLQGLFDWHVVWDWLVWLFDOO\GLIIHUHQWGDWDE\ 3HDUVRQVFWHVWGORZHUFDVHHTXDOLQWKHVDPHOLQHLQGLFDWHVVWDWLVWLFDOO\GLIIHUHQWGDWDE\)LVKHUVWHVW%RQIHUURQL correction
Hp = H. pylori - Pm = P. micra - Cr = C. rectus - Pg = P. gingivalis - Td = T. denticola - Aa =A. actinomycetemcomitans - Tf = T. forsythia
CP - control group with periodontitis CNP - control group without periodontitis BP - bariatric group with periodontitis BNP bariatric group without periodontitis
VLJQL¿FDQWGLIIHUHQFHV7KHDQDO\VLVEDVHGRQWKH RUDOUHSUHVHQWDWLRQFULWHULRQFRQ¿UPHGWKLVODFNRI
difference.
Along w it h t he oral analysis, a second set of result s t hat was derived from t he st om ach biopsies processed in t he laborat ory is furt her present ed.
7KH¿UVWVXUSULVLQJ¿QGLQJZDVWKHJHQHUDOO\KLJK
frequency of w ell- know n periodont al pat hogens in bot h t he bariat ric ( up t o 83.3% ) and cont rol ( up t o 91.7% ) gr oups. I n t he st om ach, despit e t he healt h/ disease st at us of t he periodont ium , nearly
DOOSHULRGRQWDOSDWKRJHQVVKRZHGORZHUVLJQL¿FDQW
frequencies in t he bariat ric group. Thus, in t he long t erm ( at least 24 m ont hs aft er surgery) , bariat ric surgery was accom panied by a reduced frequency of periodont al pat hogens, as w ell as H. pylori in t he st om ach. Hence, bariat ric surgery show ed an
LQYHUVHHIIHFWLQRUDODQGVWRPDFKPLFURELDOSUR¿OHV
Rat h er u n ex p ect ed ly, t h e accu r acy an aly sis ( Table 3) dem onst rat ed t hat t he frequency observed in t he st om ach was sim ilar t o t hat observed in t he m out h. How ever, t he pr esence of H. py lor i was higher in t he st om ach t han in t he m out h, as it was expect ed.
7DEOH VKRZV WKH LQÀXHQFH RIH. py lor i on
t he det ect ion of t he species periodont ally sought . Som e associat ion s bet w een H. py lor i an d or al species w ere found; for exam ple, P. gingivalis, T. dent icola,T. forsyt hia, and C. rect us w ere involved
in t h ese associat ion s. I n t er est in gly, t h ese or al
VSHFLHVZHUHDOVRUHODWHGWRVWDWLVWLFDOO\VLJQL¿FDQW
r esu lt s ob ser v ed in t h e p r ev iou sly con d u ct ed analysis. Am ong t he subj ect s colonized by H. pylori, differences of com bined H. pylori - P. gingivalis ( Hp-Pg) frequency in saliva were found am ong t he groups ( p= 0.033) . This associat ion show ed a t endency f or in cr eased b act er ial occu r r en ce in b ar iat r ic subj ect s w it h periodont it is ( BP group; p= 0.021) . I n periodont it is subj ect s, t he associat ion bet w een
H. pylori and T. forsyt hia ( Hp-Tf ) was higher in t he t ongue sam ples, especially in t he bariat ric group ( BP group; p= 0.006) . The associat ion bet ween H. pylori
and C. rect us ( Hp- Cr) was st at ist ically higher in t he bariat ric groups w it h periodont it is ( BP) t han in t he non- periodont it is bariat ric ( BNP) groups ( p= 0.006) . I n t he previous analysis, C. rect us did not show any
VWDWLVWLFDOO\ VLJQL¿FDQW UHVXOWV DPRQJ LQGLYLGXDOV
w it h per iodont it is. How ever, C. r ect us appear ed again as a key pat hogen in t he non- periodont it is individuals. The associat ion bet w een H. pylori and
C. r ect us (Hp- Cr ) was st at ist ically higher in t he bariat ric group ( BNP; p< 0.001) . Considering t he oral represent at ion, t he dat a previously showed was
FRQ¿UPHG 7KH UHG FRPSOH[ VSHFLHV VWLOO VKRZHG D VLJQL¿FDQWO\ KLJKHU IUHTXHQF\ LQ WKH EDULDWULF JURXS6LJQL¿FDQWGLIIHUHQFHVLQWKHVLPXOWDQHRXV
frequency of H. pylori and periodont al pat hogens in t he st om ach w ere not observed ( dat a not show n) .
