• Nenhum resultado encontrado

1, 100 bp DNA ladder; Lane 2, PCR product (275 bp) for

N/A
N/A
Protected

Academic year: 2019

Share "1, 100 bp DNA ladder; Lane 2, PCR product (275 bp) for"

Copied!
7
0
0

Texto

(1)

www .e l s e v i e r . c o m / l o c a t e / b j i d

The

Brazilian

Journal

of

INFECTIOUS

DISEASES

Original

article

Detection

of

E.

coli

O157:H7

and

Shigella

dysenteriae

toxins

in

clinical

samples

by

PCR-ELISA

Jafar

Amani

a

,

Askary

Ahmadpour

a

,

Abbas

Ali

Imani

Fooladi

a,∗

,

Shahram

Nazarian

b

aAppliedMicrobiologyResearchCenter,BaqiyatallahUniversityofMedicalSciences,Tehran,Iran

bImamHossainUniversity,FacultyofScience,DepartmentofBiology,Tehran,Iran

a

r

t

i

c

l

e

i

n

f

o

Articlehistory:

Received14October2014 Accepted21February2015 Availableonline21April2015

Keywords:

Shigelladysenteriae

E.coliO157:H7

PCR-ELISA

Diagnosticmethods

a

b

s

t

r

a

c

t

Shigatoxinproducing bacteriaare potentialcauses ofserioushumandisease suchas hemorrhagiccolitis,severeinflammationsofileocolonicregionsofgastrointestinaltract, thrombocytopenia,septicemia, malignantdisorders inurinaryducts, hemolyticuremic syndrome(HUS).Shiga toxin1(stx1),shigatoxin2(stx2),ora combinationofbothare responsibleformostclinicalsymptomsofthesediseases.Alotofmethodshavebeen devel-opedsofartodetectshigatoxinssuchascellculture,ELISA,andRFPLA,butduetohighcosts andlabortimeinadditiontolowsensitivity,theyhavenotreceivedmuchattention.Inthis study,PCR-ELISAmethodwasusedtodetectgenesencodingshigatoxins1and2(stx1and stx2).Todetectstx1andstx2genes,twoprimerpairsweredesignedforMultiplex-PCRthen PCR-ELISA.PCRproducts(490and275,respectively)weresubsequentlyverifiedby sequenc-ing.SensitivityandspecificityofPCR-ELISAmethodweredeterminedbyusinggenome serialdilutionandEnterobacteriastrains.PCR-ELISAmethodusedinthisstudyprovedtobe arapidandpreciseapproachtodetectdifferenttypesofshigatoxinsandcanbeusedto detectbacterialgenesencodingshigatoxins.

©2015ElsevierEditoraLtda.Allrightsreserved.

Introduction

Shigatoxinsbelongtoalargefamilyofbacterialtoxinswith two major groups, stx1 and stx2.1 These virulence factors aremainlyproducedbyShigelladysenteriaeandShigatoxigenic group ofEscherichia colilike E. coli O157:H7 which are able tocauseinfectious diseases.2,3 ThetoxinisoneoftheAB

5

toxins and hasbinding (B) and catalytic domains (A). The pentamericBsubunitofthetoxinisresponsibleforreceptor

Correspondingauthorat:AppliedMicrobiologyResearchCenter,BaqiyatallahUniversityofMedicalSciences,VanakSq.MolasadraSt.,

P.O.Box19395-5487,Tehran,Iran.

E-mailaddress:imanifouladi.a@gmail.com(A.A.ImaniFooladi).

bindingandintracellulartraffickingoftheholotoxins.4The toxinbindstoGb3locatedoncellsurfacesandisintroduced by endocytic uptake. N-glycosidase activity of the A sub-unit inhibits protein synthesis in the cell and causes cell death.5Insomecellsthesetoxinsalsotriggercytokine syn-thesis and induce apoptosis, which is caused by ribotoxic stress.6 The gene encoding toxin in Shigella dysenteriae is chromosomal.HoweverstxgeneinE.coliO157:H7is associ-atedwithaprophage.7Differentsubtypesofshigatoxinare identifiedasstx1,stx1c,stxfc,stx2,stx2e,stx2dandstx2g.8

http://dx.doi.org/10.1016/j.bjid.2015.02.008

(2)

