A role for solute carrier family 10 member 4, or vesicular aminergic-associated transporter, in structural remodelling and transmitter release at the mouse neuromuscular junction

(1)

MOLECULAR AND SYNAPTIC MECHANISMS

A role for solute carrier family 10 member 4, or vesicular

aminergic-associated transporter, in structural remodelling

and transmitter release at the mouse neuromuscular

junction

Kalicharan Patra,1,* David J. Lyons,1,* Pavol Bauer,1Markus M. Hilscher,1,2,3Swati Sharma,1 Richardson N. Le~ao1,2,3

and Klas Kullander1

1

Department of Neuroscience, Uppsala University, Uppsala, Sweden

2_{The Beijer Laboratory for Gene and Neurosciences, Uppsala, Sweden}

3

Brain Institute, Federal University of Rio Grande do Norte, Natal, Brazil

Keywords: acetylcholine, peripheral nervous system, SLC10A4, synaptic transmission, vesicular aminergic-associated trans-porter, vesicular content

Abstract

The solute carrier and presynaptic vesicle protein solute carrier family 10 member 4, or vesicular aminergic-associated transporter (VAAT), was recently proven to have a modulatory role in central cholinergic signalling. It is currently unknown whether VAAT also affects peripheral cholinergic synapses. Here we demonstrated a regulatory role for the presynaptic vesicle protein VAAT in neuromuscular junction (NMJ) development and function. NMJs lacking VAAT had fewer branch points, whereas endplates showed an increased number of islands. Whereas the amplitude of spontaneous miniature endplate potentials in VAAT-deficient NMJs was decreased, the amplitude of evoked endplate potentials and the size of the readily releasable pool of vesicles were both increased. Moreover, VAAT-deficient NMJs displayed aberrant short-term synaptic plasticity with enhanced synaptic depres-sion in response to high-frequency stimulation. Finally, the transcript levels of cholinergic receptor subunits in VAAT-deficient muscles were increased, indicating a compensatory postsynaptic sensitization. Our results suggested that VAAT modulates NMJ transmission efficiency and, as such, may represent a novel target for treatment of disorders affecting motor neurons.

Introduction

The solute carrier family 10 member 4 (SLC10A4) is a synaptic vesicular protein that is co-expressed at high levels with markers of cholinergic and monoaminergic vesicles (Geyer et al., 2008; Burger et al., 2011; Larhammar et al., 2014) and was recently designated as vesicular aminergic-associated transporter (VAAT) because of its location in presynaptic vesicles of aminergic neurons and its modu-lation of amine neurotransmission (Larhammar et al., 2014). We recently used an Slc10a4 knockout mouse (herein referred to as

Vaat KO) to study the functional and biological signiﬁcance of this

protein in central cholinergic neurotransmission (Zelano et al.,

2013). These ﬁndings suggested a protective modulatory role for

VAAT against susceptibility to cholinomimetic drugs in an induced epilepsy model. Furthermore, Vaat KO mice displayed spontaneous epileptiform activity in the cortex as well as oscillatory activity in

hippocampal slices. These and otherﬁndings, such as a possible role

for this protein in Alzheimer’s disease (Popova & Alafuzoff, 2013), have led to speculations regarding the function and clinical rele-vance of SLC10A4 (Borges, 2013). Thus, it now appears that

VAAT has, since its initial identiﬁcation as a tentative membrane

protein, emerged as a signiﬁcant player in the modulation of aminer-gic neurotransmission.

Based on previous ﬁndings suggesting that VAAT regulates the

sensitivity of central cholinergic systems (Zelano et al., 2013), we set out to determine the structural, molecular and electrical prop-erties of cholinergic synaptic transmission in the absence of this protein. As central synapses are highly complex [being multiply modulated and residing on neurons that are heavily innervated (Marder, 2012)], we sought to investigate the role of VAAT using the relatively less complex neuromuscular junctions (NMJs) in mice.

Neuromuscular junctions are specialised synaptic structures con-necting neurons to muscles with a particularly robust response upon action potential activation. Their relatively stable and large pretzel-like synaptic structure differs from central cholinergic synapses in

that they have a one-to-one axon to muscle ﬁbre connection. This

connective simplicity, robustness of transmission and physical acces-sibility confer upon the NMJ preparation numerous advantages for

Correspondence: K. Kullander, as above. E-mail: klas.kullander@neuro.uu.se

*K.P. and D.J.L. contributed equally to this work.

Received 18 January 2014, revised 14 October 2014, accepted 17 October 2014

(2)

the study of the structural, molecular and electrophysiological aspects of cholinergic neurotransmission (Ribchester, 2009). Accord-ingly, the NMJ preparation has previously been used to assess the role of other vesicle-associated synaptic proteins, e.g. Syb1 (Liu et al., 2011), in neuronal signalling.

Our ﬁndings indicate that the absence of VAAT disturbs

the structural and electrophysiological properties of NMJs. We further show that the Vaat KO mouse displays postsynaptic sensitization with elevated expression of neurotransmitter receptor subunits.

Materials and methods Mice

All mice were housed as approved by the animal care unit of Uppsala University and experiments were conducted according to Swedish guidelines and regulations, and European Union legislation (ethical permits C248/11 and C422/12).

The Slc10a4 heterozygous mice (Slc10a4+/ ) of 129/SvEvBrd

background (from Texas A&M Institute for Genomic Medicine, TX, USA) were inbred to C57BL/6 for at least three generations to obtain null mutants (Slc10a4 KO or Vaat KO) and wild-type (WT) littermates on a stable genetic background. Mice were genotyped for

Vaat using the following primer pairs: Vaat+/+_F, GGAAAGAC

ATGGCTGACTCTG; Vaat+/+_R, CACGCGGTTGTATTTGTAGC;

Vaat / _F, CAGGTAAAGGGACCACAGG; and Vaat / _R,

ACA-CCGGCCTTGTATTTGTAGC.

Western blot

The striatal lysate was separated on 4–15% mini-PROTEANâ

TGXTM

precast gel (Bio-Rad Laboratories AB, Sweden) at 120 V for 1 h and transferred to a nitrocellulose membrane (Bio-Rad Laboratories AB) at 15 V for 30 min in a semi-dry electropho-retic transfer cell (Bio-Rad Laboratories AB). The membrane was blocked with 3% bovine serum albumin in Tris-buffered

saline-Tweenâ 20 for 1 h and incubated with primary antibody in the

same blocking solution for 2 h at room temperature (22 °C),

fol-lowed by four washes in Tris-buffered saline- Tween (50 mM

Tris, pH 8, 150 mM NaCl, 0.05% Tweenâ 20). The membrane

was then incubated with protein A–horseradish peroxidase

conju-gate (Bio-Rad Laboratories AB) for 1 h at room temperature fol-lowed by washing in TBST and detection with luminol reagent. The antibody dilutions used in the western blot were as follows: rabbit SLC10A4, 1 : 1000 (HPA028835, Sigma) and mouse syn-aptophysin, 1 : 1000 (generous gift from the laboratory of Profes-sor Reinhard Jahn, Gottingen, Germany).

Quantitative real time-polymerase chain reaction

Total RNA isolated from the lumbar spinal cord and gastrocnemius

muscle from WT (n= 12) and VAAT KO (n = 12) mice by the

Tri-zol method (cat. no. 10296010, Life Technologies Ltd) was sub-jected to DNase I treatment (cat. no. EN0525, Fermentas) as per the

manufacturer’s instructions. Using Superscriptâ II enzyme (cat. no.

18064022, Invitrogen), 800 ng of RNA was reverse transcribed to cDNA, of which the equivalent of 8 ng RNA per reaction was taken as the template to run real-time polymerase chain reaction (PCR).

