UNIVERSIDADE ESTADUAL DE CAMPINAS FACULDADE DE ODONTOLOGIA DE PIRACICABA
AMANDA BANDEIRA DE ALMEIDA
ISOLAMENTO E CARACTERIZAÇÃO DE UMA LINHAGEM DE CEMENTÓCITOS.
CHARACTERIZATION OF A CEMENTOCYTE-LIKE CELL LINE
Piracicaba 2017
AMANDA BANDEIRA DE ALMEIDA
ISOLAMENTO E CARACTERIZAÇÃO DE UMA LINHAGEM DE
CEMENTÓCITOS
CHARACTERIZATION OF A CEMENTOCYTE-LIKE CELL LINE
Dissertation presented to the Piracicaba Dental School of the University of Campinas in partial fulfillment of requirements for the degree of Master in Clinical Dentistry, in Periodontology area.
Dissertação apresentada à Faculdade de Odontologia de Piracicaba da Universidade Estadual de Campinas como parte dos requisitos exigidos para obtenção do titulo de Mestra em Clínica Odontológica, na Área de Periodontia.
Orientador: Prof.Dr.Francisco Humberto Nociti Júnior Este exemplar corresponde à versão final da dissertação defendida por Amanda Bandeira de Almeida e orientada pelo Prof. Dr. Francisco Humberto Nociti Júnior.
Piracicaba 2017
DEDICATÓRIA
À DEUS.
Pelas oportunidades que me proporcionou ao longo de minha vida. Pelas benções sobre mim derramadas, pela sapiência nas tomadas de decisão e construção deste trabalho. Pelas pessoas maravilhosas que estiveram, estão e sempre estarão ao meu lado.
AOS MEUS PAIS.
Dedico a vocês essa nova conquista que foi conquistada por parte de seus esforços. Mesmo distantes, estiveram sempre comigo, ensinando-me, apoiando-me, amando-me incondicionalmente e acreditando em mim.
AOS MEUS AVÔS (in memorian).
Dedico a vocês a minha trajetória de vida. Estarás sempre comigo, pois quando um amor é muito forte, permanece vivo em suas lembranças.
AGRADECIMENTOS
À Universidade Estadual de Campinas, na pessoa do magnífico Reitor Prof. Dr. José Tadeu Jorge e à Faculdade de Odontologia de Piracicaba (FOP), por meio do Diretor Prof. Dr. Guilherme Elias Pessanha Henriques.
À Profª Drª Cinthia P. M. Tabchoury, coordenadora dos cursos de Pós Graduação da FOP/UNICAMP e à Profª Drª Karina Gonzales Silvério Ruiz, coordenadora do Programa de Pós-Graduação em Clínica OdonÓológica da FOP/UNICAMP.
Ao Prof. Dr. Francisco Humberto Nociti Júnior, meu orientador de mestrado, pela chance e confiança no trabalho realizado por mim. Obrigada pelo intenso crescimento, amadurecimento, atenção, exigências e qualidade de orientação. Muito obrigada por ser meu exemplo.
Aos professores da área de Periodontia Prof. Dr. Antônio Wilson Sallum, Prof. Dr. Enilson Antônio Sallum, Prof. Dr. Márcio Zaffalon Casat, Profª Drª Karina Gonzales Silvério Ruiz, Profª Drª Denise Carleto Andia e Prof. Dr. Renato Corrêa Viana Casarin. Obrigado pelos ensinamentos e por dividirem suas experiências clínicas e laboratoriais que foram fundamentais na minha formação como futura mestre em periodontia.
À Fundação de Amparo a Pesquisa no Estado de São Paulo (FAPESP), pela bolsa (2015/07232-0) e auxílio (2015/06372-2) de pesquisa concedidos.
Aos professores das bancas de qualificação Profª Drª Cristiane Ribeiro Salmon, Profª Drª Denise Carleto Andia, Prof Dr Renato Corrêa Viana Casarin e Profª Drª Samira Salmeron pela criteriosa avaliação e estimadas contribuições que tornaram exequível este projeto.
Aos professores titulares e suplentes da banca de defesa desta dissertação: Prof. Dr. Francisco Humberto Nociti Júnior, Profª Drª Karina Gonzales Silvério Ruiz, Profª Drª Bruna Rabelo Amorin, Profª Drª Luciane Martins e Profª Drª Daiana Cristina Pruzzo pela disponibilidade em compartilhar seus conhecimentos científicos em prol deste trabalho.
À Regina Célia Corrêa Caetano da Silva e Mariane Lazarim, que sempre estiveram dispostas a ajudar. Obrigada pela paciência e bom-humor no dia a dia.
Aos meus amigos de Pós-Graduação, Rafaela Videira Clima da Silva, Rahyza Inácio Freire de Assis, Elis Lira dos Santos, Manoelito Ferreira Silva Júnior, Marcela Di Moura Barbosa, Mabelle de Freitas Monteiro, Manuela Rocha dos Santos, Ana Lívia Fioleto, Fernanda Felix Cordeiro Dias, Isabela Lima França, Mércia Jussara da Silva Cunha, Viviene Santana Barbosa, Samira Salmeron, João Paulo Menck Sangiorgio, Tiago Taiete e Thiago Ozi Bueno, Angelina Serafini Bergamin e Thais Rochette que deixaram e deixam a Pós-Graduação mais confortável e se tornaram minha família em Piracicaba.
Aos colegas de Pós-Graduação, Tiago Tarbes Vianna, Miki Taketomi Saito, Mayra Laino Albiero pela paciência e por tudo que foi transmitido durante esse período.
Aos meus amigos de Pós-Graduação das áreas de Prótese, Odontopediatria e Dentística. Obrigada pelo carinho, apoio e alegrar ainda mais minha vida.
À minha amiga Laís Mattos, pela confiança e carinho desde a época de Graduação. À minha família, em especial aos meus primos Willterson Carlos Bandeira e Guilherme Henrique Bandeira por serem meus exemplos desde infância.
Enfim, sou profundamente grata a todos que, direta ou indiretamente, contribuíram para a concretização deste ideal.
EPÍGRAFE
“Que os vossos esforços desafiem as impossibilidades, lembrai-vos de que as grandes coisas do homem foram conquistadas do que parecia impossível.”
Charles Chaplin
RESUMO
O cemento dental é um tecido mineralizado que recobre a raiz do dente e possui função de fixação e posição posteruptiva dental. Tem sido relatado ser altamente semelhante ao osso em vários aspectos, entretanto permanece mal compreendido em termos de desenvolvimento e regeneração. A pergunta é se o cementócito, a célula residente no cemento celular, tem potencial para ser responsável da homeostase do cemento dental, respondendo aos sinais endócrinos e regulatórios do metabolismo local do cemento dental. A partir disso, o objetivo do trabalho foi isolar e caracterizar uma linhagem de cementócitos de dentes humanos e avaliar a viabilidade e proliferação celular frente ao tratamento com fosfato inorgânico. A partir de dentes humanos erupcionados saudáveis, isolou-se células utilizando uma determinada sequência de digestões com colagenase / EDTA, e mantiveram-se essas células em placas de cultura padrão. Descreve-se as propriedades de uma linhagem celular clonada a partir destas culturas, denominada HCY-23 (para o clone de cementócito humano 23) que apresentou expressão gênica compatível com cementócitos, incluindo a expressão da proteína da matriz dentinária 1 (DMP1+), esclerostina (SOST+), E11/gp38/Podoplanina (E11+) e osteoprotegerina (OPG+). Em contraste, estas células não expressaram a sialofosfoproteína dentinária (DSPP-). As células HCY-23 produziram nódulos de tipo mineral in vitro sob condições de diferenciação e aparesentaram diferenças quanto proliferação e viabilidade celular quando induzidas com fosfato inorgânico (Pi). Em conclusão, esta nova linhagem celular deve ser essencial para determinar a forma como os cementócitos contribuem para a homeostasia e regeneração periodontal.