Infections by shiga toxins producing bacteria have world-wideprevalenceandarewidespreadindevelopingcountries suchassouth-easternAsiancountries,Indiansubcontinent, SouthAfrica,centralAsia,andBangladesh.9InfectionofShiga toxin producing bacteria is a major health concern even in developed countries all over the world. These bacteria are potentialcause ofdiarrhea,hemorrhagic colitis,severe inflammationsofileocolonic regionsofthegastrointestinal tract,thrombocytopenia,septicemia,centralnervoussystem (CNS)involvement,malignantdisordersinurinaryducts,and hemolyticuremic syndrome(HUS).10 urinarytractinfection byEHECismainlygeneratedbyE.coliO157.Inchildrenunder fiveyearsoldandadultsover60,astheyhavethereceptor, itcauseskidneyfunctiondeficiencyandhasadeathrateof 5–10%.11 Cows,goatsand other animalscannaturally bea sourceofstxproducingE.coliandotheranimalssuchascrabs alsoplayarole initstransfer.12 Transferbetweenhumans canalsotakeplace.13Sinceshigatoxinscausemanydiseases, especiallyinchildrenandimmunocompromisedelderly peo-ple,arapidandsensitivediagnosticmethodwithprognostic informationwould berather useful.So far,many different detectionmethodssuchascellculture,serologicaland molec-ularmethodssuchasRPLA,real-time,PCR,hybridizationhave beenutilizedtodetectshigatoxinsortheirrespectivegenes.14 Yet,allthesemethodshavetheirownshortcomingsasthey are time-consuming, quite costly and have limitations in handlingmanysamplessimultaneously.Atpresent,although molecularmethodssuchas PCRandhybridization, despite beingless time-consuming,less costly,andmoresensitive, theyare notsuitable astheyrelyon agarose electrophore-siswithcarcinogenethidiumbromide,amajorhealththreat forlabpersonnel,anddoesnotallowanalysisofmany sam-plesatatimeincaseofepidemicbreakouts.15Nevertheless, real-timePCRdespite100%specificityandhighsensitivityhas notgainedmuchattentionbecauseofhighcostsof fluores-centmaterialandshortageofexpertpersonnel.16Toovercome shortcomingsoftheaforementionedmethods,PCR-ELISAis anappropriatealternativeapproachfordetectingstxgenes, whichissafeandnon-radioactive.PCR-ELISAismore conve-nientforrapidand reliabledetection and quantificationof pathogen-specificgene sequences.17,18 Besideshavingbeen usedinmedicalandfoodindustries,PCR-ELISAhasalsobeen usedintheveterinaryindustry.19

Inthis study,specific primersand probes forstx genes, amplificationandlabelingofproductsDIG-dUTP, hybridiza-tion ofstreptavidinwith biotinylatedprobes and detection with antibody against conjugated digoxigenin and peroxi-daseinmicrotiterplatesweredesigned.Weidentifiedspecific sequencesofstxgenesinalargenumberofsamplesusing smallamountssimultaneouslywithconsiderablesensitivity andshortturnaroundtime.

Materials

and

methods

Bacterialstrains

ShigelladysenteriaeandE.coliO157:H7strainswereprovided

fromShahedUniversity,Tehran,IranandPseudomonas

aeru-ginosa, Salmonellatyphimurium,Salmonellaparatiphi, Klebsiella

pneumoniaandVibriocholerastrainswereprovidedby

Baqiy-atallah University of Medical Sciences, Tehran, Iran. The strainswereverifiedbybiochemicalandimmunologic meth-ods.

ExtractionofbacterialgenomicDNA

ToextractgenomicDNAfrom ShigelladysenteriaeandE.coli O157:H7bacteriawereincubatedinliquidLBmediumfor18h in 37◦C.Bacterial culture was centrifuged in 3000rpmfor

5min.Thepelletwasresuspendedin300␮LTEbufferfollowed bylysissolutioncontaining10␮Llysozyme(10mg/mL),200␮L SDS20%,3␮LproteinaseKandincubatedin37◦Cfor60min.

DNAwaspurifiedbyextractionwithanequalvolumeof phe-nol/chloroform/isoamylalcohol(25:24:1)inthepresenceof5M sodiumperchlorate.A1/10volumeof3Msodiumacetateand 2volumesofabsoluteethanolwereaddedandincubatedin −20◦Cfor13h.Thegenomewaspelletedbycentrifugation, washed with70% ethanol and dried.Finally, DNA samples weredissolvedin100␮LTEbufferand,toeliminateRNA,3␮L RNaseAwasaddedandthetubeswereincubatedin37◦Cfor

30min.

Theconcentration andpurityofthe DNAsampleswere determinedspectrophotometricallyatA260andA280by Nan-oDrop2000,ThermoScientific(USA).