The primers were designed using PRIMER3 PLUS software, wherever

possible

(http://www.bioinformatics.nl/cgi-bin/primer3plus/primer3-plus.cgi) from adjacent exons in a gene to avoid any contaminating

ampliﬁcation from traces of genomic DNA, and were veriﬁed by

in-silico PCR (http://genome.ucsc.edu/cgi-bin/hgPcr?command=start), taking the mouse genome assembly released in Dec. 2011 (GRCm38/mm10) and using University of California Santa Cruz

genes as the target. Primers were veriﬁed using cDNA from a WT

sample for optimal annealing temperature. Real-time PCR was

car-ried out in duplicate using a KAPATM

SyBrâ FAST qPCR Kit

(KAPA Biosystems Inc., Woburn, USA) and iCyclerTM

(Bio-Rad). The PCR efﬁciencies of primer pairs were calculated using the

lin-ear regression method (LinRegPCR). The quantiﬁcation cycle values

thus obtained were normalised to the geometric mean of the two

most stable reference genes (Actb and Tubb5) out of ﬁve genes

tested on the geNorm algorithm (http://medgen.ugent.be/~jvdesomp/

genorm/). Theﬁnal comparisons between normalized quantiﬁcation

cycle values were graphically plotted usingGRAPHPAD PRISM©. A list

of the primers used for real time-quantitative polymerase chain reac-tion (RT-qPCR) is given in Table 1.

Immunohistochemistry

The diaphragm or gastrocnemius muscles were dissected out from

the animal and ﬁxed in 4% formaldehyde in 0.1M

phosphate-buf-fered saline (PBS) (pH 7.4) overnight at 4°C. The ﬁxed tissue was

washed in PBS before undergoing a sucrose gradient of 10%, 20% and 30% sucrose in PBS for 20 min, 120 min and 16 h, respec-tively. Finally, the tissue was embedded in O.C.T. medium

(Opti-mum Cutting Temperature compound, Tissue TEKâ) and

cryosectioned (20lm) onto super-frost plus glass slides (Menzel,

Germany). For immunostaining, the sections were rehydrated in

PBS/0.5% Tweenâ(PBST) for 10 min, immersed in antibody

dilu-ent (2% bovine serum albumin in PBST) for 2 h to saturate unspe-ciﬁc binding, and incubated with primary antibodies for 16–18 h at

4°C in the antibody diluent. After washing in PBST, secondary

antibodies diluted in PBST were applied for 1 h at room

tempera-ture. Alexa Fluorâ 488 a-bungarotoxin conjugate was added to the

same solution to label acetylcholine (ACh) receptors. Sections were

Table 1. Real time-quantitative polymerase chain reaction primers

Gene name Forward primer Reverse primer

Slc10a4 GGATAGCATTGCATCGTCAAAC ACCCCTGGACAATGTTGATG

Actb GATCTGGCACCACACCTTCT CCATCACAATGCCTGTGGTA

Tubb5 AGTGCTCCTCTTCTACAG TATCTCCGTGGTAAGTGC

Chrna1 GGTGTTCTACCTGCCCACAG GCTCCACAATGACCAGAAGG

Chrnb1 TTCTACCTCCCACCAGATGC AGGTCTCAGGCACTTTGTCG

Chrnd TTAGCCTGAAGCAGGAGGAG TGACATCTTGGTGGTTGGTG

Chrne TTGCCCAGAAAATTCCAGAG AGGGGATGTAGCATGAGTCG

Chrng GGGACCCAAAAGACTACGAAG GAGAGCCACCTCGAAGACAC

P2X7 TGCACATGATCGTCTTTTCC CCTCTGCTATGCCTTTGACC

(3)

then washed in PBST and mounted in Mowiolâ (cat. no. 81381, Sigma). The following dilutions of antibodies were used: rabbit SLC10A4, 1 : 1000 (HPA028835, Sigma); goat vesicular ACh

transporter (VAChT), 1 : 100 (sc-7717, Santa Cruz);

a-bungaro-toxin–Alexa Fluorâ _{488, 1}_{lg/mL (B13422, Invitrogen); donkey}

anti-rabbit Alexa Fluorâ647, 1 : 500 (711-605-152, Jackson

Immu-noResearch); and donkey anti-goat Rhodamine Red-X (RRX), 1 : 500 (705-295-147, Jackson ImmunoResearch).

The triangularis sterni (TS) muscle was processed for the whole-mount staining of NMJs following the protocol of the laboratory of Professor R. Ribchester (Edinburgh University, Scotland) (Court et al., 2009) with minor modiﬁcations. Brieﬂy, the TS muscle was

dissected in PBS andﬁxed with 4% formaldehyde for 40 min. The

tissue permeabilization and primary and secondary antibody incuba-tion were carried out as described above but in PBS containing

0.3% Tritonâ X-100 and 2% bovine serum albumin. All of the

washes were carried out in PBST. The antibodies used on TS

mus-cle preparations were as follows: chicken neuroﬁlament (200 kDa),

1 : 50 000 (ab4680, Abcam); rabbit SLC10A4, as above;

a-bunga-rotoxin–Alexa Fluorâ488, as above; and donkey anti-chicken RRX,

1 : 400 (703-295-155, Jackson ImmunoResearch). The whole TS muscle preparation was mounted with Mowiol.

Image analysis

Z-stacks of images at 0.35-lm optical slice depth were captured using an LSM 510 META confocal microscope (Zeiss) and a Plan-Apochromat 639/1.4 NA oil immersion objective (Zeiss) with the same laser power settings and scanning mode for NMJs of both genotypes. The Z-stacks were further analysed using MATLAB (R2013b, Mathworks) including the Image processing toolbox and ImageJ (1.48a) including various modules supplied by the Fiji distri-bution (Schindelin et al., 2012).

The sets of three-dimensional (3D) images used for the branching

analysis wereﬁrst denoised using a smoothing algorithm (Gaussian

kernel, sigma= 1) and further transformed to a binary image

apply-ing Otsu’s auto-threshold method. Followapply-ing this step, the

morphol-ogy was skeletonized using Fiji’s AnalyzeSkeleton module and the

resulting branch network was pruned for loop cycles using the ‘shortest branch’ option.

The analysis of VAChT distribution over the NMJ was based on a maximum-intensity projection of the Z-stack, following a denois-ing step usdenois-ing alternatdenois-ing morphological opendenois-ing and closdenois-ing algo-rithms to remove small elements and close holes. Afterwards, the median of the VAChT distribution was obtained on the area that had been kept dependent on the threshold intensity of the bungaro-toxin staining (representing the NMJ structure).

Motor behaviour

The forelimb grip strength test was performed on a grip strength instrument (Bio GS3, Bioseb In Vivo Research Instruments) as per the manufacturer’s instructions to measure acute muscle strength dis-played as the maximal peak force (in weight) developed by a mouse in resistance to pulling it away from a wire grid (Brooks & Dunnett, 2009). In a single move, female mice aged between 20 and 24 weeks

(N= 14 per genotype) held at the tail tips were lowered onto a wire

grid attached to the instrument, allowing the forelimbs to get a grip, and then pulled away from the grid, all within the 3-s time period. The force exerted by the mouse to hang onto the grid was registered in the

instrument. The sequence was repeated ﬁve times per mouse and

the average score (in g) was plotted to compare between genotypes.

The hanging wire test was implemented to assess muscle tone and strength as instructed by M. Putten (Leiden University, The

Nether-lands) (http://www.treat-nmd.eu/downloads/ﬁle/sops/dmd/MDX/

DMD_M.2.1.004.pdf), originally described by Raymackers et al. (2003), with some modiﬁcations. Brieﬂy, a 1.8-mm-thick copper wire was tied between two poles separated by 55 cm and elevated 35 cm from the home cage. Female mice aged between 20 and 24 weeks (set

1) and between 60 and 65 weeks (set 2) (N= 12 per genotype for

each set) were suspended in the middle with their forepaws holding the wire. Use of the hindlimbs or tail to climb onto the wire was pre-vented by gently holding the tip of the tail so that the mice could only use their forelimbs, but without applying pressure or pulling on the tail. However, the mice were allowed to walk along the wire with their forelimbs. This technique prevented the mice from displaying the inappropriate behaviour of standing over the wire or using the strength of the tail to gain balance. Mice were subjected to a 300-s hanging test

and‘falls’ and ‘reaches’ were scored. At the start, ‘fall’ was set to 10

and‘reach’ was set to 0, and for each ‘fall’ or ‘reach’ the elapsed time

was noted and the score was adjusted by reducing by 1 point per fall and increasing by 1 point per reach. A 15-s composure period was given after each fall, but for each reach the mouse was promptly

placed back in the middle. Kaplan–Meier-like curves for the ‘falls’

and‘reaches’ were separately generated after calculating the average

score for each genotype at any time point.

