Genetic dissection of antigen presentation pathways

(1)

159 A synopsis of the different screening stages is represented in figure 52.

Figure 52 - Schematic representation of the followed screening stages.

Hence, we decided to conduct qPCR measurements of mRNA transcripts (fig.

53) and/or to evaluate gene expression at the protein level by WB (fig. 54, 55,

56, 57 and 58) according to antibody availability, for correlation of observed

phenotype with gene knockdown level for the twelve mentioned genes. The

obtained results are summarized in table 12.

(2)

(3)

161 

Figure 53 - mRNA expression as determined by qPCR following infection of BMDCs with lentiviruses expressing shRNAs targeting the indicated genes. Constructs producing best phenotype are boxed. ND - not detectable. * - shRNA targeting 3’ UTR. Data are from one of at least 2 independent experiments.

Figure 54 - Protein expression measured by Western Blot for Degs1.

(4)

Figure 56 - Protein expression measured by Western Blot for Rab2.

Figure 57 - Protein expression measured by Western Blot for Bet1.

Figure 58 - Protein expression measured by Western Blot for Vamp4.

Table 12 – Summary for gene knockdown level correlation with phenotype for hit genes (in brackets is indicated shRNA number that provided observed phenotype).

Gene symbol Knockdown correlation Bet1 (3, 4, 5) Correlates Degs1 (2, 3, 5) No Correlation

Dnm1 (2, 4) No Correlation Rab17 (2, 5) No Correlation

Rab19 (1-5) Correlates Rab2 (3, 4) Possible Correlation

(5)

163 

Rab40b (1, 2, 4) Possible Correlation Sec24d (1, 3, 4, 5) No Correlation

Stx18 (3, 5) Possible Correlation Vamp4 (1-5) Correlates

Vti1a (3, 4) Correlates β2m (2, 5) Possible Correlation

Taken together, four genes showed a good correlation between knockdown

level and phenotype: Vamp4, Rab19, Vti1a and Bet1; four others (Rab40b,

Rab2,

β2m, Stx18) showed potential correlations, i.e., some of the constructs

that produced a phenotype did not produced the lowest mRNA levels, which

may be explained by differential lentiviral knockdown efficiencies along

different experiments, or additional effects at the translational level. Further

validation using immunobloting will be required to clarify if these genes are true

hits. Interestingly, constructs targeting the 3’ UTR (indicated with “*” in fig. 53)

are in many cases those that either produce one of the best knockdowns or the

gene mRNA level is the same (or higher) when compared to control. The

observation that some shRNAs used for gene targeting produce higher mRNA

levels when compared to the control has been previously described when using

this strategy (Oberdoerffer et al., 2008). One possible explanation might be due

to a miRNA effect, as there have been reports describing these as transcriptional

up-regulators (Vasudevan et al., 2007), although this is speculative in this

context.

Also, in the case of Vamp4, the Western blot showed that reduced transcript

expression was accomplished by all shRNA hairpins, Vamp4 was just depleted

at the protein level by construct #II, #III and #V.

(6)

At this point, we decided to focus in the gene Vamp4 (vesicle-associated

membrane protein 4), which has been suggested to play a role in the trans-Golgi

network-to-endosome transport (Tran et al., 2007). The rationale for this

decision is based in: 1) the strength of the phenotype and knockdown

correlation; 2) when analyzing known and predicted protein-protein

interactions databases (Jensen et al., 2009), we could observe that we “hited”

another interacting gene, Vti1a, along with the fact that Snap25, Stx1b2, Stx3,

Stx6, Stx1b1 and Stx4 also matched the selection criteria for the secondary

screening, even though the first four possibly also affect class II presentation as

well, and the last two provided inconclusive results. The Vamp4 interacting

network is depicted in figure 59.

Figure 59 - Known and predicted interactions for Vamp4 protein. From http://string.embl.de (Jensen et al., 2009).

As antibodies targeting Snap23 (another of the described interactors of

Vamp4, fig. 59) and Stx6 were available, we also decided to investigate their

knockdown level by western blot (fig. 60 and fig. 61) using our shRNA lentiviral

system, in order to pursue further antigen presentation experiments in the

Vamp4 interacting complex.

(7)

165 

Figure 60 - Protein expression measured by Western Blot for Snap23.

Figure 61 - Protein expression measured by Western Blot for Stx6.

As we can observe from figs. 60 and 61, constructs #1 and #5 targeting

Snap23 produce lower protein levels when compared to control, while none of

the Stx6 shRNA targeting hairpins mediate protein knockdown.

The validated candidates are now good candidates for follow-up mechanistic

studies (using biochemistry and cell biology tools) and to be tested in an in vivo

relevant model of antigen cross-presentation.

(8)

(9)

167 Chapter III

Concluding remarks and future

perspectives

(10)

(11)

169 Chapter III – Concluding remarks and future

perspectives

The work reported here (both for the kinase/phosphatase subset and for the

cellular traffic collection of genes) is, to our knowledge, the first systematic

screen that aims to identify genes with a role in antigen presentation in primary

cells. Particular effort has been made in the recent past to identify genes

involved in antigen cross-presentation, in a more restrictive and direct manner

(Guermonprez et al., 2003; Jancic et al., 2007; Luckashenak et al., 2008).

Recently, (Zou et al., 2009) reported the identification of a new gene (Rab3b/3c)

with a role in cross-presentation in dendritic cells, targeting a much smaller

collection of genes (57) than the ones reported in this work and by using a

murine dendritic cell-line (DC2.4) as APC.

Our results suggest that no kinase or phosphatase affects, in a specific

manner, cross-presentation, even if I have identified many with a phenotype for

both canonical and antigen cross-presentation pathways. Indeed, when

considering the role of kinases (major signal transducers) within the endocytic

machinery (which is in fact the underlying basis of antigen presentation), one

could predict many interaction points between both and specificities.

Interestingly enough, when (Liberali et al., 2008) collected all known direct

phosphorylation reactions of endocytic machinery components assigned to

specific protein kinases from the literature, and annotated those kinases onto the

protein kinome tree, they observed that there is not one specific class of kinases

that phosphorylates endocytic machinery. Rather, kinases are distributed along

the tree, suggesting that the diversity of both has coevolved. In addition, it has to

be taken into account that many studies are actually conducted in cancer cells

and that the kinases involved in a particular process in transformed cells may be

quite different from the ones regulating the same process in primary cells.

(12)

Currently, there is little to no information on the genes that regulate

membrane transport and are critically involved in cross-presentation. Therefore,

the identification of 8 novel genes with a specific or predominantly specific role

in antigen cross-presentation is of particular relevance. It is particularly exciting

the identification of Vamp4, especially because seven of its predicted molecular

interactions also give a phenotype when silenced in our screen.

Overall, our work has identified ~80 novel genes with a role in antigen

presentation and ~8 with a specific role predominantly in antigen

cross-presentation. This achievement represents a potential enormous advance to this

field as it raises an unprecedented number of molecular leads that have the

potential to help the community working in this field to begin to understand the

pathways that are specifically involved and required for antigens to be

cross-presented.

This is however the very beginning! My findings are the starting point for

many possible ways in which this project can evolve. No doubt, the first

important follow-up study will be to use biochemistry and cell biology tools to

understand the fine molecular mechanisms and pathways that are regulated by

the identified genes in the context of antigen cross-presentation.

The second major axis of research to which my work can give rise is the

study of the role of the now identified genes in vivo. Several biologically

significant problems or models can be selected, but they should reflect relevant

questions in the field including the response to tumors, non-infecting APC virus

and against parasites. A good example could be the role of these genes in an in

vivo response against Toxoplasma gondii. Interestingly, it has recently been

shown that the recruitment of ER is abundant and critical to generate CD8

+

_T

cell responses against this parasite in vitro and in vivo (Goldszmid et al., 2009).

There has been a long-standing controversy on the literature about the role of

the ER in antigen cross-presentation. Our screen identifies several genes

(13)

171 (belonging to the vesicular traffic set) that are known to be involved in ER to

other vesicle fusion and that localize to the ER. We are currently exploring this

possibility with our collaborators at the Curie Institute (Dr. Sebastian

Amigorena’s Group).

Our own laboratory is currently working on a technology that will help us to

dissect the role of the identified genes in antigen cross-presentation in vivo:

using a lentiviral system that can be controlled spatially and temporally, we

expect to be able to silence our gene of interest in the relevant cells for antigen

presentation (Dendritic Cells) and switch it on and off with the addition or

removal of a drug (tetracycline). With this tool in our hands, it will be possible

to expand the work to genes for which classical homologous recombination

knockouts are not available and also for those that are required for animal

viability. This is also a powerful approach, because we can study the role of a

gene in a specific cell type at a particular time.

Finally, but importantly, we will use drugs that are known to block genes or

the pathways that we have identified and use them to probe their effect in in

vitro assays for antigen presentation. Should any of this give a strong phenotype

in vitro, we will probe their effect in the in vivo models of tumor response,

currently under construction. Our preliminary results using a restricted number

of kinase inhibitors that have reproduced the phenotypes observed by the

shRNA silencing, strongly suggest that this will be a powerful line of work.