Primerandprobedesign

Todesignprimers andthe nucleic-acid sequencingprobes, centralpartsofshigatoxingeneswereusedastemplate. Fea-turesinthedesignedprimerssuchasGCcontent;Tm,G,etc. were checkedbyDNASISand Oligo7softwares.Theprimer andprobesequencesareillustratedinTable1.The oligonu-cleotidesweresuppliedbyCinnaClone(IRAN).

Isolationandamplificationofstx1andstx2genesbyPCR

PCRreagentsinafinalvolumeof25␮Lincluded: 1␮L tem-plateDNA,0.5␮LTaqDNApolymerase(5U/␮L),1␮Lofeach primer(10pmol/␮L),1␮LdNTPmixture,2.5␮L10×PCRbuffer, 1.5␮LMgCl2(50mM)and16.5␮LsterileDDW.Thermalcycling

ofamplificationmixturewasperformedin30cycles.20 ThePCRprogramwas carriedout at94◦Cfor3min

fol-loweddenaturingfor45sat94◦C,annealingfor45sat59C

and an extension for 1min at 72◦C. The final extension

was at72◦C for5min. PCRproductswere electrophoresed

in 1%agarosefollowed bystainingwithethidium bromide

(0.5␮g/mL) then visualized under ultraviolet light, and the

resultswererecordedbyphotography.PCRproductswere ver-ifiedbysequencing.ForlabelingofPCRproducts,thereaction ofPCRwas performedbydNTP mixturecontaining digoxi-geninlabelingmix(DigoxigenindNTPs,Roche,Germany)with thesamecondition.

DetectionofPCRproductsbyELISA

(3)

Table1–PCRprimersandhybridizationcaptureprobeforstx1andstx2genes.

Oligonucleotide Sequence Nucleotideposition Expectproductsize(bp)

Ahstx1F TTGTTTGCAGTTGATGTCAGAGG 210–233 275

Ahstx1R CAGGCAGGACACTACTCAACCTTC 676–700

Ahstx2F TTGCTGTGGATATACGAGGGC 214–235 490

Ahstx2R CGCCAGATATGATGAAACCAGTG 466–489

pStx1 Biotin-TGTTGCAGGGATCAGTCGTACG 422–444 –

pStx2 Biotin-CATATATCAGTGCCCGGTGTG 355–376 –

productofstx1 andstx2geneswere addedto90␮L1×SSC

bufferin1.5mLtubesandincubatedinboilingwaterfor10min andthen5minonice.Inthenextstep,10␮Lofstx1andstx2

probeswereaddedtoeachtubeandafter2hin60◦C,100L

fromthishybridizationsolutionwereaddedtoeachwelland after1hin37◦C,itwaswashedwith20%BPSTbuffer3times.A

1/1000solutionofanti-digoxigeninantibodyconjugatedwith peroxidesinPBSTbufferwaspreparedand100␮Lofthis

solu-tionwasaddedtoeachwell(includingcontrols)andafter1h in37◦Ctheplateswerewashedanddriedasdescribed

ear-lier.100␮Lofsubstratesolution(2mgOPD,100␮Ldetection

buffer,5␮L30%hydrogenperoxide)wasaddedtowells.100␮L

of1MH2SO4wasaddedtostopthereaction.21Theoptical den-sitywasmeasuredat490nmusinganELISA reader(Dynex Technologies,Guornesey,ChannelIslandsandGreatBritain).

EvaluationPCRspecificityandsensitivity

Todeterminethespecificity,PCRwascarriedoutwithgenomic DNA extracted from Pseudomonas aeruginosa, Salmonella

typhimurium, Salmonella paratiphiC, Klebsiellapneumonia and

Vibriocholera.Productswereanalyzedon1%agarosegel.To

determine the minimum genomic DNA concentration that couldbedetectedbythemethod,seriallydilutedgenomicDNA inTEbuffer(pH=8)wasusedasPCRtemplateandtheproduct wasanalyzedon1%agarosegel.