Electrophysiology

Intracellular recordings were carried out ﬁbres from Vaat KO mice

(n= 13) and their littermate controls (n = 11). The nerve–muscle

preparation from adult mice for electrophysiology was performed as previously described (Ribchester, 2009, 2011). Flexor digitorum bre-vis muscles with nerves attached were acutely isolated in

oxygen-ated (95% O2, 5% CO2) extracellular solution (137 mMNaCl, 5 mM

KCl, 5 mM HEPES, 1.3 mM MgCl2, 2.4 mM CaCl2, and 5 mM

D-glucose, pH 7.3). Fibres were impaled with glass micropipettes

(resistance 40–60 MO) ﬁlled with 2Mpotassium acetate and 40 mM

KCl. Evoked endplate potentials (EPPs) were elicited by supra-threshold stimulation (10 V, 0.1 ms) of the nerve via a suction

elec-trode. To prevent muscle contraction,l-conotoxin GIIIB (2 lM,

Ba-chem) was added to the bath solution for 30 min prior to recording. Miniature endplate potentials (mEPPs) and EPPs were acquired using an intracellular ampliﬁer (Multiclamp 700B) and digitised with Digidata 1440A (Molecular Devices, Sunnyvale, CA, USA). Data were analysed with pClamp 10 (Molecular Devices) and Mini Analysis Program (Synaptosoft, Inc., Decatur, GA, USA). The mean amplitudes of the EPP and mEPP recorded at each NMJ were line-arly normalized to 70-mV resting membrane potential. The EPP amplitudes were corrected for non-linear summation (Martin, 1955)

as follows: EPPCorrected= average peak EPP/[1 average peak

EPP/(Vm Er)], where Vm is the resting membrane potential and

Er is the reversal potential (taken as 5 mV). The quantal content

(number of ACh quanta released in response to a single nerve impulse) was estimated using the direct method, i.e. dividing the mean amplitude of EPPs by the mean amplitude of mEPPs of the same cell (Boyd & Martin, 1956; Wood & Slater, 2001).

Statistical analysis

The unpaired t-test was used for all of the experiments that involved statistical analysis. Data from the microstructural analysis of NMJs

are presented as mean SD, whereas data from electrophysiology

(4)

Results

VAAT expression and role in the neuromuscular junction

We ﬁrst set out to establish the expression of VAAT in NMJs

and to verify the Vaat KO at the transcript and protein levels. We performed RT-qPCR to measure the Vaat transcript levels in the

lumbar spinal cord from WT and KO mice (n = 12/genotype),

which corroborated an absence of Vaat transcripts in the spinal cords of KO mice (Fig. 1A). Western blot performed on the stria-tal lysate conﬁrmed the loss of a approximately 72-kDa prominent band, corresponding to glycosylated VAAT, whereas the level of synaptophysin, a 38-kDa common vesicular protein (Thomas et al., 1988), was similar in samples from KO and WT mice (Fig. 1B). Synaptic proteins are known to affect the bouton structure and patterning of NMJs (Choi et al., 2013). We examined whether the loss of VAAT might lead to abnormal patterning of the NMJs

over the muscle ﬁbre, e.g. as was observed in the nicotinic

gamma receptor subunit-deﬁcient mice (Liu et al., 2008). For this

purpose, the TS muscle was immunolabelled with neuroﬁlament to stain the axons (red) and bungarotoxin (green) to stain the ACh receptor clusters. At this macrostructural level, we did not observe any gross abnormalities in the distribution of NMJs (Fig. 1C). We next investigated NMJs at an individual level. Immunohistochemis-try experiments combining antibodies recognising VAAT and VAChT with bungarotoxin labelling demonstrated an overlapping distribution of VAAT and VAChT in NMJs, starting from birth (Fig. 1D; Supporting Information Fig. S1). We calculated the Pearson’s correlation coefﬁcient between VAAT and VAChT

im-munolabelling to be 0.87 (+1 is a perfect correlation). It was also

apparent that individual NMJs lacking VAAT were mis-shaped compared with NMJs from control WT mice (Fig. 1D). Although the NMJs had an abnormal appearance, the relative VAChT distri-bution over the NMJ was found to be similar in controls and VAAT null mice, as measured by correlating the 3D expression

of the VAChT-immunopositive signal with bungarotoxin labeling (Fig. 1E).

Vaat knockout mice display fragmented endplate structure The seemingly mis-shaped NMJs observed in the Vaat KO mice called for a closer structural analysis of individual NMJs. We

con-structed detailed 3D images of entire NMJs from WT (n= 87,

three animals) and KO (n= 114, four animals) mice derived from

confocal image stacks. The Z-stacks were analysed using MAT-LAB and ImageJ including modules supplied by the Fiji distribu-tion (Schindelin et al., 2012). The 3D analysis showed that the total volume was similar between KO and WT controls, whereas the number of isolated acetylcholine receptor (AChR) clusters

(islands) in a single endplate (Pratt et al., 2013) was signiﬁcantly

increased in the KO mice (P< 0.001, Supporting Information Fig.

S2A). Several branch parameters were also different between WT and KO endplates; however, we noticed that the 3D analysis soft-ware overestimated the number of branch points as convolutions and bulges were erroneously counted. To achieve a more reliable branching analysis, the 3D images were denoised and transformed to a binary image (Fig. 2A and B). Next, the morphology was skeletonized and the resulting branching network was pruned for

loop cycles using the‘shortest branch’ option (Fig. 2C). Our

two-dimensional analysis conﬁrmed that NMJ areas were similar

between WT and KO mice (116.51 83.8 lm2 in WT vs.

101.86 82.7 lm2 in KO; P= 0.3) and that the number of

islands increased in the KO mice (1.79 1.0 in WT vs.

3.26 2.0 in KO; P = 2.39e 07) (Fig. 2D), such that 60% of KO

endplates had three or more islands compared with 17% of the WT endplates. The endplate branching analysis showed that, whereas the total branch length per endplate was decreased in KO

mice (153.8 47.2 lm in WT vs. 129.42 42.4 lm in KO;

P= 0.0017), the average branch length was increased (8.1 1.9

WT KO Relative mRNA levels

T A A V x t B VAChT Merge 72 38 WT KO VAAT Syp Btx threshold intensity (%) WT KO 20 60 100

VAChT volume (um

3) 0 20 40 WT KO 0.0 1.0 A C B D E

Fig. 1. VAAT is expressed in NMJs and loss of VAAT results in abnormal NMJs. (A) Measurement of relative spinal cord mRNA levels conﬁrms loss of Vaat mRNA in Vaat KO mice. (B) Western blot experiments show a VAAT-immunopositive band in striatal lysate from WT but not Vaat KO mice. Synapto-physin (Syp), a common synaptic vesicles protein, was used as a control. Molecular sizes (in kDa) are listed on the left. (C) Distribution of bungarotoxin (Btx)-positive NMJs (green) over the TS muscle reveal a normal NMJ patterning along the nerve (red, tomato-(Btx)-positive axons). Panels on the righthand side are enlarged images from the boxed areas. (D) In WT mice, VAAT (violet) co-localised with VAChT (red) in the NMJs (upper panel), whereas the Vaat KO NMJs lacked VAAT-positive immunostaining (lower panel). Btx (green) was used to visualise the NMJs. (E) Graph showing VAChT distribution in the endplate as a function of Btx labelling intensity (WT, blue; KO, red). Scale bars: 200lm (C), 25 lm (inset C), 10 lm (D).

(5)

lm in WT vs. 9.24 2.7 lm in KO; P = 0.0037) (Fig. 2D). Moreover, and as expected given the other changes, the number of endplate branches decreased in the KO mice compared with WT controls. In summary, endplates lacking VAAT had a similar sur-face area, whereas they were fragmented and had fewer branches compared with controls.