ABSTRACT
Dental cementum is a mineralized tissue covering the tooth root that functions in tooth attachment and posteruptive adjustment of tooth position. It has been reported to be highly similar to bone in several respects but remains poorly understood in terms of development and regeneration. The question is whether cementocytes, the residing cells in cellular cementum, have the potential to be protagonist in dental cementum homeostasis, responding to endocrine signals and local regulator dental cementum metabolism. From this, the projects aim was isolate and characterize a human teeth cementocyte line and evaluate the cell viability and proliferation against inorganic phosphate treatment. From healthy erupted human teeth, the cells were isolated using sequential collagenase / EDTA digestions, and maintained them in standard cell culture conditions. A cementocyte-like cell line was cloned HCY-23 (human cementocyte clone 23), which presented a cementocyte compatible gene expression signature, including the expression of dentin matrix protein 1 (DMP1+), sclerostin (SOST+), E11/gp38/podoplanin (E11+), and osteoprotegerin (OPG+). In contrast, these cells did not express the marker dentin sialophosphoprotein (DSPP-). HCY-23 cells produced mineral-like nodules in vitro under differentiation conditions, and were higly responsive to inorganic phosphate (Pi). In conclusion, this newly established human-derived cementocyte-like cell line should prove essential for determining the role of cementocytes on periodontal homestasis and regeneration.
SUMÁRIO
1 INTRODUÇÃO ... 12
2 ARTIGO: Isolation and characterization of a human cementocyte-like cell line, hcy-23 ... 15
3 CONCLUSÃO ... 34
REFEÊNCIAS ... 35
ANEXOS... 43
ANEXO 1 – COMITÊ DE ÉTICA EM PESQUISA ... 43
1 INTRODUÇÃO
Nos seres humanos, os dentes não estão ligados de forma rígida ao osso alveolar, existe o ligamento periodontal, formado por tecido conjuntivo, localizado entre a raiz do dente e o osso alveolar ao seu redor. No ligamento periodontal maduro, os feixes de fibras estão inseridos de um lado no cemento dental e de outro no osso alveolar, referidas como fibras de Sharpey (1). O cemento dental é composto por uma matriz rica em fatores de crescimento que pode influenciar as atividades celulares do periodonto (2, 3). Pode--‐se definir o cemento dental como uma matriz extracelular composta por colágeno, fibras de Sharpey, glicosaminoglicanos proteoglicanos e hidroxiapatita inorgânica, e tem como principal função servir de estrutura anatômica local para fixação das fibras de Sharpey do ligamento periodontal e estabilização dos dentes (4). O cemento dental, comparado ao osso alveolar quanto às características estruturais, não possui organização lamelar, é avascular (na maioria das espécies estudadas), não contém medula óssea e não sofre remodelação fisiológica (5). Nos últimos 20 anos ocorreu um avanço importante nos conhecimentos celulares e eventos moleculares envolvidos no processo de desenvolvimento do periodonto. Com isso, novas estratégias terapêuticas para regeneração periodontal têm sido propostas aplicando esses novos conhecimentos (6-15). Entre estas estratégias destaca-se a utilização de fatores de crescimento como uma forma de se obter a reconstrução dos tecidos periodontais como, por exemplo, o fator de crescimento derivado de plaquetas (PDGF) e insulina (IGF) (16-22), fator de crescimento tranformador beta 1 (TGF- β1) (23), fator de crescimento de fibroblastos básico (FGF) (24), e proteínas morfogenéticas do osso (BMP) (25-30).
O cemento dental é um tecido que não sofre remodelação quando comparado ao osso, no entanto aumenta sua espessura ao longo da vida. Para isso, células progenitoras de cementoblastos são recrutadas para repor as células que chegam ao fim de sua função. Embora o tipo específico celular capaz de diferenciar-se em cementoblastos permaneça desconhecido, supõe-se que as células recrutadas, tanto para manutenção da homeostasia quanto para regeneração e reparação, são originadas do ligamento periodontal. Entretanto, os fatores que regulam o recrutamento e a diferenciação dessas células ainda não foram elucidados (31-33). Sabe-se, contudo, que o cemento pode ser regulado por diversos fatores em comum com o osso (33).
13
A origem e a natureza das moléculas que desencadeiam essa migração celular e o processo de diferenciação dos cementoblastos não são totalmente conhecidas (32). Entretanto, diversos estudos têm sugerido possibilidades. Cho e Garant (34) sugeriram que há uma substância química feita no processo de dentinogênese que atua semelhante há um quimioatrativo em células do folículo dental em molares de ratos. Outros autores sugerem que interações entre bainha epitelial de Hertwig e o folículo dental podem, eventualmente, levar à diferenciação dos cementoblastos (35). Embora tais interações tenham sido supostas, nada foi comprovado até agora e a origem dos cementoblastos e o papel das células da bainha de Hertwig na cementogênese permanece ainda desconhecido (31). Foi sugerido, também, que proteínas extracelulares não-colágenas encontradas no cemento dental e tecido ósseo, possuem um papel na diferenciação cementoblástica, tais como sialoproteína óssea (BSP) e osteopontina (OPN) (32, 36). Enquanto outros estudos não conseguiram mostrar a presença de proteínas da matriz do esmalte na superfície radicular e, consequentemente, sua relação na cementogênese (32, 37), destacaram que as células da camada interna da bainha epitelial de Hertwig mantém, por um certo tempo, o potencial de secreção e produção de proteínas do esmalte. Entretanto, os autores também não conseguiram esclarecer como estas proteínas influenciam a cementogênese.
Sobre a formação de cementócitos sabe-se que pré-cementoblastos se diferenciam em cementoblastos ao longo da matriz de dentina não mineralizada e depositam a matriz de cemento de forma rápida e multipolarizada, levando à deposição de matriz ao redor dos próprios cementoblastos e à incorporação deles ao cemento (38, 39), passando a ser chamados de cementócitos. Os cementócitos ocupam lacunas e emitem projeções, estabelecendo, por meio de canalículos, uma intercomunicação (32, 39).
Comparado aos osteócitos, os cementócitos são mais dispersos, dispostos em uma forma aleatória, e apresentam densidade inferior de canalículos (40). Embora o sistema de fluido canalicular pareça ser bem desenvolvido em regiões profundas do cemento dental, os cementócitos localizados nessas áreas da matriz cementária possuem capacidade endocítica menor que aqueles presentes perto da superfície radicular (41).