CP CNP BP BNP Total
n=154
p-value p- value
Accuracy**
Q Q Q Q Q
Stomach Hp 83.33 (10)a 50.00 (6) 75.00 (9)b 15.38 (2)a.b 55.10 (27) 0.003* *
Pg 58.33 (7) 33.33 (4) 75.00 (9)c 7.69 (1)c 34.69 (17) 0.049Ȗ 0.467Ȗ
Aa 58.33 (7)c 25.00 (3) 41.67 (5) 0.00c 30.61 (15) 0.006Ȗ 0.306Ȗ
Pm 83.33 (10) 91.67 (11)c 83.33 (10) 38.46 (5)c 73.47 (36) 0.015Ȗ 0.650Ȗ
Td 83.33 (10)a 83.33 (10)b 50.00 (6) 15.38 (2)a.b 57.14 (28) 0.001* 0.325Ȗ
Tf 66.67 (8)a 66.67 (8)b 50.00 (6) 7.69 (1)a.b 46.94 (23) 0.008* 0.070Ȗ
Cr 75.00 (9) 83.33 (10)a 83.33 (10)b 30.77 (4)a.b 67.35 (33) 0.018Ȗ 0.073Ȗ
Red Complex
58.33 (7)c 33.33 (4) 41.67 (5) 0.00c 32.65 (16) 0.008Ȗ 0.402Ȗ
7HVW F Ȗ )LVKHUV WHVW $FFXUDF\ WHVW ZLWK RUDO UHSUHVHQWDWLRQ D E ORZHUFDVH HTXDO LQ WKH VDPH OLQH LQGLFDWHV VWDWLVWLFDOO\GLIIHUHQWGDWDE\3HDUVRQVFWHVWFORZHUFDVHHTXDOLQWKHVDPHOLQHLQGLFDWHVVWDWLVWLFDOO\GLIIHUHQWGDWDE\ )LVKHUVWHVW%RQIHUURQLFRUUHFWLRQ
Hp = H. pylori - Pm = P. micra - Cr = C. rectus - Pg = P. gingivalis - Td = T. denticola - Aa =A. actinomycetemcomitans - Tf = T. forsythia
CP - control group with periodontitis CNP - control group without periodontitis BP - bariatric group with periodontitis BNP bariatric group without periodontitis
Wh en ev alu at in g t h e in f lu en ce of ag e an d t obacco use in t he groups, t here were no st at ist ically si g n i f i ca n t d i f f e r e n ce s, e i t h e r i n r e l a t i o n t o bariat ric surgery or t o t he presence or absence of periodont it is.
D I SCUSSI ON
Ev i d en ce su g g est s a t w o - w ay r el at i o n sh i p b et w een p er i o d o n t al d i sease an d o b esi t y2 0 , 2 2.