However, the endplate structure only represents the postsynaptic receptor clustering. To investigate the effect of Vaat deletion on the presynaptic axonal branching over the NMJ structures, we analysed the branching patterns of axons stained with the 200-kDa neuroﬁla-ment protein together with VAAT and bungarotoxin. 3D images of

WT (n= 47, three animals) and Vaat KO (n = 50, three animals)

animals were constructed from the Z-stacks using the IMAGEJ

soft-ware as described above (Fig. 3). Branching analysis was performed as described earlier (Prakash et al., 1996), following the same deﬁ-nitions for primary and secondary branches. Corresponding to our previous observation of VAChT distribution over the NMJs with or without VAAT, the axonal branching parameters, such as entry points, number of branches, average branch length and total branch length, were similar between the genotypes (Table 2). However, although the AChR clusters in the Vaat mutant mice clearly had neuroﬁlament staining, the separated clusters seemed to be joined by

narrow [sometimes undetectable (* in Fig. 3)] axonal branches

(Fig. 3, inset). WT KO 10 20 30 40

***

# of branches Number WT KO 5 10 15

**

Avg branch length

WT KO 10 20 30 40 50

Max branch length

WT KO 100 200 300

**

Total length µm µm µm µm 2 WT KO 0 6 12

_***

# of islands Number WT KO 0 100 200 300 400 Total area A B C D WT KO ns ns

Fig. 2. Microstructural analyses of individual NMJs in WT and Vaat KO mice. (A–C) 3D images obtained by maximum intensity projection of Z-stacks were denoised and converted to binary images and skeletonized using Fiji modules ofIMAGEJsoftware. The endplates of the KO mice showed a fragmented structure

with many unconnected‘islands’. Upper panel: WT (n = 87, three mice); lower panel: KO (n = 114, four mice). (D) Box and whiskers plots from two-dimen-sional analysis of the endplate region with MATLAB and Fiji for: (upper panel) number of branches, average branch length (lm) and maximum branch length (lm), and (lower panel) total length of all branches, number of islands and total area (lm2_{). In the Vaat KO, the number of branches and total length are low,}

whereas average branch length and number of islands are signiﬁcantly higher. Maximum branch length and total area of the endplate remain unchanged. **P < 0.01, ***P < 0.001. Individual measurement points in D are denoted (+). Scale bars: 10 lm (A).

(6)

Vaat knockout mice exhibit normal motor abilities

The structural defects led us to hypothesise that the lack of VAAT from NMJs could result in impaired motor function. We performed forelimb grip strength and hanging wire tests to assess muscle force and general muscle tone. No difference was observed in the average weight of age-matched mice of both genotypes (Fig. 4A). In tests conducted on mice aged between 24 and 31 weeks old, we did not observe any signiﬁcant differences in grip strength or hanging wire test score (data not shown). However, when the tests were repeated on mice aged between 59 and

65 weeks, we found signiﬁcant differences in their ‘fall’ and ‘reach’

scores on the hanging wire test but no difference in the average peak force applied in the grip strength test (Fig. 4B–D). Hanging wire tests

on the aged mice, where‘falls’ and ‘reaches’ were plotted separately,

revealed that the control mice tried to escape the situation and reach one

end of the wire, increasing their cumulative‘reach’ score, whereas Vaat

KO mice remained on the wire, thus obtaining a lower cumulative ‘reach’ score. This ‘reach’ attribute is not a conventional measure of gen-eral muscle tone (Raymackers et al., 2003). Thus, these results do not by themselves suggest a muscle-speciﬁc phenotype in Vaat KO animals. In addition, previous experiments relying on the motor abilities of the Vaat KO mouse did not reveal any gross abnormalities in motor behav-iour (Larhammar et al., 2014).

Altered miniature endplate potential and evoked endplate potential properties of neuromuscular synapses in Vaat knockout mice

Although the motor function abnormalities were mild, we reasoned that the clear microstructural changes in NMJ architecture that we

had observed might manifest as altered synaptic transmission. To investigate this possibility, we performed intracellular recordings

fromﬂexor digitorum brevis muscle ﬁbres (Ribchester et al., 2004)

from both Vaat KO mice and their WT littermates.

Table 2. Axonal branching parameters (mean SD)

Parameters WT KO

Nerve terminal

Entry points 2.2 1.1 2.9 1.0

Total number of branches 9.2 2.8 9.3 3.8 Average branch length (lm) 12.7 2.6 11.8 3.0 Total branch length (lm) 114.3 32.9 106.3 34.7 Endplate Receptor clusters 1.8 1.0 3.8 3.2 KO WT Btx NF VAAT Merge **

Fig. 3. Axonal branching over the NMJs. NMJs of the TS muscles from WT (upper panel, N = 3, n = 47) and KO (lower panel, N = 3, n = 50) were co-stained with bungarotoxin (Btx) (green), anti-neuroﬁlament (NF) (200 kDa) antibody (red) and anti-SLC10A4 antibody (grey) to analyse the axonal branching patterns. The postsynaptic receptor clusters in KO mice lacked integrity. The presynaptic nerve termini had normal branching, although it was sometimes less detectable (*), and connected the separate clusters (inset). Scale bars: 20 lm.

C Grip strength 100 120 140 Weight (mg) WT KO B Weight (g) WT Body weight KO 0 10 20 30 A Hanging wire D Score Time (s) Reach 100 200 300 0 1 2 3 4 Fall WT KO 0 100 200 300 6 7 8 9 10 Time (s) 40 160 5

Fig. 4. Vaat KO and WT exhibit similar physical attributes and motor abili-ties. Grip strength test and wire hang test implemented to assess acute muscle strength and general muscle tone, respectively. (A) Body weights (in g) of WT and Vaat KO aged between 24 and 31 weeks (n= 24 per genotype). (B) The average maximum peak force (in mg) applied resisting the swift pull from the grid on the grip strength meter (n= 14 per genotype). (C and D) Kaplan–Meier-like plots separately for ‘fall’ and ‘reach’ scores obtained from the hanging wire test performed on mice aged between 59 and 65 weeks (n= 12 per genotype) showing similar ‘fall’ scores but a decreased average ‘reach’ score for the VAAT KO mice. Younger mice aged between 24 and 31 weeks performed equally well on the hanging wire test (data not shown).

(7)

Miniature endplate potentials (the postsynaptic response to sponta-neous, action potential-independent transmitter release) are an important index of synaptic function at the NMJ. To quantify these

events, 60 s of membrane potential was recorded perﬂexor

digito-rum brevis ﬁbre and the properties of the resultant mEPPs were

analysed. The frequency of mEPPs in Vaat KO mice proved to be

indistinguishable from that of their WT littermates (1.48 0.15 Hz,

n= 104 in WT vs. 1.66 0.14 Hz, n = 94 in Vaat KO, P > 0.05,

Fig. 4A). In contrast, however, the amplitude of mEPPs in Vaat KO mice was signiﬁcantly diminished (0.92 0.03 mV, n = 104 in

WT vs. 0.82 0.03 mV, n = 94 in Vaat KO; P < 0.05), indicating

a decreased quantal size, i.e. a reduced amount of neurotransmitter

contained within each quantum (Fig. 4B–D).

To record action potential-dependent EPPs, we recorded ﬂexor

digitorum brevis ﬁbres while simultaneously stimulating the tibial

nerve (which innervates theﬂexor digitorum brevis via the medial

plantar nerve) with a suction electrode. The properties of EPPs were derived from analysis of the average waveform of 10 sequential EPPs elicited at a frequency of 0.5 Hz. The EPPs of Vaat KO mice

had a signiﬁcantly larger amplitude (10.67 0.38 mV, n = 104 in

WT vs. 13.39 0.38 mV, n = 76 in KO; P < 0.005; Fig. 5A and

B) and slope from 10% to 90% (7.53 0.40 mV/ms, n = 104 in

WT vs. 10.93 0.47 mV/ms, n = 76 in KO; P < 0.005) when

compared with those recorded from their WT littermates (Fig. 5A and B).