SensitivityevaluationofPCR-ELISAtechniqueusing labeledPCRproductsofstx1andstx2

To determine the detection limit for stx gene, genomic DNA was extracted and tenfold serial dilutions containing 108ng/␮Lto0.108pg/␮Land156ng/␮Lto0.156pg/␮LofE.coli O157:H7and Shigelladysenteriae genomicDNA,respectively, werepreparedandallthestepswerecarriedoutasdescribed previously.22

PCR-ELISAspecificityevaluationusingbacterialstrains

ToevaluatespecificityofPCR-ELISA,E.coliO157:H7,Shigella

dysenteriae, Pseudomonas aeruginosa, Salmonella typhimurium,

Salmonella paratiphiC and Klebsiellapneumonia strains were

growninLBmedium.GenomicDNAswereextractedandafter evaluatingtheirconcentrationbyNanoDrop,10−2folddilution

waspreparedastemplates.ThePCRwascarriedout accord-ingtomentionedprotocolsandtheproductswereanalyzed byagarosegelelectrophoresisandELISA.22

Clinicalsamplesanalysis

Inthisstudy63positivesamplesofShigelladysenteriaeand E.coliO157:H7obtainedfromstoolandurinecultureswere analyzed.SamplesweregatheredfromMazandaranhospitals ina3-monthperiodbetweenJanuaryandMarchof2013.Age groupsincludedchildrenbetween8monthsto10yearsold, adultsbetween20and30 andbetween50and 90yearsold (Table2).Samplesweretransferredtothelab,cultured,and aftergrowthwereidentifiedindifferentialandspecificmedia andverifiedbyspecificantiserums.FollowingDNAextraction byboilingmethod,PCR-ELISAwascarriedout.Dataanalysis wasperformedonSPSS.

Results

PCR

DNA from extracted genome of bacteria cultured in LB mediumwas availableinlargequantitiesand was ofgood quality. Thepurity ofthe DNA sampleswas confirmed by absorbance(A260/A280)ratio,whichwas1.8–2.0.PCRwas per-formedforeachstrainwithspecificprimers.EachPCRproduct wasobtainedasclearbandat275and490bpgeneratedbystx2 andstx1genesrespectively(Fig.1b).ThesizesofPCRproducts werethesameaspredicted.

1 2 3 2 1

490bp

275bp

500bp

300bp

a

b

Fig.1–AgarosegelelectrophoresisofextractedE.coli

O157:H7andShigelladysenteriaegenomicDNAandanalysis

(4)

Table2–Clinicalcharacteristicsofpatients.

PatientID Age(years) Sex Typeofspecimen Clinicalmanifestations Stxgenotype

Diarrhea Abdominalpain

2 30 F Bloodystool + + Stx1/Stx2

3 20 F Bloodystool + + Stx1/Stx2

8 8 M Bloodystool + + Stx1/Stx2

10 6 M Bloodystool + + Stx2

14 20 F Bloodystool + − Stx2

15 56 M Bloodystool + − Stx2

18 20 M Bloodystool + − Stx2

20 6 F Bloodystool + + Stx2

23 9 M Waterystool + − Stx2

27 8 M Bloodystool + + Stx1/Stx2

32 57 M Bloodystool + − Stx2

35 9 M Bloodystool + − Stx2

43 25 F Bloodystool + + Stx2

47 50 F Bloodystool + − Stx2

53 7 M Bloodystool + + Stx2

55 55 F Waterystool + − Stx2

59 8 M Bloodystool + − Stx2

a

b

275bp 490bp

7 6 5 4 3 2 1 1 2 3 4 5 6 7

Fig.2–SpecificityofPCRdetectionofE.coliO157:H7(a)andShigelladysenteriae(b).Lane1,positivecontrol;Lane2,100bp DNAladder;Lane3,Pseudomonasaeruginosa;Lane4,Klebsiellapneumonia;Lane5,Vibriocholera;Lane6,Salmonella typhimurium;Lane7,SalmonellaparatyphiC.

SpecificityofPCR

AftervalidationofPCRproducts,specificity ofthereaction was examined using genomes of Pseudomonas aeruginosa,

Salmonellatyphimurium,SalmonellaparatiphiC,Klebsiella pneu-moniaandVibriocholera.AsshowninFig.2,nocross-reaction

was found between the individual primers and non-target pathogensinthePCR.

SensitivityofPCR

After preparing a serial dilution from E. coli O157:H7 and

Shigella dysenteriae ata primary concentration of108ng/␮L

1 2 3 4 5 6 7 8 1 2 3 4 5 6 7 8

a

b

275bp

490bp

(5)

490bp

275bp

1 2 3 4 5

Fig.4–RepresentativeelectrophoreticgelsofPCRproducts labeledwithdigoxigenin.Lane1,100bpDNAladder;Lane 2,PCRproductofstx1fromShigelladysenteriaegenomic DNA;Lane3,PCRproductofstx1fromShigelladysenteriae

genomicDNAlabelingwithdNTPDIGmix;Lane4,PCR

productofstx2fromE.coliO157:H7genomicDNA;Lane5,

PCRproductofstx2fromE.coliO157:H7genomicDNA

labelingwithdNTPDIGmix.

and 156ng/␮L,the PCRreactions were performedon these dilutionsandtheresultsaredisplayedinFig.3.Regarding con-centrationsoftheprimarysample(108ng/␮Land156ng/␮L), sensitivityofthereactionwas calculatedas1.08pg/␮Land 1.56pg/␮L,respectively.