I n addit ion, a previous st udy t hat analyzed 345 subj ect s undergoing bariat ric surgery showed a high prevalence of periodont it is, ranging from 70.69% t o 91.66% of individuals before and aft er bariat ric surgery23. Up t o now, few st udies had evaluat ed
CP CNP BP BNP Total p-value
Q Q Q Q Q
Saliva Q Q Q Q Q
Pg 6.67 (1) 0.00 (0) 28.57 (4) 14.29 (2) 11.11 (7) 0.033Ȗ Aa 6.67 (1) 10.00 (2) 7.14 (1) 0.00 (0) 6.35 (4) 0.901*
Pm 86.67 (13) 55.00 (11) 71.43 (10) 57.14 (8) 66.67 (42) 0.195Ȗ Td 20.00 (3) 5.00 (1) 14.29 (2) 28.57 (4) 15.87 (10) 0.315Ȗ
Tf 60.00 (9) 30.00 (6) 42.86 (6) 57.14 (8) 46.03 (29) 0.261*
Cr 80.00 (12) 50.00 (10) 85.71 (12) 71.43 (10) 69.84 (44) 0.133Ȗ Red Complex 0.00 (0) 0.00 (0) 0.00 (0) 14.29 (2) 3.17 (2) 0.093Ȗ
Tongue Q Q Q Q Q
Pg 0.00 (0) 0.00 (0) 16.67 (2) 0.00 (0) 3.85 (2) 0.077Ȗ
Aa 0.00 (0) 5.88 (1) 16.67 (2) 0.00 (0) 5.77 (3) 0.337Ȗ Pm 78.57 (11) 64.71 (11) 83.33 (10) 44.44 (4) 69.23 (36) 0.231Ȗ
Td 14.29 (2) 5.88 (1) 8.33 (1) 0.00 (0) 7.69 (4) 0.821Ȗ
Tf 50.00 (7) 23.53 (4)a 75.00 (9)a 33.33 (3) 44.23 (23) 0.043Ȗ
Cr 78.57 (11)a 29.41 (5)a.d 75.00 (9) 100.00 (9)d 65.38 (34) 0.001Ȗ
Red Complex 0.00 (0) 0.00 (0) 0.00 (0) 0.00 (0) 0.00 (0)
-Saliva and Tongue
Q Q Q Q Q
Pg 6.67 (1) 0.00 (0)a 35.71 (5)a 25.00 (4) 14.93 (10) 0.005Ȗ
Aa 6.67 9.09 (2) 14.29 (2) 0.00 (0) 7.46 (5) 0.458Ȗ
Pm 93.33 (14) 77.27 (17) 92.86 (13) 75.00 (12) 83.58 (56) 0.365Ȗ
Td 20.00 (3) 9.09 (2) 21.43 (3) 25.00 (4) 17.91 (12) 0.572Ȗ
Tf 73.33 (11) 40.91 (9) 71.43 (10) 56.25 (9) 58.21 (39) 0.161*
Cr 93.33 (14)a 40.91 (9)a.b.c 92.86 (13)b 100.00 (16)c 77.61 (22) Ȗ
Red Complex 0.00 (0)a 0.00 (0)b 0.00 (0)c 18.75 (3)a.b.c 4.48 (3) 0.029Ȗ
7HVWFȖ)LVKHUVWHVW5HGFRPSOH[DEFORZHUFDVHHTXDOLQWKHVDPHOLQHLQGLFDWHVVWDWLVWLFDOO\GLIIHUHQWGDWD E\3HDUVRQVFWHVWGORZHUFDVHHTXDOLQWKHVDPHOLQHLQGLFDWHVVWDWLVWLFDOO\GLIIHUHQWGDWDE\)LVKHUVWHVW%RQIHUURQL correction
Hp = H. pylori - Pm = P. micra - Cr = C. rectus - Pg = P. gingivalis - Td = T. denticola - Aa =A. actinomycetemcomitans - Tf = T. forsythia
CP - control group with periodontitis CNP - control group without periodontitis BP - bariatric group with periodontitis BNP bariatric group without periodontitis
t he r elat ionship bet w een per iodont al pat hogens
DQG REHVLW\ WKHUHIRUH WKH SUHVHQW ¿QGLQJV RI
t he st udy ar e par t icular ly r ev ealing. A r elevant and high frequency of periodont al pat hogens and
H. pylori in bot h oral and st om ach environm ent s
w as d em on st r at ed . Th e h ig h f r eq u en cy of H.
pylori observed was expect ed8. How ever, t he high
occurrence of oral species in t he st om ach was rat her int riguing.