I am confident that this integrated strategy for the follow-up of the work here

presented has the potential to greatly improve our knowledge about antigen

cross-presentation and its relevance in the generation of effective CTL responses

against tumors and viral infections.

(14)

(15)

173 Chapter IV

(16)

(17)

175 Chapter IV – Materials and Methods

Mice

C57BL/6 mice (WT) were obtained from Instituto Gulbenkian de Ciência.

C57BL/6 recombination activating gene 1-deficient OT-1 TCR and C57BL/6

recombination activating gene 2-deficient OT-2 TCR transgenic mice were

obtained from Taconic and The Jackson Laboratory. All mice were used

according to the guidelines and regulations of the Portuguese Veterinary

Department.

Purification of bone marrow derived dendritic cells

Purification of bone marrow derived cells (BMDCs) was adapted from

previously described (Inaba et al., 1992; Inaba et al., 2001). Briefly, marrow

cavities of the tibias and femurs of 8-12 week-old mice were flushed with

complete RPMI 1640 (10% FBS) using a 27-gauge needle (Terumo, Tokyo,

Japan). After red cells hypotonic lysis for 5 min (with ammonium chloride

solution), BM cells were washed and seeded in 96 well round bottom plates

(5x10

4

_{/well), in culture medium supplemented with 30% conditioned medium}

from mouse granulocyte-macrophage colony stimulating factor (GM-CSF)

producing J558L cells.

T-cells purification

Spleens were isolated from OT-I or OT-II mice. Individual cell suspensions were

obtained by disrupting the spleens in RPMI and forcing them through a 70

µm

cell strainer. The cells were spun at 1,200 RPM for 5 minutes and the resulting

cell suspensions were subjected to hypotonic red cell lysis. The cells were

washed and resuspended in PBS (supplemented with 5% FBS), and negatively

isolated using magnetic beads, (CD8 and CD4 isolation kits, Miltenyi Biotec,

Auburn, CA, purification >90%), according to manufacture’s protocol.

(18)

Viral production

Plasmids encoding lentiviruses expressing shRNAs were obtained from the RNAi

Consortium library (TRC), supplied as glycerol stocks

(Moffat et al., 2006).

Plasmids were purified using a 96 well plate format DNA extraction procedure

according

to

the

public

protocol

described

by

the

TRC

(http://www.broad.mit.edu/genome_bio/trc/publicProtocols.html)

and DNA was

quantified by a Pico-Green assay (Molecular Probes), using a Infinite M200

plate reader (Tecan). DNA concentrations were normalized manually across

plates.

Plasmids were then transfected into HEK 293T cells with a three-plasmid system

to produce lentivirus (Dull et al., 1998; Naldini et al., 1996). Transfections were

performed in 96-well plates to generate lentiviruses in a high-throughput

manner as adapted by (Moffat et al., 2006). Briefly, packaging cells were seeded

at a density of 2.2x10

4

_{cells per well in 100µl media (DMEM, 10% FBS, no}

antibiotics) 24 hours before transfection and grown at 37ºC, 5% CO

2

. DNA for

transfections was prepared by mixing 100ng pCMVΔR.89 and 10ng pVSV-G

with 100ng pLKO.1 library plasmids in each well. A mixture of 24.26µl

OptiMEM (Gibco) and 0.6µl TransIT-LT1 (Mirus) were then added to the DNA

and this mixture was incubated for 30 min before addition to the packaging

cells. Cells were incubated for 24 h, and the media was changed to remove

remaining transfection reagent, with addition of fresh media, supplemented with

30% FBS. Cell supernatants containing the viral particles were collect 48 and

72h after transfection and stored at -80ºC.

shRNA lentiviral infections

Mouse BMDCs were plated in 96 well round-bottom plates at 5x10

4

_{cells per}

well with 200µl of GM-CSF supplemented medium. After 48h, the medium was

carefully removed without disturbing the cells at the bottom, and the cells were

infected using 10µl of shRNA lentiviral supernatant (the pellet was ressuspended

3-5 times) plus 8µg/ml of polybrene (hexadimethrine bromide

)

(Sigma) in 40µl of

GM-CSF medium. The cells were spun for 90 min at 2200 rpm, after which cell

(19)

177 supernatant was removed and 200µl/well of fresh media was added. To select

for shRNA integration, 48h after infection, puromycin (Calbiochem) was added

at a final concentration of 5 µg/ml. The cells were challenged 4 days after

infection.

Antigen presentation assays

Materials: OVA (Worthington Biochemical Corporation); S. cerevisiae

expressing OVA (kindly provided by Dr. R. Wheeler, WI); OVA peptide

257-264 (SIINFEKL) (Neaps); OVA peptide 323-339 (Neaps).

For antigen presentation assays, BMDCs were incubated with the indicated

antigen sources and concentrations. Approximately 4h later, cells were

co-cultured with labeled CFSE (carboxyfluorescein diacetate, succinimidyl ester,

which upon processing, is a green fluorescent cell staining dye) (Invitrogen)

OT-I T cells for 3 days. CFSE passively diffuses into cells and is retained throughout

development and meiosis. The dye is inherited by the daughter cells, and after

each cell division, the relative fluorescence intensity of the dye is decreased by

half, which can be visualized in a FACS plot as different fluorescence peaks. For

monitoring T cell proliferation, diminution of CFSE staining on TCR

+

_CD8

+

population was measured by FACS. In alternative, cell cultures were pulsed

with 1 µCi [

3

_{H] thymidine (Perkin Elmer) for approximately 12 hr, and}

incorporation of the radionucleotide was measured using a β-scintillation

counter (TopCount Gamma Counter; Packard, MA, USA). In addition, cell

supernatants were collected for IL-2 and IFN-γ cytokine measurement. Similar

procedure was followed in monitoring OT-II T cell proliferation.

Moreover, antigen presentation assays were also conducted by incubating

BMDCs for 18h with the B3Z cell line, CD8

+

_{T-cell hybridoma specific for}

H-2Kb OVA 257-264 complex. B3Z activation was monitored by IL-2 secretion as

measured by ELISA.

(20)

Antigen processing assays

Materials: DQ

™ ovalbumin (Invitrogen).

For antigen processing assays, BMDCs were incubated with DQ™ ovalbumin

(0.25µg/ml) for 4h, after which fluorescence emission was measured.

DQ™ ovalbumin is a self-quenched conjugate of ovalbumin that exhibits bright

green fluorescence upon proteolytic degradation (fluorescence excitation and

emission maxima of approximately 505 and 515 nm, respectively).

Cell viability assay

Cell number is assessed through Alamar Blue™ (Biosource, Camarillo, CA)

staining. Alamar Blue™ contains a redox indicator that fluoresces during

respiration of assay cells. It can accurately measure cell numbers as low as a

few hundred. Fluorescence is excited at 530-560 nm and emitted at 590 nm. A

series of standard known number of cells are prepared in addition to the

samples and jointly incubated with the Alamar Blue™ dye for 2h (1:20),

followed by fluorescence reading.

Yeast growth

S. cerevisiae expressing OVA strain was maintained in Synthetic Complete (SC)

medium (Q-BIO Gene, USA), supplemented with glucose (for OVA expression

inhibition) and a “drop-out” mix with exception of URA. S. cerevisiae was

grown overnight in SC medium, supplemented with galactose (for OVA

expression) at 30°C. Overnight cultures were diluted 1:50 into fresh

SC+galactose-URA media and grown overnight.

Inactivation of yeast for antigen presentation experiments

For UV inactivation, the equivalent of 2.5×10

7

_{cells from a culture were washed}

and resuspended in 1.5 ml of PBS in a six-well plate. The yeast were exposed to

four treatments of 100,000 µjoules/cm

2

_{in a CL-1000 UV-Crosslinker (UVP,}

(21)

179 Upland, California, United States), with agitation between each dose to treat

cells evenly. After UV-inactivation, cells were washed and renormalized by

OD600.

Quantitative RT-PCR

Total RNA was extracted using Trizol according to the manufacturer ’ s protocol

(Invitrogen), and each sample (1 µg) was reverse transcribed with SuperScript II

(Invitrogen) using Oligo-DTTs (Invitrogen) according to the manufacturer’s

instructions. Oligonucleotide primers were determined using Primer Bank,

available at http://pga.mgh.harvard.edu/primerbank/ (Spandidos et al., 2008;

Wang and Seed, 2003) and obtained from Invitrogen.

The 25µl QPCR reaction (contained 1 µl of cDNA, 12.5 µl of SYBR green master

mix (Applied Biosystems), and 20 pmol of sense and antisense primers) was

performed on an Abi Prism 7000 (Applied Biosystems, Foster City, CA). An

initial activation step for 10 min at 95°C was followed by 40 cycles of (95°C, 15

sec; 60°C, 60 sec).