SpecificPCRwithdNTPDIGlabelingmix

APCRreactionwasperformedwithdigoxigeninlabelingmix andtheresultswereanalyzedon1%agarosegel(Fig.4).

PCR-ELISAspecificityandsensitivityassay

ThespecificityofthePCR-ELISAwasanalyzedusinggenomes

ofPseudomonasaeruginosa,Salmonellatyphimurium,Salmonella

paratiphiC,KlebsiellapneumoniaandVibriocholera.

Todetermine the minimumdetectable concentration of genomic DNA of Shigella dysenteriae and E. coli O157:H7, serialdilutionswere subjectedtothePCR-ELISAtechnique. Theresults(Fig. 5)demonstratethe possibilityofdetecting 1.08pg/␮Land1.56pg/␮LE.coliO157:H7andShigella dysente-riae,respectively.

Clinicalresults

Atotalof63clinicalsampleswerecollectedandscreenedfor thepresenceofE.coliO157:H7andShigelladysenteriaestrains.

Seventeen(26.98%)samplesweredetectedasstxpositive. Agedistributionofthepatientsrangedfrom<1to90years. E.coliO157:H7andShigelladysenteriaeinfectedpatientshad an average age of 23.17 years, and 47.05% were less than 10 years old (Table 2). Themost common symptoms were bloodystools(88.23%)andabdominalpain(47.05%).Sex dis-tribution ofE. coli O157:H7 and Shigella dysenteriaeinfected patientswere7females(41.18%),and10males(58.82%). Bac-teriologicalcultureresultswerecomparedtothoseobtained byPCR-ELISA.ResultsobtainedfromPCR-ELISAassay(Fig.6) andfromselectiveculturewerecompared.Therewasa sig-nificantassociationbetweenPCR-ELISAandcultureresultsfor detectingandscreeningE.coliO157:H7andShigelladysenteriae. (p<0.001).

Discussion

Shigatoxinproducingbacteriainfectionisamajorhealth con-cernevenindevelopedcountriesallovertheworld.9,23,24With increasingreports ofE.coliO157:H7 and Shigelladysenteriae infections,greatattentionhasbeengiventothedevelopment ofmethodsfordetectingthesepathogensandapproachesfor preventionandtreatmentoftheseinfections.Thisstudywas intendedtoreachpartoftheseaims.

Inrecentyears,ELISAtesthasbeendesignedtodetectshiga toxinsdirectlyinstoolsamples.Thetestisrapidandhasa goodpotentialforshigatoxindetectionsinceitcandetectthe presenceofshigatoxin-producingE.coli(STEC)orothershiga toxin-producingbacteria.Sinceshigatoxintype differentia-tionrequireshighcostmonoclonalandpolyclonalantibodies it isnotwidelyused.Hybridization methodisaneffective, highly sensitive and specificmolecular method forprecise detectionofshigatoxins,andusesnon-radioactivesubstances suchasdigoxigeninandbiotin.However,sinceitisnot suit-ableforusinginlargenumberofclinicalsamples,thismethod isnotusedinmanyclinicallabs.25

In contrast toserological and microbiologicaltests, PCR providesarapidandsensitivealternative.Thistechnique,first developedbyKarchandMeyer,includesaprimerpairfroma

1.4

1.2

1

0.8

0.6

0.4

0.2

0

1 2 3 4 5 6 7 8

DNA concentration (ng-pg)

E. coli O157:H7 (stx 2)

Shigella dysentriae (stx 1)

0.5 1.5

1

0 2 2.5

OD:

492nm

Bacterial samples

E.coli O1157:H7 Shigella...

NEG

Vibr io cho

lerae 01 Salmonella...

Pseudomonas ...