Sabe--‐se que a homeostasia do tecido ósseo é regulada pelas atividades de três importantes tipos celulares: osteoblastos, osteócitos e osteoclastos. Atualmente, os osteócitos têm uma reconhecida importância no controle da maioria dos eventos relacionados a homeostasia do tecido ósseo, incluindo um papel regulatório na remodelação óssea e níveis
séricos de fosfato (42), por meio da expressão de fatores como FGF--‐23 (fator de crescimento fibroblástico 23), DMP--‐1(proteína da matriz de dentina 1) e SOST (esclerostina) (42).
Para que ocorra a deposição mineral normal em dentes e ossos, é necessário um ajuste entre os níveis extracelulares dos íons fosfato inorgânico (Pi) e pirofosfato inorgânico (PPi), o qual é um potente inibidor da formação de cristais de hidroxiapatita (HAP). Considerando a hipótese de que a regeneração periodontal mimetiza os episódios do desenvolvimento embrionário, pesquisas recentes têm como objetivo investigar células e moduladores necessários para formar a regeneração periodontal (46, 47, 48, 49, 50). Algumas linhas de pesquisas exploram o efeito do fosfato na formação do cemento dental. Investiga-se tecidos e células de camundongos com mutações genéticas que afetam os níveis de fosfato e pirofosfato no periodonto, objetivando aplicar esses conhecimentos no desenvolvimento de terapias que promovam a regeneração dos tecidos periodontais e orais.
Sugere-se que cementoblastos, juntamente com células do ligamento periodontal e do osso alveolar, sejam essenciais para a manutenção da homeostasia dos tecidos periodontais (7, 43, 44, 45) entretanto, o papel dos cementócitos nesse processo permanece desconhecido. Dadas as características morfológicas e biológicas comuns entre osteócitos e cementócitos, além das similaridades entre a matriz do tecido ósseo e do cemento dental, a hipótese é de que cementócitos possam exercer um papel importante para a manutenção não apenas do cemento dental, mas também de todo o conjunto que compõe o periodonto de sustentação. Desta forma, visando determinar o potencial dos cementócitos na participação de eventos biológicos no periodonto, o objetivo do presente trabalho foi isolar e caracterizar uma linhagem de cementócitos a partir de dentes humanos e avaliar a proliferação e viabilidade frente ao tratamento com fosfato inorgânico.
15
2 ARTIGO
ISOLATION AND CHARACTERIZATION OF A HUMAN
CEMENTOCYTE-LIKE CELL LINE, HCY-23
Manuscrito submetido à revista Brazilian Journal of Oral Science
Amanda B. Almeida1, Elis J. Santos1, Enilson A. Sallum1, Márcio Z. Casati1, Karina S. Ruiz1, Kamila R. Kantovitz2, Francisco H. Nociti Jr1,*.
1
Department of Prosthodontics and Periodontics, Division of Periodontics, Piracicaba School Dental, State University of Campinas,São Paulo, Brazil.
2
Department of Dental Materials, São Leopoldo Mandic Dental Research Center, Campinas, São Paulo, Brazil.
* Corresponding author:
Dr. Francisco Humberto Nociti, Jr.
Department of Prosthodontics and Periodontics, Periodontics Division, Piracicaba Dental School, University of Campinas (UNICAMP). Av. Limeira, 901, 13414-903, Piracicaba, SP, Brazil.
Phone: 55 19 21065298 Fax: 55 19 21065301
E-mail address: nociti@fop.unicamp.br
Financiamento: Fundação de Amparo à Pesquisa do Estado de São Paulo (2015/07232-0, 2015/06372-2).
ABSTRACT
Dental cementum is a mineralized tissue covering the tooth root that functions in tooth attachment and posteruptive adjustment of tooth position. It has been reported to be highly similar to bone in several respects but remains poorly understood in terms of development and regeneration. Here, the question was whether cementocytes, the residing cells in cellular cementum, have potential to be protagonist in dental cementum homeostasis, responding to endocrine signals and directing local cementum metabolism. From healthy erupted human teeth, isolated cells using sequential collagenase / EDTA digestions, and maintained them standard cell culture conditions. A cementocyte-like cell line was cloned (HCY-23, for human cementocyte clone 23), which presented a cementocyte compatible gene expression signature, including the expression of dentin matrix protein 1 (DMP1+), sclerostin (SOST+), E11/gp38/podoplanin (E11+), and osteoprotegerin (OPG+). In contrast, these cells did not express the marker dentin sialophosphoprotein (DSPP-). HCY-23 cells produced mineral-like nodules in vitro under differentiation conditions, and were higly responsive to inorganic phosphate (Pi). In conclusion, this newly established human-derived cementocyte-like cell line should prove essential for determining the role of cementocytes on periodontal homestasis and regeneration.
17
INTRODUCTION
Dental cementum, a mineralized tissue covering the tooth root, is present in two types, acellular and cellular (1). Acellular cementum (acellular extrinsic fiber cementum, or primary cementum) has been described as a critical factor for tooth attachment and covers the most coronal area of the tooth root. In contrast, cellular cementum (cellular intrinsic fiber cementum, or secondary cementum) has been proposed to play a role in posteruptive adjustment of tooth position (1), and is located at the apical roots and furcation regions. During cellular cementum development, cementoblasts secrete a layer of unmineralized extracellular matrix (ECM), called cementoid, and as the cementoid deposition progresses, cementoblasts might be entraped in the ECM and become cementocytes. Like bone, dental cementum ECM is primarily composed of collagen (predominantly type I and smaller amounts of types III, IV, V, XI, and XII), several non-collagenous proteins, including bone sialoprotein (BSP) and osteopontin (OPN), and proteoglycans, such as biglycan (BGN) and decorin (DCN) (2, 3). Unlike bone, dental cementum is non-innervated, avascular, and grows by apposition with no apparent physiological role for remodeling or turnover. While it is recognized that dental cementum regeneration is possible, current clinical strategies to regenerate the periodontal tissues often lack a biologic basis for treatment and have unpredictable outcomes with limited regeneration, especially for dental cementum (4). Studies using transgenic animals have identified novel regulators of cementogenesis (5, 6, 7) and comparative proteomic analysis of human dental cementum versus alveolar bone identified differentially expressed proteins associated with potential physiological differences between these two tissues (8). Although important progress has been made with regards to the understanding of dental cementum development, currently it is clear that a significant barrier to improved periodontal regenerative therapies is that cementum remains poorly understood.