I t has been suggest ed t hat obesit y in hum ans can incr ease t he r isk of per iodont it is21 and also
WKDWRUDOELR¿OPVSOD\DIXQGDPHQWDOUROHLQRUDO
sy st em ic m edicin e2 7. Haf f aj ee an d Socr an sk y1 1
IRXQG D VLJQL¿FDQWO\ KLJKHU IUHTXHQF\ RI
T. for sy t hia in obese indiv iduals w it h gingiv it is. Moreover, Goodson, et al.10 ( 2009) found changes
in t he salivary bact erial com posit ion in overw eight w om en w hile Mat sushit a, et al.17 ( 2015) report ed
t hat t he r ed com plex bact er ial species, i. e., P. g in g iv alis, T. d en t icola, an d T. f or sy t h ia, ar e associat ed w it h obesit y. I n our st udy, t he presence of T. for sy t hia ( up t o 72.2% ) , P. gingiv alis ( up t o 30.0% ) , T. dent icola ( up t o 35.0% ) , C. rect us
( up t o 91.4% ) , and P. m icra ( up t o 82.9% ) w ere
YHUL¿HG LQ KLJK IUHTXHQF\ LQ WKH PRXWK RI WKH
bariat ric and cont rol groups. The only periodont al species t hat was always observed in low frequency ( u p t o 5 . 0 % ) w as A. act in om y cet em com it an s.
$OWKRXJKWKHVH¿QGLQJVDUHQRWQHZWKHSUHVHQW
st udy is able t o corroborat e t he aforem ent ioned
WKHRU\LQZKLFKREHVLW\PRGL¿HVWKHLPPXQHKRVW
r esp on se, w h ich , t h er ef or e, in f lu en ces h u m an m icrobiot a. According t o Nagpal, et al.20 ( 2015) ,
t he penet rat ion of periodont al pat hogens or t heir product s in lam ina propria m ay lead t o endot oxem ia
DQGWRDVWDWHRIV\VWHPLFFKURQLFLQÀDPPDWLRQ
This st at e m ay furt her affect t he expression and f u n ct ion in g of im p or t an t im m u n oin f lam m at or y m olecules, t hereby cont ribut ing t o alt ered lipid and glucose m et abolism s. I n our st udy, t he bariat ric group show ed an increased frequency of t he red
FRPSOH[VSHFLHV7KHVH¿QGLQJVDVZHOODVWKRVHRI
Haffaj ee and Socransky11 ( 2009) , suggest t he need
for longit udinal m onit oring of obese pat ient s, since t hese bact eria play a key role in t he developm ent and progression of periodont al disease. I t is know n t h at w eig h t r ed u ct ion m ay b en ef it ov er w eig h t an d ob ese p eop le in p ar t icu lar, m ain ly d u e t o
WKH DVVRFLDWHG UHGXFWLRQ LQ WKHLU LQÀDPPDWRU\
responses4, but also because it can posit ively im pact
t heir per iodont ium20,25. Fur t her m or e, the cont r ol
of com orbidit ies, such as diabet es, could also lead t o a r educt ion of per iodont al pat hogens. I n t he present st udy, m ost of t he t arget species appeared in great er num bers in t he bariat ric group, and t hey w ere even m ore evident am ong individuals w it h periodont it is. However, it is im port ant t o em phasize t h at t h e in t en se an d pr ogr essiv e ch an ges t h at
RFFXUGXULQJWKH¿UVWIHZ\HDUVDIWHUWKHVXUJHU\
could delay t he est ablishm ent of t he oral m icrobial
SUR¿OH8QIRUWXQDWHO\GHVSLWHWKHV\VWHPLFEHQH¿WV
of bariat ric surgery, oral disorders, such as t he loss of per iodont al t onus, bleeding, hy per sensit iv it y and xerost om ia, have been relat ed t o t his form of t reat m ent for obesit y.