Enterobacter Klebcillae

OD:

492 nm

(6)

0

2 3 8 10 14 15 18 20 23 27 32 35 43 47 53 55 59 Neg

Clinical samples

0.2 0.4 0.6 0.8 1 1.2 1.4

OD: 492 nm

E. coli 0157 :H7 (stx 2) Shigella dysentriae (stx 1)

Fig.6–PCR-ELISAanalysisofclinicalsamples,E.coliO157:H7(stx2)andShigelladysenteriae.(stx1).Negativecontrolsare alsoindicated.Assaycut-offwascalculatedbyreplicateanalysisofnegativesamples(OD:0.125).

conservedregionofstx1andstx2inhomologousgeneswhose maindefectswere lowTm and ineffectivenessindifferent typesofshigatoxins.15Inthatregard,todetectdifferenttypes ofshigatoxinsitisnecessarytodesignamultiplexPCRwithat leasttwopairsofprimerstodetectshigatoxingene.Thefirst studyonmultiplexPCRdetectionshigatoxinswasbyCebula etal.whodesignedspecificprimersandusedafragmentas positiveinternalcontrol.Nonetheless,primerswereonlyable todetectstx2.26SubsequentstudieswerecarriedoutbyPaton etal.,Passetal.,Philotetal.,andBelangeretal.Theirmain dis-advantagewasthatallfragmentswerelow-sizeandwerehard todissolveinagarosegel.14,27,28Theprimersthatwedesigned forthisstudy,aftercomparisonwithavailabledatafromgene banks,using softwareand experimenton clinicalsamples, provedtolacktheabovementioneddisadvantagesandtobe ableofamplifydifferentshigatoxingenes.Inaddition,these amplifiedfragmentswereeasilydissolvedinagarosegeland bothstx1andstx2genescouldbesimultaneouslydetectedin clinicalsamples.OnepotentialproblemofPCRisthepresence ofinhibitors,whichmaycausefalseresultsofthetest.InGram negativebacteriadifferentlipids,carbohydrates,andproteins presentincellwallcanactasinhibitorsandreducethe sensi-tivityofthereaction.29Toovercometheselimitationsandto increasesensitivity,bacterialgenomemustbepurifiedbefore carryingoutthereaction.Franketal.in1998usedthe boil-ingmethodtoextractgenomicDNA;however,inthismethod inhibitorscouldnotbeeliminated.30Wangetal.in2002used SDS,lysozyme,tris,glucoseandEDTAforextractionwhich increasedsensitivityto100pmol/␮L.31In2011,Marzonyetal. removedinhibitorsandextractedgenomicDNAbyusingCTAB and5MNaClandreportedasensitivityof2.1pg/␮L.32 Com-paringPCR-ELISAwithVerocellassays,Fachetal.33showed thatresultswithPCRwereobtainedwithin24hwhereaswith Vero cell assaysresultswere available onlyafterfivedays. Furthermore,Beilei et al.developedPCR-ELISA methods to

detectEscherichiacoliO157:H7andotherShigatoxin-producing E. coli (STEC)in food, where105 CFU ofSTEC per gram of

groundbeefdetectedwithoutanycultureenrichmentby PCR-ELISA.34

In this study, inhibitors were effectively eliminated by using TE buffer, lysozyme, 20% SDS, proteinase K, RNase A,3MSodiumAcetateand coldisopropanol.Consequently, sensitivity of the test improved to 1.08pg/␮L. PCR-ELISA was successfully carried out with genomic DNA extracted fromclinicalsamples;fromShigelladysenteriae,a490bp frag-mentwasamplifiedasmentionedearlier.ForE.coliO157:H7 both490and 275bpfragmentswereamplified demonstrat-ing that it can produce both toxins. PCR-ELISA correctly confirmed the specific stx1 and stx 2 genes. Non-positive results for other strains indicate that the tests are highly specific. Moreover, we have compared the performanceof PCR-ELISA with standard agarose gel electrophoresis. PCR-ELISAassaywasmoresensitivethanthegelelectrophoresis. Our data indicate that PCR-ELISA is highly specific, and hashighersensitivitythanconventionalgelelectrophoresis. By offering shorter turnaround time and high sensitiv-ity, PCR-ELISA has the potential to serve as a powerful detectiontoolinmedicineandinfoodandagricultural indus-tries.

Conflicts

of

interest

Theauthorsdeclarenoconflictsofinterest.

Acknowledgement

(7)

submittedto AppliedMicrobiology Research Center, Baqiy-atallahUniversityofMedicalSciences,Tehran,Iraninpartial fulfillmentoftherequirementsfortheMScinmicrobiology.

r

e

f

e

r

e

n

c

e

s

1. PatonJC,PatonAW.PathogenesisanddiagnosisofShiga toxin-producingEscherichiacoliinfections.ClinMicrobiolRev. 1998;11:450–79.

2. KarmaliMA.InfectionbyShigatoxin-producing

Escherichiacoli.MolBiotechnol.2004;26:117–22.