Cementocytes, apparently terminally differentiated cells, are part of a select group of specialized cells, also including osteocytes. Although osteocytes comprise more than 95% of skeletal cells, they were just recently unrevealed as key regulators of bone homeostasis and remodeling, acting as mechanosensors, and direct endocrine regulators of mineral metabolism (9, 10). The question may be posed whether the cementocyte is a functional actor in cementum in comparable fashion with the osteocyte in the skeleton, responding to changing tooth functions and endocrine signals, as well as actively directing local cementum metabolism (11). From this, the projects aim was isolate and characterize a human teeth cementocyte line and evaluate the cell viability and proliferation against inorganic phosphate
treatment. Here, previously modification reported protocol (12) to obtain a cementocyte-like cell line from human teeth. Once these human cementocyte (HCY-23) clonal cells were established, they were characterized regarding their gene expression signature and potential to produce mineral nodules in vitro. In addition, as it is well established that dental cementum is highly sensitive to phosphate metabolism (13, 14, 15, 16), the effect of inorganic phosphate was examined on viability and proliferation cellular (Pi) on HCY-23 and osteogenic potential. MATERIALS AND METHODS
Biological samples: 13 completely erupted teeth (third molars or 1st upper premolars) of eleven subjects (three males and eight females, aged 14 to 30 years), with no clinical signs of caries and/or periodontal disease, were collected. Teeth extractions were performed at the School of Dentistry - University of Campinas following a local IRB approved protocol (196 / 96). Systemically healthy subjects (non-smokers, with no history of systemic medication in the last 6 months and/or pregnancy) provided written informed consent to participate in this study performed between 2014 - 2015. Following tooth extraction, soft connective tissues adhering to the tooth surfaces were carefully scraped off using a sterile curette, and discarded. Teeth were then rinsed in sterile phosphate buffered saline (PBS - Gibco BRL, Life Technologies, USA) several times, placed in biopsy media composed of minimum essential Eagle medium - alpha modification (α-MEM, Gibco, Life Technologies, USA) supplemented with 10 % fetal bovine serum, 250 mg / ml gentamicin sulfate, 5 m / ml amphotericin B (Gibco BRL, Life Technologies, Brazil), and transferred to the laboratory facilities for cementocyte isolation.
Cell Isolation: The protocol used was described by Stern et al (2012) (12) with some changes as described below. After extraction, the teeth were taken at Falcon 15 ml centrifuge tube (BD, Labware, USA) containing Alpha-MEM (Dulbecco's Modified Eagle Medium) biopsy medium, 10 % FBS, 250 μg / ml gentamicin sulfate, 5 μg / ml amphotericin B (Gibco BRL, Life Technologies, USA). The teeth were washed five times in biopsy medium, and on a sterile petri dish (35 x 100mm), the periodontal ligament was gently removed from the root extension with Grayce 5-6 curettes and discarded. Next, the apical third of the root was removed with the aid of a high-rotation pen and a polishing bit and placed in a collagenase solution for 25 minutes / 3 times, totaling 75 minutes, vortexing each 5 minutes. This procedure was performed to eliminate any residues of periodontal ligament and dental pulp that could result in "contamination" cementocyte cultures. After the third collagenase
19
digestion, the dental fragment was alternately placed in collagenase solution for 25 minutes with shaking every 5 minutes and a 5 mM EDTA solution at the same time totaling nine digestions. In the end, the supernatant was collected and plated in a biopsy medium, as well as the dental fragment that remained. Not all the digestions were obtained cells, so when cells began to proliferate and reached confluency, they were trypsinized with the 0.25 % Trypsin and 2.21 mM EDTA solution (Gibco BRL, Life Technologies, USA), and then resuspended in 1 ml of standard culture medium (Alpha-MEM, 10 % FBS, 100 μg / ml streptomycin and 100 U / ml penicillin) (Table1). Each population of different digestions and tooth that reached confluence for future experiments was called heterogeneous population.
Cell Culture and subcloning: Out of the total 24 “heterogeneous” cell populations obtained, only six DMP1+ populations were subcloned. For each selected cell population, five hundred cells, at passage 3, were seeded into 100 mm culture plates and incubated at 37 °C, 5 % CO2, in standard media. Individual clones were allowed to develop for 14 to 21 days until they reached approximately 50 cells per colony, and then the ring-cloning technique was carried out by placing 8 mm-diameter cylinder polystyrene rings (Millipore Corp, Danvers, USA)
around the colonies. The cells were detached with trypsin/EDTA (Gibco BRL, Life Technologies, USA), transferred to 24-well plates, and recultured as above. Next, all the obtained 115 clones. The order for genes preference were: DMP1, SOST, DSPP, E11 and OPG. A total clones were tested for gene expression in this sequence. Of these, 16 clones were positive to DMP1; 11 clones positive to SOST and DMP1; 5 clones positve to DMP1, SOST, E11 and negative for DSPP and only one clone positive to DMP1, SOST, E11, OPG and negative for DSPP (HCY-23, for human cementocyte clone 23). Only cells between the third and sixth passages were used for the experiments, which were always performed in triplicate.
Gene expression procedures: Total RNA was obtained using the RNeasy system (Qiagen, USA) following the manufacturer's recommendations, and complimentary DNA (cDNA) synthesized from 1μg of total RNA (Transcriptor First Strand cDNA Synthesis Kit, Roche Diagnostic Co., USA), following the recommended protocol. Primers sequences were obtained with the aid of the LightCycler® Probe Design Software 2.0 (Roche Diagnostics GmbH, Germany) and are listed in Table 2. Real-time PCR reactions were optimized for each primer by melting temperature determination and water was used as a negative control for the reactions. Real Time PCR reactions were performed using the SYBR Green System (Roche
Diagnostics GmbH, Germany) on the LightCycler 480 instrument (Roche Diagnostics GmbH, Germany).
Mineralization assay, in vitro: The Von Kossa assay was used to access mineralization capacity of the selected clone. Cells were seeded (5 x 104 cells / well) in 24-well plates and incubated for 24 hours in standard media. Next, standard media was changed to mineralization induction media (α-MEM added with 10 % FBS and induction supplements containing 50 mg / mL ascorbic acid, 10mM β-glycerophosphate, and 10-5M dexamethasone), and the cultures were incubated for 28 days. Media was changed each three days, and mineral nodules formation assessed after 21 and 28 days. Cells were washed with PBS and fixed in 100 % ethanol for 30 minutes. Then, every 5 minutes an ethanol solution was exchanged at concentrations of 100 %, 90 %, 80 %, 70 % and 50 %. The ethanol was aspirated and the cells washed with distilled water. Silver nitrate 5 % solution was added to each well and incubated at 37 °C, 5 % CO2 for 1 hour protected from light. Cells were then washed four times with distilled water, and after 24 hours under the light of a negatoscope the mineral nodules were photographed.
Inorganic phosphate (Pi) treatment: To determine the response pattern of HCY-23 to Pi treatment, a dose-response experiment was used (1, 3 and 5 mM). Cells were seeded at 1.5 x 104 cells / well in 12-well cell culture plates and incubated for 24 hours (day 0) in culture media, containing α-MEM, 2 % FBS, 100 μg/ml streptomycin and 100 U / ml penicillin, at 37 °C and 5 % CO2. After 24 hours, HCY-23 cells were treated or not with Pi at 1, 3 and 5 mM and cell proliferation was determined at 4, 7 and 14 days. Proliferation and viability cellular were obtained using a hemocytometer and tripan blue staining, respectively.
Statistical analysis: Statistical analyses were performed to determine the effect of Pi treatment on cell proliferation and viability using ANOVA test followed by the Tukey post hoc test (intragroup) or Bonferroni post hoc test (intergroup) (GraphPad Prism 6.0, GraphPad, La Jolla, CA, USA) with significance level set at 5 %. Experiments were performed at least twice with comparable results and quantitative data is presented as mean±standard deviation (SD) of one representative experiment performed in triplicate, unless otherwise stated.