One surprising observat ion of t his st udy was t he high frequency of periodont al pat hogens present in t he biopsies of st om ach t issue, w it h som e bact erial frequency reaching over 90% . Even species such as A. act in om y cet em com it an s ( 5 8 . 3 % ) , w h ich is som et im es only found in low num ber s in t he m out h, w ere com m only det ect ed in t he st om ach. I n addit ion, alt hough m any H. pylori infect ions are t reat ed before surgery using syst em ic ant ibiot ics, in our st udy t his m icr oor ganism was fr equent ly found in st om achs and in t he m out hs of t he bariat ric and cont r ol gr oups. Overall, longit udinal st udies are required t o furt her elucidat e oral and st om ach
EDFWHULDOSUR¿OHVLQUHVSRQVHWREDULDWULFVXUJHU\
I n ad d i t i on , f u t u r e l on g i t u d i n al st u d i es cou l d invest igat e periodont it is in obese pat ient s before and aft er bar iat r ic sur ger y. Cur r ent ly, long- t er m st udies on t he t opic are scarce. I n an unselect ed populat ion based on per iodont al st at us, Jaiswal, et al.12 ( 2015) failed t o report pocket dept h and
clinical at t achm ent level im provem ent s in a six-m ont h six-m onit or ing per iod aft er bar iat r ic sur ger y. Sim ilar ly, Sales- Per es, et al.24 ( 2015) obser v ed
w or sen ed m easu r em en t s of p ock et d ep t h an d clinical at t achm ent levels six m ont hs aft er bariat ric su r g er y, alon g sid e an in cr eased am ou n t of P. gingivalis.
Alt hough t he prim ary sit e of H. pylori colonizat ion i s t h e st o m ach , t h e m o u t h al so h ar b o r s t h i s pat hogen, even if t em porarily, m ainly in individuals wit h chronic gingivit is or periodont it is2,9,28. Thus, t he
oral cavit y could represent an ext ragast ric reservoir of H. p y lor i9 , 2 8. I n t er est in g ly, t h e p r of ession al
FRQWURORIGHQWDOELR¿OPLVDVVRFLDWHGZLWKORZHU
gast ric reinfect ion of H. pylori. I n a st udy involving 1 1 0 i n d i v i d u al s, o n l y 1 9 . 6 % o f p at i en t s w h o
UHFHLYHGRUDOELR¿OPFRQWUROZHUHUHLQIHFWHGE\H.
pylori com pared w it h 84.3% of pat ient s w it hout
SURIHVVLRQDOELR¿OPFRQWURO13. I n our st udy, t here
was a high frequency of H. pylori in t he subj ect s’ st o m ach s ( f r o m 1 5 . 3 t o 8 3 . 3 % ) , sal i v a, an d t on gu es ( f r om 3 0 . 0 t o 5 0 . 0 % ) . I n t h e con t r ol group, individuals w ho harbored t his bact erium in t he st om ach w ere m ore likely t o carry it in t heir m out hs as w ell. These pat ient s w ere probably not successfully t reat ed for H. pylori infect ion and t hey had higher BMI s t han individuals from t he bariat ric
JURXS2XU¿QGLQJVFRQ¿UPSUHYLRXVUHSRUWVRID
higher pr evalence of H. pylor i in obese pat ient s t han in non- obese pat ient s1. Erim , et al.8 ( 2008)
w ere 1.7 t im es m ore likely ( 95% CI , 1.3 - 2.2) t o dem onst rat e H. pylori infect ion. I n general t erm s, our st udy show ed a sim ult aneous fr equency of H. pylori and periodont al pat hogens in bot h t he periodont it is groups and in t he bariat ric groups.
Test s of accu r acy b et w een t h e p r esen ce of periodont al pat hogens in t he st om ach and m out h
ZHUHQRWVWDWLVWLFDOO\VLJQL¿FDQW7KHVWRPDFKLVWKH
prim ary sit e of H. pylori, w hich can help explain it s st at ist ically higher frequency in t he st om ach t han in t h e m ou t h . Sim ilar ly, per iodon t al pat h ogen s dem onst rat ed higher frequency in t heir prim ary oral sit es w hen com pared w it h t he st om ach.