Quantity values for gene expression were generated by comparison of the

fluorescence generated by each sample (always run in triplicate) with standard

curves of known quantities (the standard series were prepared by performing

10-fold serial dilutions of full-length cDNAs per QPCR reaction), and the

calculated number of copies was divided by the number of copies of the

housekeeping gene GAPDH.

Primers sequences:

Gene Sequences

Acvr2a Fw: GCGTTCGCCGTCTTTCTTATC Rv: GTTGGTTCTGTCTCTTTCCCAAT Bet1 Fw: GGGCTTTGAATTTGTTGCAT Rv: GGGAAACCCTGGAAAAACAT Dmpk Fw: CTGCTCGACCTTCTCCTGG Rv: CACGCCCGATCACCTTCAA Dnaja2 Fw: GTTAGCCAAAGAATACCACCCTG Rv: TCTGTCATACAGCTCTCGCTT Dnajb8 Fw: ACAAGAACCCCGACAACAAAG Rv: CGGTCGTACACAGAACGCTT Dnajc7 Fw: AGTGCGATGTGGTAATGGCG Rv: GCTTCGTTGTAGTCCTTCTTAGC

Dnm1 Fw: AATATGCCGAGTTCCTGCACT Rv: GTCTCAGCCTCGATCTCCAG Doc2b Fw: CGACGGCTACGAGTCAGAC Rv: TTCAGGGTGTTCCGAAGAGTT

Erbb3 Fw: AAGTGACAGGCTATGTACTGGT Rv: GCTGGAGTTGGTATTGTAGTTCA GAPDH Fw: AACTTTGGCATTGTGGAAGG Rv: ACACATTGGGGGTAGGAACA

(22)

Gcs1 Fw: CACGTCTATTTCGGCATGAAGA Rv: TGCCTGAGCTTAGGAGGGG Gucy1b2 Fw: TGATGTCTGAAGTGTTGTGTGC Rv: GCTTGCTCCTAAACTCCGCTC

Mapk7 Fw: GTGGGGGACGAGTACGAGAT Rv: TGGTCACCACATCAAAAGCAT Pdpk1 Fw: GGTCCAGTGGATAAGCGAAA Rv: TTTCTGCACCACTTGTGAGC

Pim2 Fw: TTCAGCGGGCTCAATATACGC Rv: CCAAGTCGGTATTCGGCCTC Rab17 Fw: GGCCCTCCGGTACATGAAG Rv: GGCACCCCTGAAGTAGAGGT Rab19 Fw: GTTCAAGGTCATCCTTATTGGGG Rv: GCACTCCGGTAGTAGCTTTGG

Rab2 Fw: GCGACACAGGTGTTGGTAAAT Rv: CATCAATCGTTATCATCCGAGCA Rab40b Fw: GTGCGGGCCTACGATTTTCTA Rv: GTGGCCGTAAGGAGACTCG Sec24d Fw: GGAGAGGTCTTTGTTCCTTTGTT Rv: GTCTCTGTTCTTGAGCTTCCC

Stx18 Fw: CCCACAAGGAGATACATTCCCA Rv: AACGAAATCCAAAACGGCAGT Vamp4 Fw: CGAAGGCAAATGTGGTGGC Rv: TTTCAAGTGCAGGATGATCTGAG

Vdac3 Fw: TTGACACAGCCAAATCCAAA Rv: GCTGTCCATGCCAGGTTTAT Vti1a Fw: GGATCGCCTACAGTGACGAAG Rv: CAGCCTCTCCGTGTTATCCAG

β2m Fw: TTCTGGTGCTTGTCTCACTGA Rv: CAGTATGTTCGGCTTCCCATTC

Western Blots

Antibodies: Rabbit polyclonal PDK1 (Abcam), mouse monoclonal

Pim2 (Abcam), rabbit polyclonal Vamp4 (Abcam), rabbit monoclonal

β2m (Abcam), mouse monoclonal Degs1 (Abcam), goat polyclonal

anti-Rab2 (Abcam), mouse monoclonal anti-Bet1 (BD Biosciences), mouse

monoclonal anti-Stx6 (Abcam), rabbit polyclonal anti-Snap23 (Abcam), mouse

monoclonal β-actin (Abcam), rabbit α/β tubulin (Cell Signaling);

anti-mouse, anti-rabbit and anti-goat secondary antibodies (Cell Signaling). All

antibodies were used according to manufactures recommendations.

Cells were harvested by centrifugation (1200 rpm, 5 minutes, room

temperature), after which were rinsed once with phosphate buffered saline

(PBS). Cell pellets were then lysed in 20-40µL of lysis buffer (50mM Tris, pH

7.4, 150 mM NaCl, 1% NP40, 0.25% sodium deoxycholate, 1mM EGTA, 1mM

PMSF, protease inhibitors, 1mM Na

3

VO

4

, 1mM NaF), incubated 10min on ice

and centrifuged at 14000 rpm (10 min, 4ºC). The resulting supernatants were

transferred to a fresh 1.5mL tube. Samples were loaded on 10-12% SDS-PAGE

gel and after transferring, the membranes were blocked and incubated with

primary antibodies. Anti-actin immunoblotting served as a loading control for

the Western blots, unless if otherwise stated.

(23)

181 antibodies and detected by enhanced chemiluminescence (GE Healthcare,

Piscataway, NJ).

Cytokine production measurement

Cell supernatants were collected at the referred antigen presentation assay time

points and analyzed for TNF-α, IL-6, IL-12, IL-2 and IFN-γ using DuoSet ELISA

reagents according to the manufacture’s protocol (R&D systems, Minneapolis,

MN).

Flow cytometry

Cells were stained with indicated antibodies for 20 min, on ice. After washing,

the cells were ressuspended in PBS (FBS 5%) and subsequently measured using

a FACSCalibur flow cytometer (BD Biosciences, San Jose, CA) and analyzed

using the FlowJo software (TreeStar, Ashland, OR).

APC-conjugated

anti-CD11c

(Biolegend),

PE-conjugated

anti-CD11c

(eBiosciences), FITC-conjugated CD86 (eBioscience), FITC-conjugated

anti-I-A^b (BD Biosciences), FITC-conjugated anti-H-2K^b (BD Biosciences) and

FITC-conjugated anti-Vβ8 TCR (BD Biosciences) were used at 1 mg/ml.

Statistical analysis

The data were analyzed using the Prism software and compared using the

Mann-Whitney U test, a nonparametric test that does not assume Gaussian

variation.

(24)

(25)

183 Chapter V

(26)

(27)

185 Chapter V – Supplementary Data

Figure S1 – Plate-well scatter plot raw data of BMDCs number for replicate 1.

(28)

Figure S3 – Plate-well scatter plot raw data of T-cell proliferation for replicate 1.

(29)

187

Table S1 – Gene list of enriched kinase/phosphatase screened subset.

Gene Gene Description NM number

4.93E+23 hypothetical protein 4933423E17 NM_177706 1110020G09Rik RIKEN cDNA 1110020G09 gene XM_127934 1190002A17Rik RIKEN cDNA 1190002A17 gene XM_130050 1700011K15Rik RIKEN cDNA 1700011K15 gene NM_029294 1810024B03Rik RIKEN cDNA 1810024B03 gene NM_198630 1810043M15Rik RIKEN cDNA 1810043M15 gene NM_199056 2310009E04Rik RIKEN cDNA 2310009E04 gene XM_131496 2610018G03Rik RIKEN cDNA 2610018G03 gene NM_133729 2610019A05Rik RIKEN cDNA 2610019A05 gene NM_028126 2610311B01Rik RIKEN cDNA 2610311B01 gene XM_355379 2700092H06Rik RIKEN cDNA 2700092H06 gene XM_132529 2810465F10Rik RIKEN cDNA 2810465F10 gene XM_127419 3110003A22Rik RIKEN cDNA 3110003A22 gene NM_026534 4732472I07Rik RIKEN cDNA 4732472I07 gene XM_195168 4921509C19Rik RIKEN cDNA 4921509C19 gene NM_198655 4921528H16Rik RIKEN cDNA 4921528H16 gene XM_133060 4930444A02Rik RIKEN cDNA 4930444A02 gene NM_029037 4930509O22 hypothetical protein 4930509O22 NM_172504 4930513D10Rik RIKEN cDNA 4930513D10 gene XM_142762 4932414J04 hypothetical protein 4932414J04 NM_172792 4932415M13 hypothetical protein 4932415M13 NM_177599 4933425A18Rik RIKEN cDNA 4933425A18 gene XM_127578 4933428I03Rik RIKEN cDNA 4933428I03 gene NM_025760 6330514A18Rik RIKEN cDNA 6330514A18 gene NM_183152 6720485C15Rik RIKEN cDNA 6720485C15 gene NM_026551 A630047E20Rik RIKEN cDNA A630047E20 gene NM_173032 Aatk apoptosis-associated tyrosine kinase NM_007377 Abl1 v-abl Abelson murine leukemia oncogene