21
Demographical findings: A total of 24 heterogeneous cell populations were obtained from 13 teeth. About six of these populations was DMP1+, and were subsequently cloned using the
ring-cloning technique. A total of 115 clones were obtained and characterized accordingly to the expression of known cementocytes markers, e.g. DMP1, SOST and E11. It was discovered only one clone, HCY-23, presented the expected gene expression signature (DMP1+, SOST+, E11+ and DSPP-), and was then used for further characterizations (figure 1). In culture, the HCY-23 cell line, exhibited the characteristic dendritic cementocyte morphology (figure 2) such as osteocyte morphology due to cellular prolongations.
HCY-23 cells have the potential to produce mineral nodules in vitro: An in vitro mineralization assay was performed to determine whether the human cementocyte-like cell line, HCY-23, had the ability to promote mineral nodule formation. Mineralizing conditions were created and HCY-23 cells presented the ability to form mineral nodule in vitro as early as 21 days after the induction was started. It was also found that mineral nodule formation was visually increased by 28 days (figure 3).
HCY-23 are Pi responsive cells: As dental cementum and cementoblasts have been shown to be higly sensitive to phosphate metabolism, the answer to know was whether the cementocyte-like cell line HCY-23 was affected by Pi treatment. First, using a dose-response experiment, it was discovered that, 3 and 5 mM, Pi was higly toxic to HCY-23, whereas at 1 mM Pi did not affect cell viability up to 14 days as compared to the control group (p > 0.05) (figure 4A). Moreover, a time-course assay used to determine the impact of Pi on cell proliferation suggest that at 1 mM, Pi did not affect cell proliferation at days 4 and 7, but decreased it at day 14 (p < 0.05), whereas at 5 mM Pi significantly decreased cell proliferation (p < 0.05) (figure 4B). Intriguingly, preliminary observations revealed that Pi alone resulted in dose dependent mineral deposition by HCY-23 cells (data not shown).
DISCUSSION
The present study provides an original and unpublished proposal in the literature for working with human cementocytes. It is necessary to emphasize the importance for determinimg role in periodontal homeostasis and provide new insights on target molecules that may allow the development of efficient and more predictable therapies for the periodontal tissues regeneration.
Dental cementum is similar to bone but remains little understood in many respects, including the potential function of cementocytes that reside in cellular cementum (2). Cementocytes reside on lacunae and reveal dendrites within a canalicular network, adapted as cells embedded within a mineralized matrix and through their projections can establish an intercommunication with other cells, such as, cementoblasts and cells of the PDL space (11). Scanning Electron Microscopy (SEM) and histology confirmed that cementocytes reside in lacunae and develop a canalicular network. However, they have a fewer dendritic connections and irregular lacunar shape spacing compared with osteocytes (11). The culture line, HCY-23, exhibited large nucleus and dendritic morphology characteristic due the cellular projections. Previous studies present analysis section ground clearly cementocyte morphology. In fact, the cellular body is also visible at the lower cell end and a large nucleus appears clearly in the serial images and it might be a sign of an intensive secretory action caused by the physiological eruption movement of the teeth (17). Moreover, in hypophosphatemic DMP1 null mice, cellular cementum was hypomineralized and reduced, cementocyte morphology altered, and the lacuno-canalicular system anormal (18).
Overall, cementocytes in vivo and in vitro express important key markers in osteocyte differentiation, including DMP1, E11 and SOST (19). As a result of the gene expression analisis, HCY-23 cell was obtained that presented the expected gene expression profile, that is, DMP1 +, E11 +, SOST +, OPG + and DSPP-. Others studies showed that gene expression in cementocytes mouse in vivo and in vitro present DMP1, E11, SOST and OPG (20, 21, 22, 23, 24). DMP1 play an important role on dentin formation as they are expressed during dentinogenesis (25) and DMP1 deficient mice exhibit reduced and hypomineralized dentin (26, 27). The DSPP gene, proteins dentin sialoprotein (DSP) and dentin phosphoprotein (DPP), initially in odontoblasts and dentin matrix, thereby localized to cellular cementum and alveolar bone (25, 28). qPCR showed DSPP expression in pulp of teeth, with little expression in cementum and bone. In cell culture, DSPP mRNA was not detectable/very low in cementocytes and osteocytes rat cells (11). SOST expression by cementocytes suggests that these cells may regulate cementoblast cell activity on the cementum surface (11). E11 protein was identified in cementocytes rat (29), as well as odontoblasts (30). Cementoblasts express OPG and RANKL (31), it has not know whether cementocytes express RANKL or OPG, and if the cells play a parallel role compared to osteocytes in controlling osteoclast activation around the tooth root (11).
23
Effects inorganic phosphate assay on cementocytes were further shown to be proliferation-independent and uptake-dependent. These data suggest regulation by phosphate of mineralization in cementocytes in vitro (32). Some studies have suggested that cementoblasts are positional osteoblasts noninnervated, avascular, and non undergoes to remodeling or physiological turnover (33). However, cementum is probably the least understood mineralized tissue (33), and little is known about the signaling pathways involved in cementum diseases mediated by cementocytes. During formation, phosphate may be important regulators of cementoblast functions including maturation and regulation of matrix mineralization (32). Previous study show cementocytes deposition of hydroxyapatite mineral in vitro is one marker for mineralizing cells comparing with osteocytes cell. Inorganic phosphate dose and the days choice for the reading were based on the literature (32) that present products cell regulatory properties of Pi, as reported with other cell model (cementoblast). This study presented diverse genes associated to cementoblast mineralization/differentiation were regulated by inorganic phosphate. Based on studies 5 mM Pi dose was chosen for these experiments because previous study reveals that this dose delivered a robust response for the genes of interest but did not seem be associated with the potentially stressful conditions of higher Pi doses.
CONCLUSION
HCY-23 cells present dendritic morphology, train mineral nodules when induced to osteogenic medium and present differences in proliferation and viability cellular with inorganic phosphate.
ACKNOWLEDGMENT
Foundation for Research Support in the State of São Paulo (FAPESP), for the scholarship (2015 / 07232-0) and grant aid granted (2015 / 06372-2).
REFERENCES
1) Bosshard DD , Selvig KA. Dental cementum: the dynamics tissue covering of the root. Periodontology 2000. 1997.v.13, p. 41--‐75.
2) Foster BL, Somerman MJ, McCauley LK, Somerman MJ (Eds.), Mineralized Tissues in Oral and Craniofacial Science: Biological Principles and Clinical Correlates, first ed.Wiley-Blackwell, Ames, IA 2012, pp. 169–192
3) Bosshardt D. Are cementoblasts a subpopulation of osteoblasts or a unique phenotype? J. Dent. Res. 2005. 84.390–406.
4) Bosshardt DD, Sculean A. Does periodontal tissue regeneration really work? Periodontol. 2009. 51.208–219 2000.
5) BL Foster, KJ Nagatomo, Bamashmous SO, Tompkins KA, FongH, DunnD.The progressive ankylosis protein regulates cementum apposition and extracellular matrix composition, Cells Tissues Organs. 2011. 194. 382–405.