The relat ionship bet w een m icroorganism s and obesit y is not yet well underst ood. This com plex and int riguing relat ionship reveals several possibilit ies in
DZLGH¿HOGRIUHVHDUFK7KHUHIRUHIXWXUHUHVHDUFK WRH[DPLQHKRZRUDOEDFWHULDFDQLQÀXHQFHREHVLW\
is st r on gly r ecom m en ded. Fin ally, t h e possible m ou t h - st om ach r ou t e h igh ligh t ed in t h is st u dy d r aw s at t en t ion t o ot h er w ay s f or p er iod on t al pat hogens t o m igrat e from oral t o syst em ic sit es. I t is im port ant t o consider t hat t his rout e is not necessarily dependent on t he diseased epit helium
IRXQGLQWKHZDOOVRILQÀDPHGJLQJLYDOSHULRGRQWDO
pocket s. Once m ore, t he m aint enance of local healt h and cont rol of oral m icrobiot a appear t o im pact a person’s syst em ic healt h. Considering t he possible
LGHQWL¿FDWLRQRI'1$IURPQRQYLDEOHEDFWHULDWKH
aut hors also suggest t he use of a sam ple analysis u sin g differ en t m icr obial t ech n iqu es, especially qu an t it at iv e on es. How ev er, u n der t h e cor r ect con dit ion s, a sm all bact er ial f r agm en t or ev en bact erial product s could init iat e and/ or sust ain an
LQÀDPPDWRU\UHVSRQVH
Som e lim it at ion s of ou r st u dy, su ch as t h e u se of a con v en ien ce sam p le, sh ou ld also b e m en t ion ed . Th e m ost ob v iou s cr it icism ab ou t convenience sam pling is t hat t he sam ple is not r epr esen t at iv e of t h e en t ir e popu lat ion , w h ich lim it s dat a generalizat ion. I n addit ion, because of t heir overall com prom ised syst em ic condit ion, t he exclusion of m orbidly obese part icipant s could have im pact ed t he result s draw n from t he present st udy, alt hough w e cannot presum e t o know w hat t ype of m icrobial int eract ions am ong oral bact eria
and H. py lor i w ould be ex pect ed in t his gr oup.
Moreover, a great er num ber of st om ach biopsies sh ou ld b e m icr ob iolog ically an aly zed b y u sin g quant it at ive t echniques t o det erm ine any infect ive p at t er n s. Som e of t h e lim it at ion s ob ser v ed in t he st udy could be cor r ect ed in fut ur e r esear ch by r an dom ly select in g obese pat ien t s t o m or e accurat ely represent t he ent ire populat ion and by including ot her degrees of obesit y and quant ifying bact erial levels.
Our st udy suggest s t hat t he st om ach, alt hough a different environm ent from t he oral cavit y, can
KDUERUVSHFL¿FRUDOEDFWHULD)RUQRZZHGRQRW
k now w het her oral bact er ia in t he st om ach ar e able t o m igrat e t o ot her part s of t he body and if periodont al pat hogens can cont ribut e t o st om ach disease in obese or bar iat r ic su r gically t r eat ed individuals. The result s of t his st udy show ed t hat obese individuals had higher levels of periodont al p at h og en s an d H. p y lor i in b ot h t h eir m ou t h s and st om achs. I t is clear t hat bar iat r ic sur ger y h a s i n f l u e n ce d b a ct e r i a l f r e q u e n cy i n t h e se environm ent s, but t he changes t hat occur aft er t he surgery seem t o t rigger dist inct ive effect s in t he m out h and in t he st om ach.
CON CLUSI ON S
Bariat ric surgery show ed an inverse m icrobial effect on oral and st om ach environm ent s and was accom panied by higher oral and low er st om ach bact erial frequencies.
ACKN OW LED GEM EN TS
Th is st u d y w as su p p or t ed b y a g r an t f r om t he Coordinat ion for t he I m provem ent of Higher Educat ion Personnel ( CAPES) , t he Nat ional Council
IRU6FLHQWL¿FDQG7HFKQRORJLFDO'HYHORSPHQW&13T
t he Minas Gerais Research Foundat ion ( FAPEMI G grant No. 15354) , and t he São Paulo Resear ch Foundat ion ( FAPESP grant No. 2010/ 20424- 1) . I t was also support ed by t he Product ivit y Research
)HOORZV34IURPWKH1DWLRQDO&RXQFLORI6FLHQWL¿F
and Technological Developm ent ( CNPq) .