1 NM_009594

Abl2 _{oncogene 2 (arg, Abelson-related gene)}v-abl Abelson murine leukemia viral XM_136360 Acacb acetyl-Coenzyme A carboxylase beta NM_133904

Acp1 acid phosphatase 1, soluble NM_021330

Acvr1 activin A receptor, type 1 NM_007394

Acvr1b activin A receptor, type 1B NM_007395 Acvr1c activin A receptor, type IC XM_194020

Acvr2a activin receptor IIA NM_007396

Acvr2b activin receptor IIB NM_007397

Acvrl1 activin A receptor, type II-like 1 NM_009612 Adam22 a disintegrin and metallopeptidase domain ₂₂ XM_131876 Adck1 aarF domain containing kinase 1 NM_028105 Adck2 aarF domain containing kinase 2 NM_178873 Adck4 aarF domain containing kinase 4 NM_133770 Adck5 aarF domain containing kinase 5 NM_172960

Adk adenosine kinase NM_134079

Adpgk ADP-dependent glucokinase NM_028121

Adrbk1 adrenergic receptor kinase, beta 1 NM_130863 Adrbk2 adrenergic receptor kinase, beta 2 NM_177078 AIF1 allograft inflammatory factor 1 NM_001623

(30)

Ak1 adenylate kinase 1 NM_021515

Ak3l1 adenylate kinase 3 alpha-like 1 NM_009647

Akap2 A kinase (PRKA) anchor protein 2 NM_009649 Akt1 thymoma viral proto-oncogene 1 NM_009652 Akt2 thymoma viral proto-oncogene 2 NM_007434 Akt3 thymoma viral proto-oncogene 3 NM_011785

Alk anaplastic lymphoma kinase NM_007439

Alpk1 alpha-kinase 1 XM_131194

Alpk2 alpha-kinase 2 XM_128981

Alpk3 alpha-kinase 3 NM_054085

Als2cr2 amyotrophic lateral sclerosis 2 (juvenile)

chromosome region, candidate 2 (human) NM_172656 Als2cr7 amyotrophic lateral sclerosis 2 (juvenile) _{chromosome region, candidate 7} XM_194683 Amhr2 anti-Mullerian hormone type 2 receptor NM_144547 Anapc2 anaphase promoting complex subunit 2 NM_175300 Ankk1 ankyrin repeat and kinase domain _{containing 1} NM_172922

Apoe apolipoprotein E NM_009696

Araf v-raf murine sarcoma 3611 viral oncogene _homolog NM_009703 Arhgap24 Rho GTPase activating protein 24 NM_146161 Arhgap29 Rho GTPase activating protein 29 NM_172525 Arhgap5 Rho GTPase activating protein 5 NM_009706 Atf6 activating transcription factor 6 XM_129579 Atm ataxia telangiectasia mutated homolog

(human) NM_007499

Atp2a2 ATPase, Ca++ transporting, cardiac _{muscle, slow twitch 2} NM_009722 Atp2a3 ATPase, Ca++ transporting, ubiquitous NM_016745 Atr ataxia telangiectasia and rad3 related XM_147046

Aurka aurora kinase A XM_130737

Aurkb aurora kinase B XM_181344

Aurkc aurora kinase C NM_020572

AW548124 expressed sequence AW548124 XM_128778 AW742319 expressed sequence AW742319 NM_021345

Axin2 axin2 NM_015732

Axl AXL receptor tyrosine kinase NM_009465 B230120H23Rik RIKEN cDNA B230120H23 gene NM_023057 Bace1 beta-site APP cleaving enzyme 1 NM_011792 Bag1 Bcl2-associated athanogene 1 NM_009736

BC021891 cDNA sequence BC021891 NM_145608

BC030499 cDNA sequence BC030499 XM_126274

Bcap31 B-cell receptor-associated protein 31 NM_012060 Bckdk branched chain ketoacid dehydrogenase _kinase NM_009739 Bcr breakpoint cluster region homolog XM_125706

(31)

189

BLNK B-cell linker NM_013314

Bmi1 B lymphoma Mo-MLV insertion region 1 NM_007552

Bmp2k BMP2 inducible kinase NM_080708

Bmpr1a bone morphogenetic protein receptor, type _1A NM_009758 Bmpr1b bone morphogenetic protein receptor, type _1B NM_007560 Bmpr2 bone morphogenic protein receptor, type II _{(serine/threonine kinase)} NM_007561 Bmx BMX non-receptor tyrosine kinase NM_009759

Braf Braf transforming gene XM_355754

Brd2 bromodomain containing 2 NM_010238

Brd7 bromodomain containing 7 NM_012047

Brsk1 BR serine/threonine kinase 1 XM_356021 Btk Bruton agammaglobulinemia tyrosine _kinase NM_013482 Btrc beta-transducin repeat containing protein NM_009771 C330002I19Rik RIKEN cDNA C330002I19 gene XM_126866 C330011J12Rik RIKEN cDNA C330011J12 gene XM_136225 C330018K18Rik RIKEN cDNA C330018K18 gene NM_177352 C330049O21Rik RIKEN cDNA C330049O21 gene NM_177174

Calm2 calmodulin 2 NM_007589

Calm3 calmodulin 3 NM_007590

Calr Calreticulin NM_007591

Camk1 calcium/calmodulin-dependent protein _{kinase I} NM_133926 Camk1d calcium/calmodulin-dependent protein _{kinase ID} NM_177343 Camk1g calcium/calmodulin-dependent protein _{kinase I gamma} NM_144817 Camk2a calcium/calmodulin-dependent protein _{kinase II alpha} NM_009792 Camk2b calcium/calmodulin-dependent protein _{kinase II, beta} NM_007595 Camk2d calcium/calmodulin-dependent protein _{kinase II, delta} NM_023813 Camk2g calcium/calmodulin-dependent protein _{kinase II gamma} NM_178597 Camk4 calcium/calmodulin-dependent protein _{kinase IV} NM_009793 Camkk1 calcium/calmodulin-dependent protein _{kinase kinase 1, alpha} NM_018883 Camkk2 calcium/calmodulin-dependent protein _{kinase kinase 2, beta} NM_145358 Camkv CaM kinase-like vesicle-associated NM_145621

Canx calnexin NM_007597

Carkl carbohydrate kinase-like NM_029031

Cask calcium/calmodulin-dependent serine

protein kinase (MAGUK family) NM_009806

Casp12 caspase 12 NM_009808

Ccnd1 cyclin D1 NM_007631

Ccrk cell cycle related kinase NM_053180

CD209 CD209 antigen NM_021155

(32)

Cdc20 cell division cycle 20 homolog (S. _cerevisiae) NM_023223 Cdc25a cell division cycle 25 homolog A (S. _cerevisiae) NM_007658 Cdc25b cell division cycle 25 homolog B (S. _cerevisiae) NM_023117 Cdc25c cell division cycle 25 homolog C (S. _cerevisiae) NM_009860 Cdc2a cell division cycle 2 homolog A (S. pombe) NM_007659 Cdc2l1 cell division cycle 2-like 1 NM_007661 Cdc2l5 cell division cycle 2-like 5

(cholinesterase-related cell division controller) XM_127221 Cdc2l6 cell division cycle 2-like 6 (CDK8-like) NM_198164 Cdc42bpa Cdc42 binding protein kinase alpha XM_283677 Cdc42bpb Cdc42 binding protein kinase beta NM_183016 Cdc42bpg CDC42 binding protein kinase gamma _(DMPK-like) XM_140553 Cdc7 cell division cycle 7 (S. cerevisiae) NM_009863 Cdk10 cyclin-dependent kinase (CDC2-like) 10 NM_194444

Cdk2 cyclin-dependent kinase 2 NM_016756

Cdk5r1 cyclin-dependent kinase 5, regulatory _{subunit (p35) 1} NM_009871 Cdk5r2 cyclin-dependent kinase 5, regulatory _{subunit 2 (p39)} NM_009872

Cdk7 cyclin-dependent kinase 7 (homolog of _{Xenopus MO15 cdk-activating kinase)} NM_009874

Cdk9 cyclin-dependent kinase 9 (CDC2-related _kinase) NM_130860 Cdkl1 cyclin-dependent kinase-like 1 (CDC2-_{related kinase)} NM_183294 Cdkl2 cyclin-dependent kinase-like 2

(CDC2-related kinase) NM_016912

Cdkl3 cyclin-dependent kinase-like 3 NM_153785 Cdkl5 cyclin-dependent kinase-like 5 XM_356367 Cebpa CCAAT/enhancer binding protein (C/EBP),

alpha NM_007678

Cebpb CCAAT/enhancer binding protein (C/EBP), _beta NM_009883

Cerk ceramide kinase NM_145475

CFL1 cofilin 1 (non-muscle) NM_005507

CFL2 cofilin 2 (muscle) NM_021914

Chek1 checkpoint kinase 1 homolog (S. pombe) NM_007691 Chek2 CHK2 checkpoint homolog (S. pombe) NM_016681