As ﬁbres from Vaat KO mice exhibited larger EPPs despite their

smaller quantal size, we supposed a change in the number of quanta released per stimulus (or quantal content). An estimation of this

property was acquired by dividing a ﬁbre’s EPP amplitude by its

corresponding mEPP amplitude. We found the value for Vaat KOs to be signiﬁcantly larger than the calculated value for WT

litter-mates (12.63 0.45, n = 87 in WT vs. 17.80 0.70, n = 71 in

KO; P< 0.005; Fig. 5C and D).

Altered short-term synaptic plasticity and increased size of readily releasable pool in VAAT-deficient mice

To investigate a possible role for Vaat in the short-term synaptic plasticity of the NMJ, we utilised paired-pulse and high-frequency train stimulus protocols delivered at frequencies of 30 and 60 Hz.

At 30 Hz (33-ms interpulse interval), WT ﬁbres exhibited

paired-pulse facilitation of 6.51 1.35% (n = 66), a value not

signiﬁ-cantly different to that of KO ﬁbres (4.14 0.88%, n = 51;

P> 0.05). These results imply a constant initial release probability

WT KO 1.4±0.02Hz 1.6±0.01Hz ns A B C D 0.98±0.03mV 0.75±0.03mV

***

WT KO 0.0 0.5 1.0 1.5 2.0 2.5

*

mEPP amplitude (mV)

Fig. 5. Decreased spontaneous endplate potential amplitudes in Vaat KO. (A) Representative current-clamp recordings of WT and KO mEPPs. Scale bars: 0.5 mV, 0.5 s. (B) Rise-aligned mEPPs (grey) from representative 60-s sweeps with average event superimposed in bold (black, control; grey, KO). Scale bars: 0.4 mV, 4 ms. (C) Superimposition of the event averages in B. Note the reduced amplitude of events from Vaat KO. *** P < 0.005. Scale bars: 0.4 mV, 4 ms. (D) mEPPs are signiﬁcantly smaller in the Vaat KO (0.74 0.03) when compared with WT controls (0.96 0.03). Boxes represent 25, 50 and 75 percentiles with superimposed mean SEM and maximum and minimum values (control, n = 104; KO, n = 94; *P < 0.05).

(8)

in the neuromuscular synapses of both KO and WTﬁbres (Fig. 6A and B).

We subsequently analysed the response of NMJs to repeated stim-ulation. Fibres were subjected to 30 sequential supra-threshold (10.0 V) stimuli delivered at a frequency of 30 Hz with the ratio of

the ﬁrst EPP to subsequent EPPs (EPP1: EPPn) taken as a measure

of synaptic plasticity. After initial facilitation, synaptic responses underwent pronounced depression, rapidly reaching a plateau of

constant amplitude in both KO and WT ﬁbres. However,

compara-tive analysis of the EPP1: EPPn ratio across the full extent of the

train revealed signiﬁcant differences in synaptic depression begin-ning at stimulus seven and continuing intermittently until the end of

the protocol [WT, n= 66 vs. Vaat KO, n = 51; grey dash indicates

P< 0.05; 11/30 events (37%); Fig. 7C and D].

When the stimulus frequency was increased to 60 Hz, we saw a more modest degree of paired-pulse facilitation that was again

indis-tinguishable between WT and KO animals (2.57 1.69%, n = 34

in WT vs. 1.80 1.84%, n = 34 in KO; P > 0.05; Fig. 7E and F).

However, at this higher frequency, the synaptic depression observed during the high-frequency train was enhanced, reaching statistical signiﬁcance at the fourth stimulus and remaining so for the rest of

the train [WT, n= 34 vs. Vaat KO, n = 34; grey dash indicates

P< 0.05; 27/30 events (90%); Fig. 7G and H].

In order to address the effect of Vaat KO on the readily releasable pool of vesicles (the body of vesicles immediately available for syn-aptic release upon stimulation), we calculated the cumulative EPP amplitudes in response to the 30-Hz high-frequency train. As the

EPP amplitude plateaued by the 20th event, weﬁtted the 20th–30th

event and, by linear regression, extrapolated the EPP amplitude at

time zero (31.21 2.06 mV, n = 65 in WT vs. 33.54 1.67 mV,

n= 51 in KO; P > 0.05). Dividing a ﬁbre’s estimated EPP

ampli-tude by the ampliampli-tude of its respective mEPP gives a value for the

readily releasable pool of vesicles (Schneggenburger et al., 1999). By this measure, the readily releasable pool of vesicles of

neuro-muscular synapses from Vaat KO mice (44.41 2.54; n = 46) was

signiﬁcantly larger than that calculated for WT litter mates

(34.32 2.49; n = 57; P < 0.005 vs. KO; Fig. 8A and B). These

data suggest that KO of Vaat results in an enhancement of the num-ber of vesicles easily mobilised upon nervous stimulation.

Loss of Vaat leads to upregulation of acetylcholine receptor subunit levels in muscle

In order to assess any postsynaptic changes, we measured the expression levels of ACh receptor subunits, which constitute a func-tional pentamer in adult mouse muscles. Although the mRNA levels of subunits Chrnb1 and Chrne were similar in WT and KO mice, we observed an increase in the alpha1 and delta subunits in the cho-linergic nicotinic receptor complex (Chrna1 and Chrnd) in Vaat KO mice (Fig. 9A and B). Interestingly, the alpha subunits contain the primary ACh ligand-binding sites at residues 190–193 (Karlin et al., 1987; Abramson et al., 1989) in close apposition to the neighbour-ing non-alpha subunits, whereas the delta subunit is known to

regu-late binding afﬁnity and channel gating (Sine & Claudio, 1991;

Shen et al., 2008; Gupta et al., 2013). In the Vaat KO animals, the elevated transcript levels of the AChR subunits directly involved in ACh binding along with the increased number of readily releasable

vesicles (Fig. 9) imply compensation for less vesicular ﬁlling of

transmitter. Discussion

In this study, we investigated the potential role of VAAT in cholinergic neurotransmission at the murine NMJ by comparing the

Quantal content B C D 12.6±0.45 17.5±0.37 EPP Amplitude (mV) 0 10 20 30

***

WT KO WT KO 0 20 40 60

***

A

Fig. 6. Increased EPP amplitudes in NMJs from Vaat KO mice. (A) Representative EPPs from KO and WT controls. Traces show 10 rise-aligned and superim-posed EPPs (grey), which have been sequentially triggered at a frequency of 0.5 Hz with greyscale coded averages (WT, black; KO, grey) superimsuperim-posed. Scale bar: 2 mV, 4 ms. (B) EPPs from Vaat KO (13.39 0.38 mV) were signiﬁcantly larger when compared with control (10.60 0.67 mV). Boxes represent 25, 50 and 75 percentiles with superimposed mean SEM and maximum and minimum values (WT, n = 104; KO, n = 76, P < 0.005). (C) Traces highlighting the mEPPs and corresponding EPPs of representative control (black) and KO (grey)ﬁbers, the ratio of which (EPP : mEPP) was used to calculate quantal con-tent. Scale bar: 1 mV, 1 ms. (D) Quantal content is enhanced at the NMJ of Vaat KO mice (17.50 0.37) when compared with control (12.63 0.45). Boxes represent 25, 50 and 75 percentiles with superimposed mean SEM and maximum and minimum values (WT, n = 87; KO, n = 71, ***P < 0.005).

(9)

properties of these highly specialised synapses in VAAT null mutant mice with WT controls. We also investigated parameters related to locomotion, including weight and muscle strength, which we found to be similar between Vaat KO mice and controls. However, at the microstructural level, NMJs lacking VAAT had fewer branch points and an increased number of disconnected islands. The electrophysio-logical properties of NMJs in VAAT-deﬁcient mice were also chan-ged, with reduced mEPP amplitudes and increased EPP amplitudes. Furthermore, Vaat KO NMJs displayed aberrant short-term synaptic plasticity with increased synaptic depression upon repeated stimula-tion and a larger readily releasable pool of vesicles. Finally,

cholinergic receptor subunits were found to have an increased level of mRNA expression in the VAAT-deﬁcient muscles, implying post-synaptic sensitization.