3. KarmaliMA.Prospectsforpreventingserioussystemic toxemiccomplicationsofshigatoxin-producingEscherichia coliinfectionsusingshigatoxinreceptoranalogues.JInfect Dis.2004;189:355–9.

4. LingwoodCA.Shigatoxinreceptorglycolipidbinding. MethodsMolMed.2002;73:165–86.

5. EndoY,TsurugiK,YutsudoT,TakedaY,OgasawaraT,Igarashi K.SiteofactionofaVerotoxin(VT2)fromEscherichiacoli

O157:H7andofShigatoxinoneukaryoticribosomes.EurJ Biochem.1988;171:45–50.

6. FosterGH,TeshVL.Shigatoxin1-inducedactivationofc-Jun NH2-terminalkinaseandp38inthehumanmonocyticcell lineTHP-1:possibleinvolvementintheproductionofTNF-␣.J

LeukocBiol.2002;71:107–14.

7. HuangA,FriesenJ,BruntonJ.Characterizationofa bacteriophagethatcarriesthegenesforproductionof Shiga-liketoxin1inEscherichiacoli.JBacteriol. 1987;169:4308–12.

8. GobiusKS,HiggsGM,DesmarchelierPM.Presenceof activatableShigatoxingenotype(stx2d)inShigatoxigenic

Escherichiacolifromlivestocksources.JClinMicrobiol. 2003;41:3777–83.

9. SackD,HoqueS,EtheridgeM,HuqA.Isprotectionagainst shigellosisinducedbynaturalinfectionwithPlesiomonas shigelloides?Lancet.1994;343:1413–5.

10.SieglerRL.Spectrumofextrarenalinvolvementin postdiarrhealhemolytic-uremicsyndrome.JPediatrics. 1994;125:511–8.

11.SieglerRL.PostdiarrhealShigatoxin-mediatedhemolytic uremicsyndrome.JAMA.2003;290:1379–81.

12.UrdahlA,BeutinL,SkjerveE,ZimmermannS,WastesonY. AnimalhostassociateddifferencesinShigatoxin-producing

Escherichiacoliisolatedfromsheepandcattleonthesame farm.JApplMicrobiol.2003;95:92–101.

13.KumarH,KarunasagarI,KarunasagarI,TeizouT,ShimaK, YamasakiS.CharacterisationofShigatoxin-producing

Escherichiacoli(STEC)isolatedfromseafoodandbeef.FEMS MicrobiolLett.2004;233:173–8.

14.PhilpottD,EbelF.E.coli:shigatoxinmethodsandprotocols. Springer;2003.

15.KarchH,MeyerT.Singleprimerpairforamplifyingsegments ofdistinctShiga-like-toxingenesbypolymerasechain reaction.JClinMicrobiol.1989;27:2751–7.

16.CroxenMA,FinlayBB.Molecularmechanismsof

Escherichiacolipathogenicity.NatRevMicrobiol.2010;8:26–38.

17.DalyP,CollierT,DoyleS.PCR-ELISAdetectionof

Escherichiacoliinmilk.LettApplMicrobiol.2002;34:222–6.

18.PerelleS,DilasserF,MalornyB,GroutJ,HoorfarJ,FachP. ComparisonofPCR-ELISAandLightCyclerreal-timePCR assaysfordetectingSalmonellaspp.inmilkandmeat samples.MolCellProbes.2004;18:409–20.

19.KobetsT,BadalováJ,GrekovI,HavelkováH,SvobodováM, LipoldováM.Leishmaniaparasitedetectionand

quantificationusingPCR-ELISA.NatProtoc.2010;5:1074–80.

20.AhmadpourA,AmaniJ,ImaniFooladiAA,SedighianH, NazarianS.DetectionofShigelladysenteriaeandE.coliO157:H7 toxinsbymultiplexPCRmethodinclinicalsamples.IranJ MedMicrobiol.2013;7:41–51.

21.MousaviSL,NazarianS,AmaniJ,RahgerdKarimiA.Rapid screeningoftoxigenicvibriocholeraeO1strainsfromsouth IranbyPCR-ELISA.IranBiomedJ.2008;12:15–21.

22.MousaviSL,SalimiyanJ,RahgerdiAK,AmaniJ,NazarianS, ArdestaniH.ArapidandspecificPCR-ELISAfordetecting

Salmonellatyphi.IranJClinInfectDis.2006;1:113–9.

23.SandvigK.Shigatoxins.Toxicon.2001;39:1629–35.