Chka choline kinase alpha NM_013490

Chkb choline kinase beta NM_007692

Cit citron NM_007708

Cited4 _{Glu/Asp-rich carboxy-terminal domain, 4}Cbp/p300-interacting transactivator, with NM_019563

Ckb creatine kinase, brain NM_021273

(33)

191

Ckmt1 creatine kinase, mitochondrial 1, _ubiquitous NM_009897

Ckmt2 creatine kinase, mitochondrial 2 NM_198415

Cks1b CDC28 protein kinase 1b NM_016904

Cks2 CDC28 protein kinase regulatory subunit 2 NM_025415

Clk1 CDC-like kinase 1 NM_009905

Clk4 CDC like kinase 4 NM_007714

Cmpk cytidylate kinase NM_025647

Cnksr2 connector enhancer of kinase suppressor of _{Ras 2} NM_177751

Coasy Coenzyme A synthase NM_027896

Cpne4 copine IV XM_135115

Crebbp CREB binding protein XM_148699

Crk7 CDC2-related kinase 7 NM_026952

Crybb2 crystallin, beta B2 NM_007773

Csf1r colony stimulating factor 1 receptor NM_007779

Csk c-src tyrosine kinase NM_007783

Csnk1a1 casein kinase 1, alpha 1 NM_146087

Csnk1d casein kinase 1, delta NM_027874

Csnk1e casein kinase 1, epsilon NM_013767

Csnk1g1 casein kinase 1, gamma 1 NM_173185

Csnk2a1 casein kinase II, alpha 1 polypeptide NM_007788 Csnk2a2 casein kinase II, alpha 2, polypeptide NM_009974 Csnk2b casein kinase II, beta subunit NM_009975 Ctnnb1 catenin (cadherin associated protein), beta _{1, 88kDa} NM_007614

Cul1 cullin 1 NM_012042 Cul2 cullin 2 NM_029402 Cul3 cullin 3 NM_016716 Cul4a cullin 4A NM_146207 Cul4b cullin 4B NM_028288 Cul5 cullin 5 NM_027807 Cul7 cullin 7 XM_358324

D830007F02Rik RIKEN cDNA D830007F02 gene NM_175441 Dab2ip disabled homolog 2 (Drosophila)

interacting protein XM_130206 Dapk1 death associated protein kinase 1 NM_029653

Dapk2 death-associated kinase 2 NM_010019

Dapk3 death-associated kinase 3 NM_007828

Dcamkl1 double cortin and calcium/calmodulin-_{dependent protein kinase-like 1} NM_019978 Dcamkl2 doublecortin and CaM kinase-like 2 NM_027539 Dcamkl3 doublecortin and CaM kinase-like 3 NM_172928

Dck deoxycytidine kinase NM_007832

Ddr1 discoidin domain receptor family, member ₁ NM_007584 Ddr2 discoidin domain receptor family, member

2 NM_022563

(34)

Dgkb diacylglycerol kinase, beta NM_178681 Dgke diacylglycerol kinase, epsilon NM_019505 Dgkg diacylglycerol kinase, gamma NM_138650

Dgkh diacylglycerol kinase, eta XM_358465

Dgki diacylglycerol kinase, iota XM_355752 Dgkq diacylglycerol kinase, theta NM_199011

Dgkz diacylglycerol kinase zeta NM_138306

Dguok deoxyguanosine kinase NM_013764

Dlg5 discs, large homolog 5 (Drosophila) XM_127605 Dlgap3 discs, large (Drosophila) homolog-_{associated protein 3} NM_198618 Dlgh1 discs, large homolog 1 (Drosophila) NM_007862 Dlgh2 discs, large homolog 2 (Drosophila) NM_011807 Dlgh3 discs, large homolog 3 (Drosophila) NM_016747 Dlgh4 discs, large homolog 4 (Drosophila) NM_007864 Dmpk dystrophia myotonica-protein kinase NM_032418 Dnaja2 DnaJ (Hsp40) homolog, subfamily A, _{member 2} NM_019794 Dnaja4 DnaJ (Hsp40) homolog, subfamily A,

member 4 NM_021422

Dnajb1 DnaJ (Hsp40) homolog, subfamily B, _{member 1} NM_018808 Dnajb10 DnaJ (Hsp40) homolog, subfamily B,

member 10 NM_020266

Dnajb12 DnaJ (Hsp40) homolog, subfamily B, _{member 12} NM_019965 Dnajb3 DnaJ (Hsp40) homolog, subfamily B, _{member 3} NM_008299 Dnajb5 DnaJ (Hsp40) homolog, subfamily B,

member 5 NM_019874

Dnajb6 DnaJ (Hsp40) homolog, subfamily B, _{member 6} NM_011847 Dnajb8 DnaJ (Hsp40) homolog, subfamily B, _{member 8} NM_019964 Dnajb9 DnaJ (Hsp40) homolog, subfamily B,

member 9 NM_013760

Dnajc1 DnaJ (Hsp40) homolog, subfamily C, _{member 1} NM_007869 Dnajc2 DnaJ (Hsp40) homolog, subfamily C, _{member 2} NM_009583 Dnajc3 DnaJ (Hsp40) homolog, subfamily C,

member 3 NM_008929

Dnajc5 DnaJ (Hsp40) homolog, subfamily C, _{member 5} NM_016775 Dnajc7 DnaJ (Hsp40) homolog, subfamily C, _{member 7} NM_019795 Dnclc1 dynein, cytoplasmic, light chain 1 NM_019682

Dnm1l dynamin 1-like NM_152816

Doc2b double C2, beta NM_007873

Dtymk deoxythymidylate kinase NM_023136

Dusp1 dual specificity phosphatase 1 NM_013642 Dusp14 dual specificity phosphatase 14 NM_019819 Dusp2 dual specificity phosphatase 2 NM_010090 Dusp8 dual specificity phosphatase 8 NM_008748 Dyrk1a dual-specificity tyrosine-(Y)- NM_007890

(35)

193

phosphorylation regulated kinase 1a

Dyrk1b dual-specificity

tyrosine-(Y)-phosphorylation regulated kinase 1b NM_010092 Dyrk3 _{phosphorylation regulated kinase 3}dual-specificity tyrosine-(Y)- NM_145508 Dyrk4 _{phosphorylation regulated kinase 4}dual-specificity tyrosine-(Y)- NM_207210 E030030I06Rik RIKEN cDNA E030030I06 gene XM_286230 E030037J05Rik RIKEN cDNA E030037J05 gene NM_177169 E130304F04Rik RIKEN cDNA E130304F04 gene NM_175538 Eef2k eukaryotic elongation factor-2 kinase NM_007908 Efhc1 EF-hand domain (C-terminal) containing 1 XM_129694 Egfr epidermal growth factor receptor NM_007912 Eif2ak1 eukaryotic translation initiation factor 2

alpha kinase 1 NM_013557

Eif2ak3 eukaryotic translation initiation factor 2 _{alpha kinase 3} NM_010121 Eif2ak4 eukaryotic translation initiation factor 2 _{alpha kinase 4} NM_013719

Endog endonuclease G NM_007931

Epha1 Eph receptor A1 NM_023580

Ephb1 Eph receptor B1 NM_173447

Erbb2 oncogene homolog 2, neuro/glioblastoma v-erb-b2 erythroblastic leukemia viral

derived oncogene homolog (avian) XM_109715 Erbb3 v-erb-b2 erythroblastic leukemia viral

oncogene homolog 3 (avian) XM_125954 Erbb4 v-erb-a erythroblastic leukemia viral _{oncogene homolog 4 (avian)} XM_136682

Ern1 endoplasmic reticulum (ER) to nucleus

signalling 1 NM_023913

Ern2 endoplasmic reticulum (ER) to nucleus _{signalling 2} NM_012016

Etnk1 ethanolamine kinase 1 XM_284250

Etnk2 ethanolamine kinase 2 NM_175443

Eya1 eyes absent 1 homolog (Drosophila) NM_010164 Eya2 eyes absent 2 homolog (Drosophila) NM_010165 Eya3 eyes absent 3 homolog (Drosophila) NM_010166 Fastk Fas-activated serine/threonine kinase NM_023229 Fbxw11 F-box and WD-40 domain protein 11 NM_134015 Fbxw8 F-box and WD-40 domain protein 8 NM_172721 Fer1l3 fer-1-like 3, myoferlin (C. elegans) XM_283556

(36)

Fert2 fer (fms/fps related) protein kinase, testis _{specific 2} NM_008000

Fes feline sarcoma oncogene NM_010194

Fgfr1 fibroblast growth factor receptor 1 NM_010206 Fgfr2 fibroblast growth factor receptor 2 NM_010207 Fgfr3 fibroblast growth factor receptor 3 NM_008010 Fgfr4 fibroblast growth factor receptor 4 NM_008011 Fgr Gardner-Rasheed feline sarcoma viral (Fgr) _{oncogene homolog} NM_010208