The use of a constitutive Vaat KO is a potential caveat of this study, as compensation for the loss of this protein during develop-ment may take place. Thus, it is possible that many traits of the Vaat KO that were similar to their littermate controls, including weight, motor behaviour, muscle strength and VAChT distribution, may be more strongly affected by acute silencing of VAAT. It should also be noted that the loss of VAAT occurs at all aminergic

terminals and therefore [as serotonergic and dopaminergic

C A B 30Hz F E WT KO D KO WT 6.00% 5.96% 0 10 20 30 0.6 0.8 1.0 1.2 Normalised amplitude Event Number 0 10 20 30 Event Number

Paired pulse ratio

WT KO WT KO 0.6 1.2 1.8 ns 2.70% 1.86% WT KO WT KO G H 0.4 0.6 0.8 1.0 Normalised amplitude 0.6 1.0 1.4 ns

Paired pulse ratio

60Hz

Fig. 7. Reduced short-term synaptic plasticity of Vaat KO NMJs. (A) Representative traces of the membrane potential response of flexor digitorum brevis (FDB) musclefibers from control (black) and KO (grey) mice to a paired-pulse protocol delivered at a frequency of 30 Hz. Scale bar: 5 mV, 5 ms. Correspond-ing relative facilitation is shown adjacent. (B) Paired-pulse ratio is unchanged in Vaat KO (5.96 0.88%, n = 51) when compared with WT controls (6.00 1.35%, n = 66). (C) Representative traces of the membrane potential response of muscle fibers from control (black) and KO (grey) mice to high-fre-quency stimulation (30 Hz). Scale bar: 5 mV, 50 ms. (D) Vaat KO show enhanced synaptic depression in response to high-frehigh-fre-quency stimulation (30 Hz) (con-trol, n= 66; KO, n = 51, grey dash indicates P < 0.05). (E) Representative traces of the membrane potential response of FDB muscle fibers from control (black) and KO (grey) mice to a paired-pulse protocol delivered at a frequency of 60 Hz. Scale bar: 4 mV, 2 ms. Corresponding relative facilitation is shown adjacent. (F) Paired-pulse ratio is unchanged in Vaat KO (1.30 1.84%, n = 34) when compared with WT controls (3.00 1.69%, n = 34). (G) Representa-tive traces of the membrane potential response of musclefibers from control (black) and KO (grey) mice to high-frequency stimulation (60 Hz). Scale bar: 5 mV, 20 ms. (H) Vaat KO show enhanced synaptic depression in response to high-frequency stimulation (60 Hz) (control, n= 34; KO, n = 34, grey dash indicates P< 0.05). For histograms, boxes represent 25, 50 and 75 percentiles with superimposed mean SEM and maximum and minimum values.

(10)

modulation of motor neuron signalling is well documented (Cooper & Neckameyer, 1999; Perrier et al., 2013)] we cannot rule out the possibility that the observed alterations are the consequence of hav-ing lost VAAT at aminergic sites upstream of the NMJ. However, with regard to the electrophysiological effects in particular, we con-sider this to be less likely.

This study is, to our knowledge, theﬁrst description of the

micro-structural attributes of the NMJ in the absence of a presynaptic vesicular protein of the cholinergic system. Previously, there have been studies on the effects of loss of the VAChT on the develop-ment and function of neuromuscular synapses. A partial loss of this vesicular transporter protein results in myasthenic mice together with slight changes in cholinergic transmission; however, a detailed microstructural analysis of NMJs is missing (Prado et al., 2006; de Castro et al., 2009; Lima et al., 2010). The presence of VAAT in aminergic vesicles and its documented supportive role for transport of neurotransmitters into dopaminergic vesicles (Larhammar et al., 2014) indicate that VAAT may facilitate transport of ACh into NMJ vesicles. The changes on the postsynaptic site, especially the rear-rangement of ACh receptor clusters found in the VAAT-deﬁcient NMJs, are intriguing, although it is not clear if this is due to devel-opmental compensation or other mechanisms such as alterations in muscle, skeletal receptor tyrosine kinase levels that mediate the for-mation and maintenance of endplate structure (Burden, 2011). Somewhat surprisingly, we did not observe changes in presynaptic nerve terminal branching in KO mice compared with WT controls (Fig. 3, and Table 2). Axonal retraction is known to be associated with ageing and diseased endplate structures. However, an age-related effect on nerve terminal branching should not be ruled out at

this point; a thorough study on the effect of ageing on VAAT null mice would address this question.

At the microstructural level, NMJs lacking VAAT were clearly affected, as shown by the fewer branch points and increased number of disconnected islands. Similar disturbances of endplate arboriza-tion have been reported in, e.g. the mdx mouse [a model of Duch-enne’s muscular dystrophy (Pratt et al., 2013)] and neural cell

adhesion molecule deﬁcient mouse (Rafuse et al., 2000).

Interest-ingly, these reports demonstrate that microstructural disturbances of the NMJ do not necessarily alter neuromuscular synaptic transmis-sion. Unlike the examples above, microstructural alterations in the NMJs of Vaat KO mice were coincident with changes in their elec-trophysiological characteristics. However, electrical recordings from myasthenic patients show decreased mEPP amplitudes coincident with altered synaptic clefts in the intercostal muscles (Albuquerque et al., 1976). The observed reduction in mEPP amplitude could be due to either decreased release of ACh or a reduction in postsynap-tic responsiveness. As we found that the postsynappostsynap-tic site responded with an upregulation of receptors (Fig. 9), it is unlikely that the

postsynaptic responsiveness was decreased. We therefore ﬁnd the

most likely explanation of the decreased mEPP amplitude to be a reduction in the amount of ACh released per vesicle.

Given the smaller amplitude of mEPPs in the Vaat KO mouse, one would expect correspondingly reduced amplitudes for EPPs, yet

weﬁnd the reverse – increased EPP amplitudes. Our data suggest

that this apparent paradox is most likely the result of a combination of presynaptic and postsynaptic changes, i.e. the observed increase in the readily releasable pool of vesicles and the upregulation of postsynaptic receptors. Moreover, it is also likely that these changes

B A 0 100 200 300 31.2±2.1mV 33.5±1.7mV ns Cumulative EPP Amplitude (mV)

0 5 10 15 20 25 30 WT KO —20 0 20 40 60 80 100 RRP Size **

Fig. 8. Vaat KO mice have an enlarged readily releasable pool (RRP) of vesicles. (A) Mean cumulative EPP amplitudes in WT (black) and KO (grey). Ten data points from the 20th to the 30th stimulus wereﬁtted by linear regression and back extrapolated to give an estimate of EPP at time zero (grey inset). The estimated EPP amplitude was unchanged in Vaat KO mice (47.40 2.6 mV) when compared with WT controls (41.60 2.9 mV) (control, n = 65; KO, n= 51, P > 0.05). (B) Estimated EPP amplitude was divided by mEPP amplitude in order to give an estimate of the RRP. Vaat KO mice showed an enhanced number of quanta (44.41 2.54) in the RRP when compared with WT controls (34.32 2.49) (control, n = 56; KO, n = 47, **P < 0.005). Boxes represent 25, 50 and 75 percentiles with superimposed mean SEM and maximum and minimum values.

Chrna1

Relative expression

Chrnb1 Chrnd Chrne P2X7 P2Y1

* WT

Vaat KO

Nicotinic ACh receptor subunits ATP receptors ns A a1 d a1 e b1 B Postsynaptic membrane ACh molecule Sodium ions 0 1 2

Fig. 9. Transcript levels of mRNAs encoding ACh receptor (AChR) subunits. (A) Relative mRNA transcript levels of muscle-specific AChR subunits Chrna1, Chrnb1, Chrnd and Chrne along with two ATP receptors P2X7 and P2Y1 known to be expressed in skeletal muscle. We found a significant upregulation of Chrna1 (n= 12, P = 0.03) and a trend of upregulation of Chrnd (n = 12, P = 0.058). White bars, WT; grey bars, Vaat KO. *P < 0.05. (B) Schematic of a nic-otinic AChR embedded in the muscle endplate membrane, with the subunits named as a1, b1, d and e. ACh binding causes a change in the conformation of the subunits and allowsflow of Na+_{ions into the muscle}_fibre.