6) Foster BL, M Ao, C Willoughby, Y Soenjaya, E Holm, L Lukashova.Mineralization defects in cementum and craniofacial bone from loss of bone sialoprotein, Bone . 2015. 78150–164.
7) Zweifler LE, Patel MK, Nociti Jr FH, Wimer HF, Millan JL, Somerman MJ. Counter-regulatory phosphatases TNAP and NPP1 temporally regulate tooth root cementogenesis. Int. J. Oral. Sci. 2015. 7 .27–41.
8) Salmon CR, Tomazela DM, Ruiz KGS, Foster BL, Leme AFP, Sallum EA, Somerman MJ, Nociti-Junior FH. Proteomic analysis of human dental cementum and alveolar bone. Journal of Proteomics. 2013. 91. 544 – 555.
9) Bonewald LF. The amazing osteocyte. J Bone Miner Res. 2011.26(2): 229–38.
10) Dallas SL. Prideaux M, Bonewald LF. The osteocyte: an endocrine cell . . . and more. Endocr Rev. 2013;34(5):658–90.
12) Stern AR, Stern MM, Van Dyke ME, Jahn K, Prideaux M, Bonewald LF. Isolation and culture of primary osteocytes from the long bones of skeletally mature and aged mice. Biotechniques. 2012.52:361-73.
25
13) Nociti Jr F.H.,Foster B.L, Kingsley D.M, Berry J.E, Somerman M.J, Miyauchi M, Takata T, Gurley K.A. Cementum: A phosphate-sensitive tissue. J Dent Res, 2002.v. 81, n.12, p. 817-821.
14) Zweifler LE, Patel MK, Nocit FH, Wimer HF, Millán JL, Somerman M.J, Foster B.L. Counter-regulatory phosphatases TNAP and NPP1 temporally regulate tooth root cementogenesis. International Journal of Oral Science. 2014.v. 23, p. 27-41,
15) Foster BL, NagamotoK Tso. H, Tran AB, Nociti JR. FH, Narisawa S, Yadav M, Mckee M, Millan, J.L. Somerman M.J. Tooth root dentin mineralization defects in a mouse model of hypophosphatasia. Journal of Bone and Mineral Research, v. 28, p. 271-282, 2013. 16) Foster BL, Nagatomo KJ, Nociti JR. FH, Millan JL, Somerman MJ. Central role of pyrophosphate in acellular cementum formation.. Plos One, 2012.v. 7, p. e38393.
17) Scivetti M, Pilolli GP, Corsalini M, Lucchese A, Favia G. Confocal laser scanning microscopy of human cementocytes: Analysis of three-dimensional image reconstruction. Ann Anat 189. 2007. 169—174
18) Ye L, Zhang S, Ke H, Bonewald LF, Feng JQ. Periodontal breakdown in the DMP1 null mouse model of hypophosphatemic rickets. J Dent Res. 2008. 87(7):624–629.
19) Zhao N, Foster BL, Bonewald LF. The Cementocyte An Osteocyte Relative? Journal of Dental Research. 2016. Vol. 95(7) 734–741
20) Foster BL, Somerman MJ. Mcauley LK, Ames, Wiley-Blackwell. Somerman MJ, editors. Cementum. In: Mineralized tissues in oral and craniofacial science: biological principles and clinical correlates. 2012. p. 169–192.
21) Zhao N, Nociti FH Jr, Duan P, Prideaux M, Zhao H, Foster BL, Somerman MJ, Bonewald LF. Isolation and functional analysis of an immortalized murine cementocyte cell line, IDG-CM6. J Bone Mineral Res. 2016. 31(2):430–442.
22) Tenorio D, Cruchley A, Hughes FJ. Immunocytochemical investigation of the rat cementoblast phenotype. J Periodontal Res. 1993. 28(6 Pt 1):411–419.
23) Jäger A, Götz W, Lossdörfer S, Rath-Deschner B. Localization of Sost/ sclerostin in cementocytes in vivo and in mineralizing periodontal ligament cells in vitro. J Periodontal Res. 2010. 45(2):246–254.
24) Walker CG, Dangaria S, Ito Y, Luan X, Diekwisch TG. Osteopontin is required for unloading-induced osteoclast recruitment and modulation of RANKL expression during tooth drift-associated bone remodeling, but not for super-eruption. Bone. 2010.47(6):1020–9. 25) Baba O, Qin C, Brunn JC, Wygant JN, McIntyre BW, Butler WT (2004) Colocalization of dentin matrix protein 1 dentin sialoprotein at late stages of rat molar development. Matrix Biol 23:371–379
26) Ye L, MacDougall M, Zhang S, Xie Y, Zhang J, Li Z, Lu Y, Mishina Y, Feng JQ . Deletion of dentin matrix protein-1 leads to a partial failure of maturation of predentin into dentin, hypomineralization, and expanded cavities of pulp and root canal during postnatal tooth development. J Biol Chem. 2004. 279:19141–19148
27) Ye L, Mishina Y, Chen D, Huang H, Dallas SL, Dallas MR, Sivakumar P, Kunieda T, Tsutsui TW, Boskey A, Bonewald LF, Feng JQ.Dmp1-deficient mice display severe defects in cartilage formation responsible for a chondrodysplasia-like phenotype. J Biol Chem. 2005. 280: 6197–6203
28) Butler WT, Bhown M, Dimuzio MT, Linde A. Nonocollagenous proteins of dentin. Isolation and partial characterization of rat dentin proteins and proteoglycans using a three-step preparative method. Coll Relat Res. 1981;1(2):187–99.
29) Tenorio D, Cruchley A, Hughes F. Immunocytochemical investigation of the rat cementoblast phenotype. J Periodontal Res. 1993;28(6 Pt 1):411 –9.
30) Schwab W, Schulze E, Witt M, Funk RHW, Kasper M. Immunohistochemical localization of the differentiation marker E11 in dental development of rats. Acta Histochem. 1999;101(4):431 –6.
31) Murshed M, Harmey D, Millan JL, McKee MD, Karsenty G,Unique coexpression in osteoblasts of broadly expressed genes accounts for the spatial restriction of ECM mineralization to bone. Genes Dev. 2005. 19:1093–1104
32) Foster BL,Nociti Jr FH,Swanson EC,Matsa-Dunn D, Berry JE,Cupp CJ, Zhang P, Somerman MJ. Regulation of Cementoblast Gene Expression by Inorganic Phosphate In Vitro. Calcif Tissue Int. 2006. 78:103–112.
27
33) Foster BL. Methods for studying tooth root cementum by light microscopy. Int J Oral Sci. 2012.4:119–28.
TABLES
Table 1: Procedures for isolating a human-derived cementocyte-like cell line
Step 1 Teeth extracted (n=13), quickly rinsed in saline and kept in biopsy media (α-MEM added with 10% fetal bovine serum, 250mg/ml gentamicin sulfate, 5m/ml amphotericin B) at room temperature.
Step 2 Once at the lab, soft connective tissues adhering to the tooth surfaces were scraped off using a sterile curette, and the apical portions of teeth were dissected and used for cementocyte isolation from the cellular dental cementum.