Fkbp1a FK506 binding protein 1a NM_008019

Fkbp8 FK506 binding protein 8 NM_010223

Flt3 FMS-like tyrosine kinase 3 NM_010229

Flt3l FMS-like tyrosine kinase 3 ligand NM_013520

Flt4 FMS-like tyrosine kinase 4 NM_008029

Fn3k fructosamine 3 kinase NM_022014

Frap1 FK506 binding protein 12-rapamycin _{associated protein 1} NM_020009

Frk fyn-related kinase NM_010237

Frmd6 FERM domain containing 6 NM_028127

Fuk fucokinase NM_172283

Fyn Fyn proto-oncogene NM_008054

Fzr1 fizzy/cell division cycle 20 related 1

(Drosophila) NM_019757

Gak cyclin G associated kinase XM_132229

Galk1 galactokinase 1 NM_016905

Galk2 galactokinase 2 NM_175154

Gck glucokinase NM_010292

Gcs1 glucosidase 1 NM_020619

Gk2 glycerol kinase 2 NM_010294

Gm1078 gene model 1078, (NCBI) XM_355840

(37)

195

Gm711 gene model 711, (NCBI) NM_198628

Gmip Gem-interacting protein NM_198101

Gnb2l1 guanine nucleotide binding protein (G

protein), beta polypeptide 2 like 1 NM_008143

Gne glucosamine NM_015828

Gprk2l G protein-coupled receptor kinase 2, _{groucho gene related (Drosophila)} NM_019497 Gprk5 G protein-coupled receptor kinase 5 NM_018869 Gprk6 G protein-coupled receptor kinase 6 NM_011938 Grk1 G protein-coupled receptpr kinase 1 NM_011881

Gsg2 germ cell-specific gene 2 NM_010353

Gsk3b glycogen synthase kinase 3 beta NM_019827 GSN gelsolin (amyloidosis, Finnish type) NM_000177 Gucy1a3 guanylate cyclase 1, soluble, alpha 3 NM_021896 Gucy1b2 guanylate cyclase 1, soluble, beta 2 NM_172810 Gucy1b3 guanylate cyclase 1, soluble, beta 3 NM_017469

Gucy2c guanylate cyclase 2c XM_132928

Gucy2e guanylate cyclase 2e NM_008192

Gucy2f guanylate cyclase 2f XM_142224

Guk1 guanylate kinase 1 NM_008193

Gyk glycerol kinase NM_008194

Gykl1 glycerol kinase-like 1 NM_010293

Hck hemopoietic cell kinase NM_010407

Hdac6 histone deacetylase 6 NM_010413

Hipk1 homeodomain interacting protein kinase 1 NM_010432 Hipk2 homeodomain interacting protein kinase 2 NM_010433 Hipk3 homeodomain interacting protein kinase 3 NM_010434

Hk1 hexokinase 1 NM_010438

Hk2 hexokinase 2 NM_013820

Hk3 hexokinase 3 XM_127381

Hkdc1 hexokinase domain containing 1 NM_145419

Hoxa10 homeo box A10 NM_008263

Hsf1 heat shock factor 1 NM_008296

Hspa14 heat shock 70kDa protein 14 NM_015765

Hspa1a heat shock protein 1A XM_207062

Hspa2 heat shock protein 2 NM_008301

Hspa5 heat shock 70kD protein 5 (glucose-_{regulated protein)} NM_022310

Hspb1 heat shock protein 1 NM_013560

Hspca heat shock protein 1, alpha NM_010480

Hspcb heat shock protein 1, beta NM_008302

Hunk hormonally upregulated Neu-associated

kinase NM_015755

Ide insulin degrading enzyme NM_031156

Igf1r insulin-like growth factor I receptor NM_010513 Ihpk1 inositol hexaphosphate kinase 1 NM_013785

(38)

Ikbkb inhibitor of kappaB kinase beta NM_010546 Ikbke inhibitor of kappaB kinase epsilon NM_019777

Ilk integrin linked kinase NM_010562

Insr insulin receptor NM_010568

Insrr insulin receptor-related receptor NM_011832 Ipmk inositol polyphosphate multikinase XM_125641 Irak2 interleukin-1 receptor-associated kinase 2 NM_172161 Irak3 interleukin-1 receptor-associated kinase 3 NM_028679 Irak4 interleukin-1 receptor-associated kinase 4 NM_029926

Itch itchy XM_192925

ITGA4 integrin, alpha 4 (antigen CD49D, alpha 4 _{subunit of VLA-4 receptor)} NM_000885 Itgb1bp3 integrin beta 1 binding protein 3 XM_125745

Itk IL2-inducible T-cell kinase NM_010583

Itpk1 inositol 1,3,4-triphosphate 5/6 kinase NM_172584 Itpka inositol 1,4,5-trisphosphate 3-kinase A NM_146125 Itpkb inositol 1,4,5-trisphosphate 3-kinase B XM_205854 Itpkc inositol 1,4,5-trisphosphate 3-kinase C NM_181593 Itpkc inositol 1,4,5-trisphosphate 3-kinase C NM_181593 Itpr1 inositol 1,4,5-triphosphate receptor 1 NM_010585 Itpr3 inositol 1,4,5-triphosphate receptor 3 NM_080553

Jak1 Janus kinase 1 NM_146145

Kdr kinase insert domain protein receptor NM_010612

Khk ketohexokinase NM_008439

Kit kit oncogene NM_021099

Ksr kinase suppressor of ras NM_013571

LAT linker for activation of T cells NM_014387

Lats1 large tumor supressor XM_194716

Lats2 large tumor suppressor 2 NM_015771

LBP lipopolysaccharide binding protein NM_004139 Lck lymphocyte protein tyrosine kinase NM_010693 Lef1 lymphoid enhancer binding factor 1 NM_010703 Limk1 LIM-domain containing, protein kinase NM_010717 Limk2 LIM motif-containing protein kinase 2 NM_010718

Lmtk2 lemur tyrosine kinase 2 XM_132499

Lmtk3 lemur tyrosine kinase 3 XM_356032

LOC209203 similar to heat shock protein 1, beta XM_142222

LOC210619 similar to RP3-330M21.4 XM_140038

LOC211430 similar to Dysferlin (Dystrophy associated _{fer-1 like protein) (Fer-1 like protein 1)} XM_136730 LOC216178 similar to TAK1 (TGF-beta-activated kinase) XM_125802 LOC225264 similar to Pyruvate kinase 3 XM_140199 LOC227885 similar to heat shock protein 1, beta XM_140982

LOC229005 similar to Pim2 protein XM_130753

LOC229879 similar to Nucleoside diphosphate kinase B _{(NDK B) (NDP kinase B) (P18)} XM_143595 LOC232619 similar to hypothetical protein XM_145207 LOC233024 similar to protein kinase C zeta XM_124895 LOC237016 similar to pyruvate kinase (EC 2.7.1.40)

isozyme M2 - rat XM_142088

(39)

197

LOC238564 similar to myosin light chain kinase XM_111421

LOC238678 similar to Methylmalonic aciduria type A XM_138664 LOC241051 similar to PHD finger protein 19 XM_136726 LOC241572 similar to Pyruvate kinase 3 XM_141269 LOC241864 similar to SNF related kinase XM_143053 LOC245068 similar to putative protein kinase XM_142402 LOC245355 similar to Casein kinase II, alpha 1 _polypeptide XM_141642

LOC279333 similar to TOPK XM_205529

LOC329248

similar to Phosphatidylinositol-4-phosphate 3-kinase C2 domain-containing beta polypeptide (Phosphoinositide 3-Kinase-C2-beta) (PtdIns-3-kinase C2 beta)

(PI3K-C2beta) (C2-PI3K)

XM_283638

LOC329302 similar to CDC42-binding protein kinase _alpha XM_283676 LOC333050 similar to kinase suppressor of ras 2 XM_285897

LOC381164 similar to Pgk1 protein XM_355086

LOC381390 similar to serine/threonine kinase XM_355352 LOC381936 similar to Ser/Thr protein kinase PAR-1A XM_355960 LOC381937 similar to Ser/Thr protein kinase PAR-1A XM_355961 LOC383041 similar to novel protein similar to

vertebrate otoferlin (OTOF) XM_356816 LOC383956 similar to putative protein kinase XM_357348 LOC385049 similar to Rho-associated coiled-coil _{forming kinase 1} XM_358017 LOC385092 similar to putative protein kinase XM_358047 LOC546214 similar to putative protein kinase XM_142616 LOC546236 similar to putative protein kinase XM_135656 Lrrk2 leucine-rich repeat kinase 2 NM_025730