The aut hors w ish t o t hank Dr. Marcelo Gom es Gir undi, Dr. Ot av iano August o de Paula Fr eit as, Dr. Dew ey Jose de Alm eida Guim arães, Aline Silva Miranda, and t he Traum a One st aff.
R
EFEREN CES
$UVODQ($WLOJDQ+<DYDúR÷OX,7KHSUHYDOHQFHRI+HOLFREDFWHU
pylori in obese subj ect s. Eur J I nt ern Med. 2009; 20: 695- 7. 2- Bharat h TS, Reddy MS, Dhanapal R, Raj Kum ar NG, Neeladri Raj u P, Sar asw at h i T. Molecu lar det ect ion an d cor elat ion of Helicobact er py lor i in den t al plaqu e an d gast r ic biopsies of dyspept ic pat ient s. J Oral Maxillofac Pat hol. 2014; 18: 19- 24. 3- Belst røm D, Holm st rup P, Nielsen CH, Kirkby N, Twet m an S,
+HLWPDQQ%/HWDO%DFWHULDOSUR¿OHVRIVDOLYDLQUHODWLRQWRGLHW
lifest y le fact or s, an d socioecon om ic st at u s. J Oral Micr obiol. 2014; 6. Available from : ht t p: / / dx.doi.org/ 10.3402/ j om .v6.23609. 4- Boesing F, Pat iño JS, Silva VR, Moreira EA. The int erface bet ween obesit y and periodont it is w it h em phasis on oxidat ive st ress and
LQÀDPPDWRU\UHVSRQVH2EHV5HY
5- Cort elli JR, Aquino DR, Cort elli SC, Fernandes CB, Carvalho-Filho J, Franco GC, et al. Et iological analysis of init ial colonizat ion o f p er i o d o n t a l p a t h o g en s i n o r a l cav i t y. J Cl i n Mi cr o b i o l . 2008; 46: 1322- 9.
7- Dalla Vecchia CF, Susin C, Rösing CK, Opperm ann RV, Albandar JM. Overw eight and obesit y as risk indicat ors for periodont it is in adult s. J Periodont ol. 2005; 76: 1721- 8.
8- Erim T, Cruz- Correa MR, Szom st ein S, Velis E, Rosent hal R. Prevalence of Helicobact er pylori seroposit ivit y am ong pat ient s undergoing bariat ric surgery: a prelim inary st udy. World J Surg. 2008; 32: 2021- 5.
9- Gonçalves LS, Sout o R, Colom bo AP. Det ect ion of Helicobact er py lor i, En t er ococcu s f aecalis, an d Pseu dom on as aer u gin osa
LQ WKH VXEJLQJLYDO ELR¿OP RI +,9LQIHFWHG VXEMHFWV XQGHUJRLQJ
HAART w it h chronic periodont it is. Eur J Clin Microbiol I nfect Dis. 2009; 28: 1335- 42.
10- Goodson JM, Groppo D, Halem S, Carpino E. I s obesit y an oral bact erial disease? J Dent Res. 2009; 88: 519- 23.
11- Haffaj ee AD, Socransky SS. Relat ion of body m ass index, p er i o d o n t i t i s an d Tan n er el l a f o r sy t h i a. J Cl i n Per i o d o n t o l . 2009; 36: 89- 99.
12- Jaiswal GR, Jain VK, Dhodapkar SV, Kum at halli KI , Kum ar
51HPDZDW$HWDO%DULDWULFVXUJHU\DQGGLHWPRGL¿FDWLRQRQ
periodont al st at us: a six m ont h cohort st udy. J Clin Diagn Res. 2015; 9: ZC43- 5.
13- Jia CL, Jiang GS, Li CH, Li CR. Effect of dent al plaque cont rol on infect ion of Helicobact er pylori in gast ric m ucosa. Tex Dent J. 2012; 129: 1069- 73.
14- Jort h P, Turner KH, Gum us P, Nizam N, Buduneli N, Whit eley M. Met at ranscr ipt om ics of t he hum an oral m icr obiom e dur ing healt h and disease. M Bio. 2014; 5: e01012- 4.