Step 3 Additional removal of PDL and pulp tissues from tooth root fragments was achieved by enzymatic digestion (300 U/mL type I collagenase for 30 minutes at 37°C), and supernatant was discarded.
Step 4
Tooth root fragments were subjected to (3x) serial digestions (collagenase A, 300 U/mL and EDTA, 5 mM/ 0.1% BSA, for 25 minutes each at 37°C), and the supernatant was discarded. Step 5
Tooth fragments were subjected to (9x) serial digestion cycles of collagenase A (300 U/mL) and EDTA (5mM, pH=7.4) for 25 minutes each, under agitation, at 37°C, in order to allow cementocyte release from the cementum matrix, and supernatants plated in biopsy media. Additionally, tooth fragments were rinsed with PBS at 37°C (3x) and cultured in biopsy culture media.
Step 6
Cell outgrowth monitored and DMP-1+ heterogeneous populations were subcloned. A single clone, HCY-23, exhibiting a cementocyte-like gene expressioin signature was used for the subsequent studies.
29
Table 2: Primers sequences.
GAPDH Forward 5' - AGCCACATCGCTCAGACAC -3' Reverse 5' - GCTGTACTCGGACACGTCTTT -3' SOST Forward 5' - AGCTGGAGAACAACAAGACCA -3' Reverse 5' - GCTGTACTCGGACACGTCTTT -3' E11 Forward 5'- AAATGTCGGGAAGGTACTCG -3' Reverse 5'- AGGGCACAGAGTCAGAAACG -3' DSPP Forward 5'- GCAACATGCTGATGGGAAGA -3' Reverse 5'-TTTACCTTCGTTGCCTTTCC -3’ OPG Forward 5'- GAAGGGCGCTACCTTGAGAT -3' Reverse 5'- GCAAACTGTATTTCGCTCTGG -3' DMP1 Forward 5'- TTCTTTGTGAACTACGGAGGGTA -3' Reverse 5'- CAGGATAATCCCCAAAGGGAAC -3'
Abbreviations: GAPDH: glyceraldehyde-3-phosphate dehydrogenase; SOST: sclerostin; E11: podoplanin; DSPP: dentin sialophosphoprotein; OPG: osteoprotegerin; DMP-1: dentin matrix protein 1.
FIGURES
Figure 1: The flow chart chacacterization the HCY-23 population through human teeth.
.
31
Figure 2: Photomicroscopy of HCY-23 cell line exhibited the characteristic dendritic cementocyte morphology.trough prolongations cellular. Inverted microscopy image of HCY-23 in magnifications of 20 x. The arrows indicate the prolongations cellular.
Figure 3: Image represents the Von Kossa's test on days 21 and 28 that compares control group with the group induced by osteogenic medium. Mineral nodules formation can observed after 21 and 28 days of mineralization induction.
Control
Osteogenic Medium
0% 20% 40% 60% 80% 100% 120%
control 1mM 3mM 5mM control 1mM 3mM 5mM control 1mM 3mM 5mM
day 4 Day 7 Day 14
To tal c e lls non-viable cells viable cells * * *
Figure 4A: Graphic showing the effect of Pi viability in 4, 7 and 14 days with inorganic phosphate concentration at 1, 3, 5 mM. (*) statistically significant results (p < 0.05, ANOVA test / Tukey post hoc)
33 0 5 10 15 20 25 30 35
0 day 4 day 7 day 14 day
Cel ls n u m b er control 1mM 3mM 5mM * Figure 4B:
Graphic showing the effect of Pi proliferation in 4, 7 and 14 days with inorganic phosphate concentration at 1, 3, 5 mM. (*) statistically significant results (p < 0.05, ANOVA test / Bonferroni post hoc)
3 CONCLUSÃO
Com os resultados pdoemos concluir que as células HCY-23 apresentam características morfológicas semelhantes às células dendríticas, possuem capacidade de produzir nódulos de minerais e apresentam diferenças quanto à proliferação e viabilidade celular quando induzidas com fosfato inorgânico.
35
REFERÊNCIAS
1) Schupbach P, Gaberthuel T, Lutz F, Guggenheim B. Periodontal repair or
regeneration: structures of different types of new attachment. J Periodontal Res. 1993; 28(4): 281-93.
2) Goncalves PF, Lima LL, Sallum EA, Casati MZ, Nociti Junior FH .Root cementum may modulate gene expression during periodontal regeneration: a preliminar study in humans. Journal of Periodontology. 2008.v. 79, p. 323-331.
3) Lima LL, Goncalves PF, Sallum EA, Casati MZ, Nociti Junior FH .Guided tissue regeneration may modulate gene expression in periodontal intrabony defects: a human study. Journal of Periodontal Research. 2008.v. 43, p. 459-464.
4) Arzate H, Zeichner David M, Mercado Celis G. Cementum proteins: role in
cementogenesis, biomineralization, periodontium formation and regeneration Periodontology 2000, v. 67, p. 211–233, 2015.
5) Armitage GC. Cementum. In: Bhaskar SN, ed. Orbans Oral Histology and Embryology. 1980. London: Mosby,.p.180–203.
6) Froum SJ, Gomez C, Brealt MR. Current concepts of periodontal regeneration. A review of the literature. N Y State Dent. 2002.v.68, p. 14–22.
7) Grzesik WJ, Narayanan AS. Cementum and periodontal wound healing and regeneration. Crit Rev Oral Biol Med. 2002.v 13, p.474–484.
8) King GN. New regenerative technologies: rationale and potential for periodontal regeneration: 1. New advances in established regenerative strategies. Dent Update. 2001.v. 28, p.7–12.
9) King GN. New regenerative technologies: rationale and potential for periodontal regeneration: 2. Growth factors. Dent Update. 2001.v.28, p.60–65.
10) King GN, Cochran DL. Factors that modulate the effects of boné morphogenetic protein induced periodontal cementum proteins regeneration: a critical review. J Periodontol. 2002.v.73, p.925–936.
11) Lamster IB. Current concepts and future trends for periodontal disease and periodontal therapy, Part 2: classification, diagnosis, and nonsurgical and surgical therapy. Dent Today. 2001.v.20, p.86–91.
12) Nakashima M, Reddi AH. The application of bone morphogenetic proteins to dental tissue engineering. Nat Biotechnol. 2003.v. 21, p.1025–1032.
13) Toze TF, Demirapl B. Platelet rich plasma: a promis € ing innovation in dentistry. J Can Dent Assoc. 2003. v.69, p.664.
14) Wikesjo UM, Sorensen RG, Kinoshita A, Jian LI X, Wosney € J.M. Periodontal repair in dogs: effect of recombinant human bone morphogenetic protein (rhBMP on regeneration of alveolar bone and periodontal attachment. J Clin Periodontol. 2004. v.31, p.662–670.
37
15) Zeichner David M. Regeneration of periodontal tissues: cementogenesis revisited. Periodontol 2000. 2006.v.41, p.196– 217.
16) Cho MI, Lin WL, Genco RJ. Platelet derived growth fator modulated guided tissue regenerative therapy. J Periodontol. 1995.v.66, p.522–530.