Ltk leukocyte tyrosine kinase NM_206941

Lyn Yamaguchi sarcoma viral (v-yes-1) _{oncogene homolog} NM_010747 M6PR mannose-6-phosphate receptor (cation

dependent) NM_002355

M6PRBP1 mannose-6-phosphate receptor binding _{protein 1} NM_005817

Mamdc1 MAM domain containing 1 NM_207010

Map2k1 mitogen activated protein kinase kinase 1 NM_008927 Map2k2 mitogen activated protein kinase kinase 2 NM_023138 Map2k3 mitogen activated protein kinase kinase 3 NM_008928 Map2k4 mitogen activated protein kinase kinase 4 NM_009157 Map2k5 mitogen activated protein kinase kinase 5 NM_011840 Map2k6 mitogen activated protein kinase kinase 6 NM_011943 Map2k7 mitogen activated protein kinase kinase 7 NM_011944 Map3k1 mitogen activated protein kinase kinase _{kinase 1} NM_011945 Map3k10 mitogen activated protein kinase kinase _{kinase 10} XM_194344 Map3k11 mitogen activated protein kinase kinase _{kinase 11} NM_022012 Map3k12 mitogen activated protein kinase kinase _{kinase 12} NM_009582 Map3k14 mitogen-activated protein kinase kinase _{kinase 14} NM_016896

(40)

Map3k2 mitogen activated protein kinase kinase _{kinase 2} NM_011946 Map3k3 mitogen activated protein kinase kinase _{kinase 3} NM_011947 Map3k4 mitogen activated protein kinase kinase _{kinase 4} NM_011948 Map3k5 mitogen activated protein kinase kinase _{kinase 5} NM_008580 Map3k6 mitogen-activated protein kinase kinase _{kinase 6} NM_016693 Map3k7 mitogen activated protein kinase kinase _{kinase 7} NM_172688 Map3k8 mitogen activated protein kinase kinase _{kinase 8} NM_007746 Map3k9 mitogen-activated protein kinase kinase _{kinase 9} NM_177395 Map4k1 mitogen activated protein kinase kinase _{kinase kinase 1} NM_008279 Map4k2 mitogen activated protein kinase kinase _{kinase kinase 2} NM_009006 Map4k3 mitogen-activated protein kinase kinase _{kinase kinase 3} XM_128800 Map4k4 mitogen-activated protein kinase kinase _{kinase kinase 4} NM_008696 Map4k5 mitogen-activated protein kinase kinase _{kinase kinase 5} NM_024275 Mapk1 mitogen activated protein kinase 1 NM_011949 Mapk10 mitogen activated protein kinase 10 NM_009158 Mapk11 mitogen-activated protein kinase 11 NM_011161 Mapk12 mitogen-activated protein kinase 12 NM_013871 Mapk13 mitogen activated protein kinase 13 NM_011950 Mapk14 mitogen activated protein kinase 14 NM_011951 Mapk15 mitogen-activated protein kinase 15 NM_177922 Mapk3 mitogen activated protein kinase 3 NM_011952 Mapk4 mitogen-activated protein kinase 4 NM_172632 Mapk6 mitogen-activated protein kinase 6 NM_015806 Mapk7 mitogen activated protein kinase 7 NM_011841 Mapk8 mitogen activated protein kinase 8 NM_016700 Mapk8ip1 mitogen activated protein kinase 8 _{interacting protein 1} NM_011162 Mapk9 mitogen activated protein kinase 9 NM_016961 Mapkapk2 MAP kinase-activated protein kinase 2 NM_008551 Mapkapk3 mitogen-activated protein kinase-activated _{protein kinase 3} NM_178907 Mapkapk5 MAP kinase-activated protein kinase 5 NM_010765 MARCO macrophage receptor with collagenous _structure NM_006770 Mark1 MAP/microtubule affinity-regulating kinase ₁ NM_145515 Mark2 MAP/microtubule affinity-regulating kinase

2 NM_007928

Mark3 MAP/microtubule affinity-regulating kinase ₃ NM_022801 Mark4 MAP/microtubule affinity-regulating kinase ₄ NM_172279 Mast2 microtubule associated serine/threonine NM_008641

(41)

199

kinase 2

Mast3 microtubule associated serine/threonine

kinase 3 NM_199308

Mast4 microtubule associated serine/threonine _{kinase family member 4} XM_283179 Mastl microtubule associated serine/threonine _kinase-like NM_025979 Matk megakaryocyte-associated tyrosine kinase NM_010768 Meis1 myeloid ecotropic viral integration site 1 NM_010789 Melk maternal embryonic leucine zipper kinase NM_010790

Mep1b meprin 1 beta NM_008586

Mertk c-mer proto-oncogene tyrosine kinase NM_008587

Met met proto-oncogene NM_008591

MGC102419 similar to mNori-2p XM_355368

MGI:1351465 Ras-GTPase-activating protein SH3-domain _{binding protein} NM_013716 Mink1 misshapen-like kinase 1 (zebrafish) NM_016713 Mknk1 MAP kinase-interacting serine/threonine _{kinase 1} NM_021461 Mknk2 MAP kinase-interacting serine/threonine _{kinase 2} NM_021462 Mlkl mixed lineage kinase domain-like XM_356104

Morc microrchidia NM_010816

Morc3 microrchidia 3 XM_128334

Mos Moloney sarcoma oncogene NM_020021

Mpp1 membrane protein, palmitoylated NM_008621 Mpp2 membrane protein, palmitoylated 2 _{(MAGUK p55 subfamily member 2)} NM_016695 Mpp3 membrane protein, palmitoylated 3

(MAGUK p55 subfamily member 3) NM_007863 Mpp4 membrane protein, palmitoylated 4 _{(MAGUK p55 subfamily member 4)} NM_145143 Mpp5 membrane protein, palmitoylated 5 _{(MAGUK p55 subfamily member 5)} NM_019579 Mpp6 membrane protein, palmitoylated 6

(MAGUK p55 subfamily member 6) NM_019939

MRC1 mannose receptor, C type 1 NM_002438

MRC2 mannose receptor, C type 2 NM_006039

Mre11a meiotic recombination 11 homolog A (S. _cerevisiae) NM_018736 MSR1 macrophage scavenger receptor 1 NM_002445 Mst1r macrophage stimulating 1 receptor (c-met-_{related tyrosine kinase)} NM_009074 Mtmr2 myotubularin related protein 2 NM_023858 Mtmr3 myotubularin related protein 3 NM_028860 Mtmr7 myotubularin related protein 7 NM_019433

Muc3 mucin 3, intestinal XM_355711

Mulk multiple substrate lipid kinase NM_023538 Musk muscle, skeletal, receptor tyrosine kinase NM_010944

Mvk mevalonate kinase NM_023556

Mylk myosin, light polypeptide kinase NM_139300 Mylk2 myosin, light polypeptide kinase 2, skeletal _muscle XM_130630

Myo3a myosin IIIA NM_148413

(42)

Nadk NAD kinase NM_138671

Nbn nibrin NM_013752

Nck1 non-catalytic region of tyrosine kinase _{adaptor protein 1} NM_010878 Nedd8 _{developmentally down-regulated gene 8}neural precursor cell expressed, NM_008683 Nek11 NIMA (never in mitosis gene a)-related

expressed kinase 11 NM_172461 Nek2 NIMA (never in mitosis gene a)-related _{expressed kinase 2} NM_010892 Nek3 NIMA (never in mitosis gene a)-related

expressed kinase 3 NM_011848 Nek4 NIMA (never in mitosis gene a)-related _{expressed kinase 4} NM_011849 Nek5 NIMA (never in mitosis gene a)-related _{expressed kinase 5} NM_177898 Nek6 NIMA (never in mitosis gene a)-related

expressed kinase 6 NM_021606 Nek7 NIMA (never in mitosis gene a)-related _{expressed kinase 7} NM_021605 Nek8 NIMA (never in mitosis gene a)-related _{expressed kinase 8} NM_080849 Nek9 NIMA (never in mitosis gene a)-related

expressed kinase 9 NM_145138 Nfkb1 nuclear factor of kappa light chain gene _{enhancer in B-cells 1, p105} NM_008689

Nlk nemo like kinase NM_008702

Nme1 expressed in non-metastatic cells 1, protein NM_008704 Nme2 expressed in non-metastatic cells 2, protein NM_008705 Nme3 expressed in non-metastatic cells 3 NM_019730 Nme4 expressed in non-metastatic cells 4, protein NM_019731 Nme5 expressed in non-metastatic cells 5 NM_080637 Nme6 expressed in non-metastatic cells 6, protein NM_018757 Nme7 non-metastatic cells 7, protein expressed in NM_138314 Npr1 natriuretic peptide receptor 1 NM_008727 Npr2 natriuretic peptide receptor 2 NM_173788 Nrbp nuclear receptor binding protein NM_147201 Nrbp2 nuclear receptor binding protein 2 NM_144847