(11)

to the readily releasable pool explain the more pronounced synaptic depression of NMJs lacking VAAT, as such synapses would be more rapidly exhausted upon repeated stimulation.

Although our data provide an explanation, other factors may con-tribute to the increased EPP amplitude. ATP is known to be released from the NMJ (Meunier et al., 1975) and at millimolar concentra-tions negatively modulates ACh transmission, reducing the endplate current amplitudes of evoked but not spontaneous events (Giniatullin & Sokolova, 1998). Furthermore, adenosine broken down from ATP in the synaptic cleft can initiate adenosine receptor-mediated modu-lation of ACh release, reducing the magnitude of synaptic

depres-sion during repetitive activity (Redman & Silinsky, 1994).

Accordingly, a reduction in synaptically released ATP could poten-tially enhance both evoked response and synaptic depression, predic-tions that are in line with our observapredic-tions. Intravesicular ATP is an important co-factor for vesicular ACh uptake; a disturbed ATP uptake mechanism would probably reduce the amount of ACh per vesicle. Such an occurrence could also explain both the reduced mEPP amplitude and [as ACh is an important factor for the develop-mental wiring of the NMJ (Pittman & Oppenheim, 1979; Oppen-heim et al., 2008)] the microstructural alterations observed. More investigations are needed to substantiate these speculations. To this

end, in RT-PCR experiments, we did not ﬁnd any changes in the

levels of the two postsynaptic ATP receptors between the genotypes. However, we found a speciﬁc 40% reduction in the mRNA levels of adenosine receptor A2A, a presynaptic purinergic receptor in motor neurons (Supporting Information Fig. S2B). Other cellular events involving protein kinase C and protein kinase A downstream of presynaptic adenosine receptors (Cunha, 2001), as well as musca-rinic ACh receptors (Wright et al., 2009), may contribute to modu-lating cholinergic transmission in the absence of VAAT and should be investigated.

In conclusion, we interpret our ﬁndings such that the loss of

VAAT leads to a reduction in vesicular loading of the neurotrans-mitter ACh. This manifests itself as a reduced mEPP amplitude, which results in compensatory changes, part of which account for the absence of a motor phenotype. These include an increased read-ily releasable pool of vesicles, altered NMJ architecture and changes in both presynaptic and postsynaptic receptors. These results high-light a novel and potentially important role for VAAT in cholinergic neurotransmission whose further study may provide a better under-standing of synaptic physiology and the treatment of neuromuscular disease (Ruff, 2011).

Supporting Information

Additional supporting information can be found in the online ver-sion of this article:

Fig. S1. Immunohistochemistry of gastrocnemius muscle from post natal day 2 (p2) and adult mice showing colocalization of VAChT (yellow) and VAAT (red) in the end plate region marked by Btx (green).

Fig. S2. 3D analysis of the endplate regions revealed similar trend as in 2D analysis.

Acknowledgements

We thank J. Jonsson and S. Perry for critical reading of the manuscript, A. Raja for technical assistance and M. Blunder for providing mice. Professor R. Ribchester (Edinburgh University, Scotland) explained theﬂexor digito-rum brevis–tibialis and TS muscle preparations extensively used in this study. The mouse antibody to synaptophysin was a generous gift from Pro-fessor Reinhard Jahn (Gottingen, Germany). This work was ﬁnanced by

grants from the Swedish Medical Research Council, Hallsten and Swedish Brain Foundations. K.K. is a Royal Swedish Academy of Sciences Research Fellow supported by a grant from the Knut and Alice Wallenberg Founda-tion. The authors declare no conﬂict of interest.

Abbreviations

3D, three-dimensional; ACh, acetylcholine; EPP, evoked endplate potential; KO, knockout; mEPP, miniature endplate potential; NMJ, neuromuscular junction; PBS, phosphate-buffered saline; PBST, phosphate-buffered saline/ 0.5% Tweenâ; PCR, polymerase chain reaction; SLC10A4, solute carrier fam-ily 10 member 4; TS, triangularis sterni; VAAT, vesicular aminergic-associated transporter; VAChT, vesicular acetylcholine transporter; WT, wild-type.

References

Abramson, S.N., Li, Y., Culver, P. & Taylor, P. (1989) An analog of lopho-toxin reacts covalently with Tyr190 in the alpha-subunit of the nicotinic acetylcholine receptor. J. Biol. Chem.,264, 12666–12672.

Albuquerque, E.X., Rash, J.E., Mayer, R.F. & Satterﬁeld, J.R. (1976) An electrophysiological and morphological study of the neuromuscular junc-tion in patients with myasthenia gravis. Exp. Neurol.,51, 536–563. Borges, K. (2013) Slc10A4 - what do we know about the function of this

“secret ligand carrier” protein? Exp. Neurol., 248, 258–261.

Boyd, I.A. & Martin, A.R. (1956) The end-plate potential in mammalian muscle. J. Physiol.,132, 74–91.

Brooks, S.P. & Dunnett, S.B. (2009) Tests to assess motor phenotype in mice: a user’s guide. Nat. Rev. Neurosci., 10, 519–529.

Burden, S.J. (2011) SnapShot: neuromuscular Junction. Cell,144, e821. Burger, S., D€oring, B., Hardt, M., Beuerlein, K., Gerstberger, R. & Geyer, J.

(2011) Co-expression studies of the orphan carrier protein Slc10a4 and the vesicular carriers VAChT and VMAT2 in the rat central and peripheral nervous system. Neuroscience,193, 109–121.

de Castro, B.M., De Jaeger, X., Martins-Silva, C., Lima, R.D.F., Amaral, E., Menezes, C., Lima, P., Neves, C.M.L., Pires, R.G., Gould, T.W., Welch, I., Kushmerick, C., Guatimosim, C., Izquierdo, I., Cammarota, M., Rylett, R.J., Gomez, M.V., Caron, M.G., Oppenheim, R.W., Prado, M.A.M. & Prado, V.F. (2009) The vesicular acetylcholine transporter is required for neuromuscular development and function. Mol. Cell. Biol.,29, 5238–5250. Choi, H.Y., Liu, Y., Tennert, C., Sugiura, Y., Karakatsani, A., Kroger, S., Johnson, E.B., Hammer, R.E., Lin, W. & Herz, J. (2013) APP interacts with LRP4 and agrin to coordinate the development of the neuromuscular junction in mice. eLife,2, e00220.

Cooper, R.L. & Neckameyer, W.S. (1999) Dopaminergic modulation of motor neuron activity and neuromuscular function in Drosophila melanog-aster. Comp. Biochem. Phys. B.,122, 199–210.

Court, F.A., Hewitt, J.E., Davies, K., Patton, B.L., Uncini, A., Wrabetz, L. & Feltri, M.L. (2009) A laminin-2, dystroglycan, utrophin axis is required for compartmentalization and elongation of myelin segments. J. Neurosci., 29, 3908–3919.

Cunha, R.A. (2001) Adenosine as a neuromodulator and as a homeostatic regulator in the nervous system: different roles, different sources and dif-ferent receptors. Neurochem. Int.,38, 107–125.

Geyer, J., Fernandes, C.F., Doring, B., Burger, S., Godoy, J.R., Rafalzik, S., Hubschle, T., Gerstberger, R. & Petzinger, E. (2008) Cloning and molecu-lar characterization of the orphan carrier protein Slc10a4: expression in cholinergic neurons of the rat central nervous system. Neuroscience,152, 990–1005.

Giniatullin, R.A. & Sokolova, E.M. (1998) ATP and adenosine inhibit trans-mitter release at the frog neuromuscular junction through distinct presynap-tic receptors. Brit. J. Pharmacol.,124, 839–844.

Gupta, S., Purohit, P. & Auerbach, A. (2013) Function of interfacial prolines at the transmitter-binding sites of the neuromuscular acetylcholine receptor. J. Biol. Chem.,288, 12667–12679.