17) Giannonile WV, Finkelman RD, Lynch SE. Comparison of canine and non human primate animal models for periodontal regenerative therapy: results following a single administration of PDGF/IGF I. J Periodontol. 1994.v.65, p.1158–1168.
18) Howell TH, Fiorellini JP, Paquette DW, Offenbacher S, Giannobile WV, Lynch SE. A phase I/II clinical trial to evaluate a combination of recombinant human platelet derived growth fator BB and recombinant human insulin like growth factor-I in patients with periodontal disease. J Periodontol. 1997.v.68, p.1186–1193.
19) Lynch SE, DE Castilla GR, Williams RC, Kiristy CP, Howell TH, Reddy MS,
Antoniades HN. The effects of short term application of a combination of platelet derived and insulin like growth factors on periodontal wound healing. J Periodontol. 1991.v.62, p.458– 467.
20) Park JB, Matsuura M, Han KY, Norderyd O, Lin WL, Genco RJ, Cho MI. Periodontal regeneration in class III furcation defects of beagle dogs using guided tissue regenerative therapy with platelet derived growth factor. J Periodontol. 1995.v.66, p.462– 477.
21) Rutherford RB, Ryan ME, Kennedy JE, Tucker MM, Charette MF. Platelet derived growth factor and dexamethasone combined with a collagen matrix induce regeneration of the periodontium in monkeys. J Clin Periodontol. 1993.v.20, p.537– 544.
22) Wang HL, Pappert TD, Castelli WA, Chiego DJ.Jr, Shyr Y, Smith BA. The effect of platelet derived growth factor on the cellular response of the periodontium: an
autoradiographic study on dogs. J Periodontol. 1994.v.65, p.429–436.
23) Matsuda N, Lin WL, Kumar NM, Cho MI, Genco RJ. Mitogenic, chemotactic, and synthetic responses of rat periodontal ligament fibroblastic cells to polypeptide growth factors in vitro. J Periodontol. 1992.v. 63, p. 515–525.
24) Selvig KA, Wikesjo UM, Bogle GC, Finkelman RD. € Impaired early boné formation in periodontal fenestration defects in dogs following application of insulin like growth factor (II). Basic fibroblast growth factor and transforming growth factor beta 1. J Clin Periodontol. 1994.v.21, p.380–385.
25) King GN, King N, Hughes FJ. The effect of root surface demineralization on bone morphogenetic protein 2 induced healing of rat periodontal fenestration defects. J Periodontol, 1998.v.69, p.561 –570.
26) Kuboki Y, Sasaki M, Saito A, Takita H, Kato H. Regeneration of periodontal ligament and cementum by BMP applied tissue engineering. Eur J Oral Sci. 1998.v.106, p.197– 203.
39
27) Oda S, Kinoshita A, Higuchi T, Shizuya T, Ishikawa I. Ectopic boné formation by biphasic calcium phosphate (BCP) combined with recombinant human boné morphogenetic protein 2 (rhBMP 2). J Med Dent Sci. 1997.v.44, p.53–62.
28) Ripamonti U, Reddi AH. Periodontal regeneration: potential role of boné morphogenetic proteins. J Periodontal Res. 1994.v.29, p.225–235.
29) Ripamonti U, Heliotis M, Rueger DC, Sampath TK. Induction of cementogenesis by recombinant human osteogenic protein 1 (hop 1/bmp 7) in the baboon (Papio ursinus). Arch Oral Biol. 1996.v.41, p.121 –126.
30) Ripamonti U. Soluble osteogenic molecular signals and the induction of bone formation. Biomaterials. 2006.v.27, p.807–822.
31) Bosshardt DD E Schroeder HE. Cementogenesis reviewed: a comparison between human premolars and rodente molars. Anat Rec. 1996; 245: 267-292.
32) Bosshardt DD e Selvig KA. Dental cementum: the dynamic tissue covering of the root. Periodontol 2000. 1997; 13: 41-75.
33) Saygin NE, Giannobile WV, Somerman MJ. Molecular and cell biology of cementum. Periodontol 2000. 2000; 24:73–98.
34) Cho MI, Garant PR. Ultrastructural evidence of directed cell migration during initial cementoblast differentiation in root formation. J Periodont Res. 1988; 23: 268-276.
35) Hoffman RL. Formation of periodontal tissues around subcutaneously transplanted hamster molars. J Dent Res. 1960; 39: 781-798.
36) Macneil RL, Somerman MJ. Developmente and regeneration of the periodontium: parallels and contrasts. Periodontol 2000. 1999; 19: 8-20.
37) Diekwisch TGH. Developmental biology of cementum. Int J Dev Biol. 2001; 45: 695-706.
38) Bosshardt DD, Schroeder HE. Initial formation of cellular intrinsic fiber cementum in developing human teeth. Cell Tissue Res. 1992; 267(2):321-335.
39) Nanci A, Bosshardt D. Structure of periodontal tissues in health and disease. Periodontol 2000. 2006; 40: 11-28.
40) Kagayama M, Sasano Y, Mizoguchi I et al. Confocal microscopy of cementocytes and their lacunae and canaliculi in rat molars. Anat Embryol. 1997.v.195, p.491 – 496.
41) Ayasaka N, Kondo T, Goto T et al. Differences in the transport systems between cementocytes and osteocytes in rats using microperoxidase as a tracer. Arch Oral Biol. 1992. v.37, p.363–369,
41
42) Bonewald LF. The Amazing Osteocyte, Journal of Bone and Mineral Research. February 2011.v. 26, No. 2, p.229–238, DOI: 10.1002/jbmr.320 2011 American Society for Bone and Mineral Research.
43) Saygin NE, Giannobile W.V, Somermam M.J. Molecular and cell biology of cementum. Periodontol 2000. 2000.v.24, p.73‐98.
44) Hefti AF. Aspects of cell biology of the normal periodontium. Periodontol 2000. 1993. v.3, p.64‐75,
45) Bartold PM. Turnover in periodontal connective tissues: dynamics homeostasis of cells, collagen and ground substances. Oral Dis. 1995.v.1, p.238‐53.
46) Beertsen W, VandenBos T, Everts V. Root development in mice lacking functional tissue non-specific alkaline phosphatase gene: inhibition of acellular cementum formation. J Dent Res. 1999.78(6):1221-9.
47) D'Errico JA, Berry JE, Ouyang H, Strayhorn CL, Windle JJ, Somerman MJ.
Employing a transgenic animal model to obtain cementoblasts in vitro. J Periodontol. 2000. 71(1):63-72.
48) Harmey D, Hessle L, Narisawa S, Johnson KA, Terkeltaub R, Millan JL. Concerted regulation of inorganic pyrophosphate and osteopontin by akp2, enpp1, and ank: an
integrated model of the pathogenesis of mineralization disorders. Am J Pathol. 2004.164(4):1199-
49) Nociti FH, Jr., Berry JE, Foster BL, Gurley KA, Kingsley DM, Takata T, et al. Cementum: a phosphate-sensitive tissue. J Dent Res. 2002. 81(12):817-21.
50) Takano Y, Sakai H, Watanabe E, Ideguchi-Ohma N, Jayawardena CK, Arai K, et al. Possible role of dentin matrix in region-specific deposition of cellular and acellular
43
ANEXOS