Nrk Nik related kinase NM_013724

Nrp1 neuropilin 1 NM_008737

Nrp2 neuropilin 2 NM_010939

Ntrk1 neurotrophic tyrosine kinase, receptor, type ₁ XM_283871 Ntrk2 neurotrophic tyrosine kinase, receptor, type ₂ NM_008745 Ntrk3 neurotrophic tyrosine kinase, receptor, type ₃ NM_008746 Nuak1 ZNUAK family, SNF1-like kinase, 1 XM_196007 Nuak2 NUAK family, SNF1-like kinase, 2 NM_028778

Olfr1047 olfactory receptor 1047 NM_147012

(43)

201

Oxsr1 oxidative-stress responsive 1 XM_135264 Pak1 p21 (CDKN1A)-activated kinase 1 NM_011035 Pak2 p21 (CDKN1A)-activated kinase 2 NM_177326 Pak3 p21 (CDKN1A)-activated kinase 3 NM_008778 Pak4 p21 (CDKN1A)-activated kinase 4 NM_027470 Pak6 p21 (CDKN1A)-activated kinase 6 XM_111790 Pak7 p21 (CDKN1A)-activated kinase 7 NM_172858

Pank1 pantothenate kinase 1 NM_023792

Pank2 pantothenate kinase 2 (Hallervorden-Spatz _syndrome) NM_153501

Papss1 3'-phosphoadenosine 5'-phosphosulfate _{synthase 1} NM_011863 Papss2 3'-phosphoadenosine 5'-phosphosulfate _{synthase 2} NM_011864 Pask PAS domain containing serine/threonine _kinase NM_080850

Pbk PDZ binding kinase NM_023209

Pbx1 pre B-cell leukemia transcription factor 1 NM_008783 Pcgf2 polycomb group ring finger 2 NM_009545 Pck1 phosphoenolpyruvate carboxykinase 1, _cytosolic NM_011044 Pctk1 PCTAIRE-motif protein kinase 1 NM_011049 Pctk2 PCTAIRE-motif protein kinase 2 NM_146239 Pctk3 PCTAIRE-motif protein kinase 3 NM_008795 Pdia3 protein disulfide isomerase associated 3 NM_007952 Pdik1l PDLIM1 interacting kinase 1 like NM_146156 Pdk2 pyruvate dehydrogenase kinase, isoenzyme ₂ NM_133667 Pdk3 pyruvate dehydrogenase kinase, isoenzyme ₃ NM_145630 Pdk4 pyruvate dehydrogenase kinase, isoenzyme ₄ NM_013743

PDLIM5 PDZ and LIM domain 5 NM_006457

Pdpk1 3-phosphoinositide dependent protein

kinase-1 NM_011062

Pdxk pyridoxal (pyridoxine, vitamin B6) kinase NM_172134

Pdzk8 PDZ domain containing 8 XM_140761

Pfkfb1

6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 1 XM_284750

(44)

Pfkfb3 6-phosphofructo-2-kinase/fructose-2,6-_{biphosphatase 3} NM_172976 Pfkfb4 6-phosphofructo-2-kinase/fructose-2,6-_{biphosphatase 4} NM_173019 Pfkl phosphofructokinase, liver, B-type NM_008826

Pfkm phosphofructokinase, muscle NM_021514

Pftk1 PFTAIRE protein kinase 1 NM_011074

Pgk1 phosphoglycerate kinase 1 NM_008828

Pgk2 phosphoglycerate kinase 2 NM_031190

Phc1 polyhomeotic-like 1 (Drosophila) NM_007905 Phka1 phosphorylase kinase alpha 1 NM_008832 Phka2 phosphorylase kinase alpha 2 NM_172783

Phkb phosphorylase kinase beta NM_199446

Phkg1 phosphorylase kinase gamma 1 NM_011079 Phkg2 phosphorylase kinase, gamma 2 (testis) NM_026888 Pi4k2a phosphatidylinositol 4-kinase type 2 alpha NM_145501 Pi4k2b phosphatidylinositol 4-kinase type 2 beta NM_025951 Pik3c2a phosphatidylinositol 3-kinase, C2 domain _{containing, alpha polypeptide} NM_011083 Pik3c2g phosphatidylinositol 3-kinase, C2 domain

containing, gamma polypeptide NM_011084 Pik3c3 phosphoinositide-3-kinase, class 3 NM_181414 Pik3ca phosphatidylinositol 3-kinase, catalytic,

alpha polypeptide NM_008839

Pik3cb phosphatidylinositol 3-kinase, catalytic, _{beta polypeptide} NM_029094 Pik3cd phosphatidylinositol 3-kinase catalytic _{delta polypeptide} NM_008840 Pik3cg phosphoinositide-3-kinase, catalytic,

gamma polypeptide NM_020272

Pik3r2 phosphatidylinositol 3-kinase, regulatory _{subunit, polypeptide 2 (p85 beta)} NM_008841 Pik3r3 phosphatidylinositol 3 kinase, regulatory _{subunit, polypeptide 3 (p55)} NM_181585 Pik3r4 phosphatidylinositol 3 kinase, regulatory

subunit, polypeptide 4, p150 XM_135116 Pik4cb phosphatidylinositol 4-kinase, catalytic, _{beta polypeptide} NM_175356

Pim1 proviral integration site 1 NM_008842

Pin1 protein (peptidyl-prolyl cis/trans isomerase) _{NIMA-interacting 1} NM_023371 Pink1 PTEN induced putative kinase 1 NM_026880 Pip5k1a phosphatidylinositol-4-phosphate 5-kinase, _{type 1 alpha} NM_008846 Pip5k1b phosphatidylinositol-4-phosphate 5-kinase, _{type 1 beta} NM_008847 Pip5k1c phosphatidylinositol-4-phosphate 5-kinase, _{type 1 gamma} NM_008844 Pip5k2a phosphatidylinositol-4-phosphate 5-kinase, _{type II, alpha} NM_008845 Pip5k2b phosphatidylinositol-4-phosphate 5-kinase, _{type II, beta} NM_054051 Pip5k2c phosphatidylinositol-4-phosphate 5-kinase, _{type II, gamma} NM_054097

(45)

203

Pip5k3 phosphate/phosphatidylinositol 5-kinase,

phosphatidylinositol-3-type III NM_011086

Pip5kl1 phosphatidylinositol-4-phosphate

5-kinase-like 1 NM_198191

Pkia protein kinase inhibitor, alpha NM_008862 Pklr pyruvate kinase liver and red blood cell NM_013631

Pkm2 pyruvate kinase, muscle NM_011099

Pkmyt1 protein kinase, membrane associated _{tyrosine/threonine 1} NM_023058

Pkn1 protein kinase N1 NM_177262 Pkn2 protein kinase N2 NM_178654 Pkn3 protein kinase N3 NM_153805 Plcg1 phospholipase C, gamma 1 NM_021280 Plcl1 phospholipase C-like 1 XM_129785 Plcl2 phospholipase C-like 2 NM_013880

Plk1 polo-like kinase 1 (Drosophila) NM_011121 Plk2 polo-like kinase 2 (Drosophila) NM_152804 Plk3 polo-like kinase 3 (Drosophila) NM_013807 Plk4 polo-like kinase 4 (Drosophila) NM_011495

Pln phospholamban NM_023129

Pmvk phosphomevalonate kinase NM_026784

Pnck pregnancy upregulated non-ubiquitously _{expressed CaM kinase} NM_012040 Pnkp polynucleotide kinase 3'- phosphatase NM_021549 Ppfibp2 type, F interacting protein, binding protein protein tyrosine phosphatase,

receptor-2

NM_008905 Ppid peptidylprolyl isomerase D (cyclophilin D) NM_026352 Ppp1ca protein phosphatase 1, catalytic subunit, _{alpha isoform} NM_031868 Ppp2cb protein phosphatase 2a, catalytic subunit, _{beta isoform} NM_017374 Ppp2r1a _{regulatory subunit A (PR 65), alpha isoform}protein phosphatase 2 (formerly 2A), NM_016891 Ppp3cc protein phosphatase 3, catalytic subunit, _{gamma isoform} NM_008915 Ppp3r1 protein phosphatase 3, regulatory subunit _{B, alpha isoform (calcineurin B, type I)} NM_024459 Prkaa1 protein kinase, AMP-activated, alpha 1 _{catalytic subunit} XM_139298 Prkaa2 protein kinase, AMP-activated, alpha 2 _{catalytic subunit} XM_131633 Prkab1 protein kinase, AMP-activated, beta 1 non-_{catalytic subunit} NM_031869 Prkab2 protein kinase, AMP-activated, beta 2 non-_{catalytic subunit} NM_182997 Prkaca protein kinase, cAMP dependent, catalytic, _alpha NM_008854 Prkaca-ps1 protein kinase, cAMP dependent, catalytic, _{alpha pseudogene 1} XM_205338 Prkacb protein kinase, cAMP dependent, catalytic, _beta NM_011100 Prkag1 protein kinase, AMP-activated, gamma 1 _{non-catalytic subunit} NM_016781 Prkag3 protein kinase, AMP-activated, gamma 3 NM_153744