Karlin, A., DiPaola, M., Kao, P.N. & Lobel, P. (1987) Functional sites and transient states of the nicotinic acetylcholine receptor. Soc. Gen. Phy.,41, 43–65.

Larhammar, M., Patra, K., Blunder, M., Emilsson, L., Peuckert, C., Arvidsson, E., R€onnlund, D., Preobraschenski, J., Birgner, C., Limbach, C., Widengren, J., Blom, H., Jahn, R., Wallen-Mackenzie, A. & Kullander, K. (2014) SLC10A4 is a vesicular amine-associated transporter modulating dopamine homeostasis. Biol. Psychiat., doi: 10.1016/j.biopsych.2014. 07.017. [Epub ahead of print].

(12)

Lima, R.D., Prado, V.F., Prado, M.A.M. & Kushmerick, C. (2010) Quantal release of acetylcholine in mice with reduced levels of the vesicular acetyl-choline transporter. J. Neurochem.,113, 943–951.

Liu, Y., Padgett, D., Takahashi, M., Li, H., Sayeed, A., Teichert, R.W., Oli-vera, B.M., McArdle, J.J., Green, W.N. & Lin, W. (2008) Essential roles of the acetylcholine receptor gamma-subunit in neuromuscular synaptic patterning. Development,135, 1957–1967.

Liu, Y., Sugiura, Y. & Lin, W. (2011) The role of synaptobrevin1/VAMP1 in Ca2+-triggered neurotransmitter release at the mouse neuromuscular junction. J. Physiol.,589, 1603–1618.

Marder, E. (2012) Neuromodulation of neuronal circuits: back to the future. Neuron,76, 1–11.

Martin, A.R. (1955) A further study of the statistical composition of the end-plate potential. J. Physiol.-London,130, 114–122.

Meunier, F., Israel, M. & Lesbats, B. (1975) Release of ATP from stimulated nerve electroplaque junctions. Nature,257, 407–408.

Oppenheim, R.W., Caldero, J., Cuitat, D., Esquerda, J., McArdle, J.J., Olivera, B.M., Prevette, D. & Teichert, R.W. (2008) The rescue of devel-oping avian motoneurons from programmed cell death by a selective inhibitor of the fetal muscle-speciﬁc nicotinic acetylcholine receptor. Dev. Neurobiol.,68, 972–980.

Perrier, J.F., Rasmussen, H.B., Christensen, R.K. & Petersen, A.V. (2013) Modulation of the intrinsic properties of motoneurons by serotonin. Curr. Pharm. Design,19, 4371–4384.

Pittman, R. & Oppenheim, R.W. (1979) Cell death of motoneurons in the chick embryo spinal cord. IV. Evidence that a functional neuromuscular interaction is involved in the regulation of naturally occurring cell death and the stabilization of synapses. J. Comp. Neurol.,187, 425–446. Popova, S.N. & Alafuzoff, I. (2013) Distribution of SLC10A4, a synaptic

vesicle protein in the human brain, and the association of this protein with Alzheimer’s disease-related neuronal degeneration. J. Alzheimers Dis., 37, 603–610.

Prado, V.F., Martins-Silva, C., de Castro, B.M., Lima, R.F., Barros, D.M., Amaral, E., Ramsey, A.J., Sotnikova, T.D., Ramirez, M.R., Kim, H.G., Ros-sato, J.I., Koenen, J., Hui, Q., Cota, V.R., Moraes, M.F.D., Gomez, M.V., Guatimosim, C., Wetsel, W.C., Kushmerick, C., Pereira, G.S., Gainetdinov, R.R., Izquierdo, I., Caron, M.G. & Prado, M.A.M. (2006) Mice deﬁcient for the vesicular acetylcholine transporter are myasthenic and have deﬁcits in object and social recognition. Neuron,51, 601–612.

Prakash, Y.S., Miller, S.M., Huang, M. & Sieck, G.C. (1996) Morphology of diaphragm neuromuscular junctions on differentﬁbre types. J. Neurocytol., 25, 88–100.

Pratt, S.J., Shah, S.B., Ward, C.W., Inacio, M.P., Stains, J.P. & Lovering, R.M. (2013) Effects of in vivo injury on the neuromuscular junction in healthy and dystrophic muscles. J. Physiol.,591, 559–570.

Rafuse, V.F., Polo-Parada, L. & Landmesser, L.T. (2000) Structural and functional alterations of neuromuscular junctions in NCAM-deﬁcient mice. J. Neurosci.,20, 6529–6539.

Raymackers, J.M., Debaix, H., Colson-Van Schoor, M., De Backer, F., Tajeddine, N., Schwaller, B., Gailly, P. & Gillis, J.M. (2003) Consequence of parvalbumin deﬁciency in the mdx mouse: histological, biochemical and mechanical phenotype of a new double mutant. Neuromuscular Disord.,13, 376–387.

Redman, R.S. & Silinsky, E.M. (1994) ATP released together with acetyl-choline as the mediator of neuromuscular depression at frog motor nerve endings. J. Physiol.,477, 117–127.

Ribchester, R.R. (2009) Mammalian neuromuscular junctions: modern tools to monitor synaptic form and function. Curr. Opin. Pharmacol.,9, 297–305. Ribchester, R. (2011) Quantal analysis of endplate potentials in mouseﬂexor

digitoum brevis muscle. Curr. Protoc. Mouse Biol.,1, 429–444.

Ribchester, R.R., Thomson, D., Wood, N.I., Hinks, T., Gillingwater, T.H., Wishart, T.M., Court, F.A. & Morton, A.J. (2004) Progressive abnormali-ties in skeletal muscle and neuromuscular junctions of transgenic mice expressing the Huntington’s disease mutation. Eur. J. Neurosci., 20, 3092– 3114.

Ruff, R.L. (2011) Endplate contributions to the safety factor for neuromuscu-lar transmission. Muscle Nerve,44, 854–861.

Schindelin, J., Arganda-Carreras, I., Frise, E., Kaynig, V., Longair, M., Pietzsch, T., Preibisch, S., Rueden, C., Saalfeld, S., Schmid, B., Tinevez, J.Y., White, D.J., Hartenstein, V., Eliceiri, K., Tomancak, P. & Cardona, A. (2012) Fiji: an open-source platform for biological-image analysis. Nat. Methods,9, 676–682.

Schneggenburger, R., Meyer, A.C. & Neher, E. (1999) Released fraction and total size of a pool of immediately available transmitter quanta at a calyx synapse. Neuron,23, 399–409.

Shen, X.M., Fukuda, T., Ohno, K., Sine, S.M. & Engel, A.G. (2008) Con-genital myasthenia-related AChR delta subunit mutation interferes with in-tersubunit communication essential for channel gating. J. Clin. Invest., 118, 1867–1876.

Sine, S.M. & Claudio, T. (1991) Gamma- and delta-subunits regulate the afﬁnity and the cooperativity of ligand binding to the acetylcholine recep-tor. J. Biol. Chem.,266, 19369–19377.

Thomas, L., Hartung, K., Langosch, D., Rehm, H., Bamberg, E., Franke, W.W. & Betz, H. (1988) Identiﬁcation of synaptophysin as a hexameric channel protein of the synaptic vesicle membrane. Science,242, 1050–1053. Wood, S.J. & Slater, C.R. (2001) Safety factor at the neuromuscular junction.

Prog. Neurobiol.,64, 393–429.

Wright, M.C., Potluri, S., Wang, X., Dentcheva, E., Gautam, D., Tessler, A., Wess, J., Rich, M.M. & Son, Y.J. (2009) Distinct muscarinic ace-tylcholine receptor subtypes contribute to stability and growth, but not compensatory plasticity, of neuromuscular synapses. J. Neurosci., 29, 14942–14955.

Zelano, J., Mikulovic, S., Patra, K., Kuhnemund, M., Larhammar, M., Em-ilsson, L., Leao, R. & Kullander, K. (2013) The synaptic protein encoded by the gene Slc10A4 suppresses epileptiform activity and regulates sensi-tivity to cholinergic chemoconvulsants. Exp. Neurol.,239, 73–81.