24.KargarM,DaneshvarM,HomayounM.Surveillanceof virulencemarkersandantibioticresistanceofshigatoxin producingE.coliO157:H7StrainsfromMeatsPurchasein Shiraz.ISMJ.2011;14:76–83.

25.JacksonMP.DetectionofShigatoxin-producingShigella dysenteriaetype1andEscherichiacolibyusingpolymerase chainreactionwithincorporationofdigoxigenin-11-dUTP.J ClinMicrobiol.1991;29:1910–4.

26.CebulaTA,PayneWL,FengP.Simultaneousidentificationof strainsofEscherichiacoliserotypeO157:H7andtheirShiga-like toxintypebymismatchamplificationmutation

assay-multiplexPCR.JClinMicrobiol.1995;33:248–50.

27.BélangerSD,BoissinotM,MénardC,PicardFJ,BergeronMG. RapiddetectionofShigatoxin-producingbacteriainfecesby multiplexPCRwithmolecularbeaconsonthesmartcycler.J ClinMicrobiol.2002;40:1436–40.

28.WongCS,JelacicS,HabeebRL,WatkinsSL,TarrPI.Theriskof thehemolytic–uremicsyndromeafterantibiotictreatmentof

EscherichiacoliO157:H7infections.NEnglJMed. 2000;342:1930–6.

29.TamminenM,JoutsjokiT,SjöblomM,etal.Screeningoflactic acidbacteriafromfermentedvegetablesbycarbohydrate profilingandPCR-ELISA.LettApplMicrobiol.2004;39:439–44.

30.FranckSM,BosworthBT,MoonHW.MultiplexPCRfor enterotoxigenic,attachingandeffacing,andShiga toxin-producingEscherichiacolistrainsfromcalves.JClin Microbiol.1998;36:1795–7.

31.WangG,ClarkCG,RodgersFG.DetectioninEscherichiacoliof thegenesencodingthemajorvirulencefactors,thegenes definingtheO157:H7serotype,andcomponentsofthetype2 ShigatoxinfamilybymultiplexPCR.JClinMicrobiol. 2002;40:3613–9.

32.MarzonyET,KamaliM,SaadatiM,KeihanAH,FooladiAAI, SajjadiS.SinglemultiplexPCRassaytoidentifytheshiga toxin.AfrJMicrobiolRes.2011;5:1794–800.

33.FachP,PerelleS,DilasserF,GroutJ.Comparisonbetweena PCR-ELISAtestandtheverocellassayfordetectingShiga toxin-producingEscherichiacoliindairyproductsand characterizationofvirulencetraitsoftheisolatedstrains.J ApplMicrobiol.2001;90:809–18.

34.GeB,ZhaoS,HallR,MengJ.APCR-ELISAfordetectingShiga toxin-producingEscherichiacoli.MicrobesInfect.

Imagem

Table 1 – PCR primers and hybridization capture probe for stx1 and stx2 genes.
Fig. 2 – Specificity of PCR detection of E. coli O157:H7 (a) and Shigella dysenteriae (b)
Fig. 5 – Specificity and sensitivity of PCR-ELISA assay for stx2 and stx1 hybridization
Fig. 6 – PCR-ELISA analysis of clinical samples, E. coli O157:H7 (stx 2) and Shigella dysenteriae

Referências

Documentos relacionados

Nessa perspectiva o presente estudo avaliou o potencial leishmanicida in vitro e in vivo de flavonoides raros isolados da fase diclorometânica das raízes da Fridericia platyphylla..

This work showed that the PCR-RFLP can be used as a simple and rapid method to detect larvae of the golden mussel and species of Asian Clam, especially in samples with presence of

perfringens isolates that produced animal disease were submitted to PCR assay using primer sets to detect the presence of genes encoding alpha toxin.. MATERIALS

Table 2 – Limit of detection of the PCR and real-time PCR assays used to detect Campylobacter spp.. in

No diagrama de linhas de fluxo magnético e a distribuição da indução magnética da máquina em vazio da Fig. 4.19 se constata que a indução magnética se encontra

PRODUÇÃO E CARACTERIZAÇÃO DO METAL DURO – CARBETO DE TUNGSTÊNIO (WC) COM ADIÇÃO DE AÇO INOXIDÁVEL AISI316L COMO.. SUBSTITUINTE

La relación establecida entre las bases metodológicas y el documento a analizar es aquello que se pretende evidenciar, comentando el porqué de las decisiones tomadas

Os exercícios de peso contribuem para redução do tecido adiposo, como todo tipo de atividade física, entretanto, para que ocorra a mobilização de gordura