15- López NJ, Sm it h PC, Gut ierrez J. Higher risk of pret erm birt h and low birt h w eight in w om en w it h periodont al disease. J Dent Res. 2002; 81: 58- 63.
1 6 - Mat su d a M, Sh i m o m u r a I . I n cr eased ox i d at i v e st r ess in ob esit y : im p licat ion s f or m et ab olic sy n d r om e, d iab et es, hypert ension, dyslipidem ia, at herosclerosis, and cancer. Obes Res Clin Pract . 2013; 7: e330- 41.
17- Mat sushit a K, Ham aguchi M, Hashim ot o M, Yam azak i M, Yam azaki T, Asai K, et al. The novel associat ion bet w een r ed com plex of oral m icrobe and body m ass index in healt hy Japanese: a populat ion based cross- sect ional st udy. J Clin Biochem Nut r. 2015; 57: 135- 9.
18- Moura- Grec PG, Marsicano JA, Carvalho CA, Sales- Peres SH. Obesit y and periodont it is: syst em at ic review and m et a- analysis. Cien Saude Colet . 2014; 19: 1763- 72.
19- Musella M, Milone M, Gaudioso D, Bianco P, Palum bo R, Galloro G, et al. A decade of bariat ric surgery. What have w e learned? Out com e in 520 pat ient s from a single inst it ut ion. I nt J Surg. 2014; 12( Suppl 1) : S183- 8.
20- Nagpal R, Yam ashiro Y, I zum i Y. The t w o- way associat ion of per iodont al infect ion w it h syst em ic disor der s: an over view.
0HGLDWRUV,QÀDPP
21- Nascim ent o GG, Leit e FR, Do LG, Per es KG, Cor r ea MB, Dem arco FF, et al. I s w eight gain associat ed w it h t he incidence of periodont it is? A syst em at ic review and m et a- analysis. J Clin Periodont ol. 2015; 42: 495- 505.
22- Pat ar o AL, Cost a FO, Cor t elli SC, Cor t elli JR, Abr eu MH, Cost a JE. Associat ion bet w een severit y of body m ass index and periodont al condit ion in w om en. Clin Oral I nvest ig. 2012; 16: 727-34.
23- Pat aro Al, Cost a FO, Cort elli SC, Cort elli JR, Souza AC, Abreu
0+ HW DO ,QÀXHQFH RI REHVLW\ DQG EDULDWULF VXUJHU\ RQ WKH
periodont al condit ion. J Periodont ol. 2012; 83: 257- 66.
24- Sales- Peres SH, Moura- Grec PG, Yam ashit a JM, Torres EA, Dionísio TJ, Leit e CV, et al. Periodont al st at us and pat hogenic bact eria aft er gast ric bypass: a cohort st udy. J Clin Periodont ol. 2015; 42: 530- 6.
25- Shim azaki Y, Egam i Y, Mat subara T, Koike G, Akifusa S, Jingu
6HWDO5HODWLRQVKLSEHWZHHQREHVLW\DQGSK\VLFDO¿WQHVVDQG
periodont it is. J Periodont ol. 2010; 81: 1124- 31.
2 6 - Siln ess J, Löe H. Per iod on t al d isease in p r eg n an cy. I I . Correlat ion bet w een oral hygiene and periodont al condit ion. Act a Odont ol Scand. 1964; 22: 121- 35.
6LQWLP+2*UVR\8.%LR¿OPVDV³FRQQHFWRUV´IRURUDODQG
syst em s m edicine: a new opport unit y for biom arkers, m olecular t arget s, and bact erial eradicat ion. OMI CS. 2016; 20( 1) : 3- 11. 28- Suzuki N, Yoneda M, Nait o T, I wam ot o T, Masuo Y, Yam ada K, et al. Det ect ion of Helicobact er pylori DNA in t he saliva of pat ient s com plaining of halit osis. J Med Microbiol. 2008; 57: 1553- 9. 29- World Healt h Organizat ion. Obesit y: prevent ing and m anaging t he global epidem ic - Report of a WHO Consult at ion. Geneva: WHO; 2000. 252 p.