• Nenhum resultado encontrado

Rev. Soc. Bras. Med. Trop. vol.30 número5

N/A
N/A
Protected

Academic year: 2018

Share "Rev. Soc. Bras. Med. Trop. vol.30 número5"

Copied!
4
0
0

Texto

(1)

The ac ute p hase o f Chagas’ dise ase is characterized by high parasitemia levels in which the blood parasites may easily be detected by microscopic observation. However, most acute infections remain undiagnosed and clinical disease may only become apparent many years later during the chronic phase of disease in which some patients may develop c a rd i a c , d i g e s ti ve a n d /o r n e u ro l o g i c a l pathology3. During the chronic phase, blood p a ra s i t e s a re n o t d e t e c t a b l e b y d i re c t parasitological methods, but evidence for infection may be obtained by serological means. More recently, the presence of parasite DNA in pe riphe ral b lo o d in patie nts with c hro nic infection has been demonstrated by PCR2 14.

The mechanisms underlying the development of pathological disorders in chagasic patients are poorly understood. The infecting strain as well as autoimmune factors have been shown to be involved in the pathological process10 11. In Ecuador, the existence of chagasic endemic regions is well documented4 5 with a new foci with evidence of transmission recently reported1. Although in Ecuador cardiomyopathy has been asso c iate d with Chagas’ dise ase8, little is

known in relation to digestive pathology. We herein report two cases with severe digestive pathology suggestive of Chagas’ disease, in which circulating T. cruzi DNA was demonstrated by PCR.

CASE REPORTS

Ca se 1. A 65-year-old man living in the province of Esmeraldas (northwestern area of Ecuador) but born in an area highly endemic for Chagas (province of Loja, southwestern re gio n) , so ught me dic al assistanc e due to chronic constipation. His chief complaint was abdominal pain and no bowel movements for the last two weeks. Physical examination revealed abdominal distension and tenderness. Rectal examination revealed the presence of a fecaloma. Hematological and biochemical blood tests were all within normal limits. Radiological s tu die s o f th e a b do m e n c o n firm e d th e presence of a large amount of fecal material in th e re c to s ig m o ida l re g io n a lo n g w ith pronounced achalasia of esophagus. (Figure 1A). Oesophago-gastroduodenoscopy revealed th e p re se n c e o f e so p h a ge c ta sis, wh ile a c o lo no sc o py sho we d do lic ho me gac o lo n. Histopathological studies on biopsies taken fro m th e e s o p h a g u s a n d c o lo n s h o w e d n e uro n a l le s io n s in th e e s o p h a ge a l a n d intestinal mesenteric plexuses. A diagnosis of dolichomegaesophagus and megacolon was made.

Ca se 2. A 63-year-old woman born and permanent resident of the province of Morona Santiago (southeastern Ecuador), sought medical

389

SEVERE DIGESTIVE PATHOLOGY ASSOCIATED WITH

CHRONIC CHAGAS’ DISEASE IN ECUADOR:

REPORT OF TWO CASES

Angel G. Guevara, José W. Eras, Marcelo Recalde, Luis Vinueza,

Philip J. Cooper, Ali Ouaissi and Ronald H. Guderian

DNA extra cted from periphera l blood of two Ecua doria n pa tients showing severe d i ge sti ve pa th o lo gy w a s a m pli f i e d b y th e po lym e ra se c h a i n r e a c ti o n u si n g a

Trypanosoma cruzi specific oligonucleotide primers derived from the prima ry sequence of a cDNA encoding for a 24 kDa excretory/secretory protein. The positive PCR results together with the clinica l findings confirmed tha t both pa tients ha d a digestive pa thology due to Cha ga s’ disea se. This pa thology could be more frequent tha n previously described in the cha ga sic endemic regions of Andea n countries.

Key-words: Cha ga s' disea se. T. cruzi. PCR. Mega esopha gus. Mega colon. Ecua dor.

Department of Clinic al Investigations, Department of Family Practice, Department of Surgery, Hospital Vozandes-Quito, Vozandes-Quito, Ecuador and Parasitology Laboratory, CJF INSERM No 96-04, Faculty of Medicine, Montpellier, France.

Ad d r e ss to :Dr. Ange l Gustavo Gue vara. Lab o rato r y o f Clinical Investigations. Hospital Vozandes-Quito, Villalengua 267 y 10 de Agosto, Casilla 17-17-691, Quito, Ecuador. Fax: ++ 593-2-269.234.

Recebido para publicação em 19/11/96.

Revista da Socieda de Bra sileira de Medicina Tropica l 30(5):389-392, set-out, 1997.

(2)

Rela to de Ca so. Gueva ra AG, Era s JW, Reca lde M, Vinueza L, Cooper PJ, Oua issi A, Guderia n RH. Severe digestive pa thology a ssocia ted with chronic Cha ga s’ disea se in Ecua dor: report of two ca ses. Revista da Socieda de Bra sileira de Medicina Tropica l 30:389-392, set-out, 1997.

390

help due to chronic constipation and abdominal pain. Physical examination revealed a painful distended abdomen. Radiological studies showed the presence of a megacolon associated with dolichome gacolon (Figure 1B ). On hospital admission, the patient was dyspneic due to abdominal distension. An emergency laparotomy was done which revealed an extremely dilated colon, in particular the sigmoid, occupying the whole abdominal cavity. A fecaloma was found in the rectum. A sigmoidectomy and colostomy was performed. Histopathological studies on the tissue s sho we d ganglio nar c e lls with d e g e n e ra t i v e c h a n g e s . A d i a g n o s i s o f dolichomegacolon was made.

Dia gnosis of T. cruzi Infection. Serology. Since the histo patho lo gical studie s sho we d nonspecific changes, and since megaviscera can be associated with Chagas’ disease, sera from both patients were tested for anti-T. cruzi antibodies. ELISA tests were performed using as antigens an epimastigote crude extract and a re c o mb in a n t T. c r u z i s p e c ific a n tige n (rTc24)8. A strong positive reaction against both antigens was seen with sera from both patients. DNA preparation and Tc24-based polymerase c hain re ac tio n. Antib o die s against rTc 24 reflect the presence of an active T. cruziinfection o r an unsuc c e ssful tre atme nt9, while tho se directed against crude lysate indicate exposure

Figure 1A - Cha ga sic mega esopha gus showing stenosis

typica l of a cha la sia (ca se 1). Figura 1B - Cha ga sic mega colon with enla rgement of thesigmoid.

to the parasite. To confirm the possible existence of a T. cruziinfection, a PCR assay6was performed as fo llo ws: 5ml o f ve no us b lo o d fro m b o th patients were collected with EDTA. 200µl of each sample were brought up to 400µl with PCR grade wate r and mixe d with the same volume of 2X lysis buffer (20mM EDTA, 20mM

(3)

b lo o d sample se ro lo gic ally ne gative fo r T. cruzi from a endemic area was used, while a pGEX-2T plasmid containing the Tc24 cDNA was use d as the po sitive c o ntro l. Fo r PCR assay, 5µl of purified DNA templates were adde d in a final vo lume o f 50-µl re ac tio n containing 100 pmol of Tc24-specific primers: T1 5´ GACGGCAAGAACGCCAAGGAC 3´ and T2 5´ TCACGCGCTCTCCGGCACGTTGTC 3´, a n d 2 . 5 u n its o f Ta q D NA p o lym e ra s e (Promega, Madison, WI, USA). After 35 cycles at 94oC (1 min, denaturation), 60oC (1 min, annealing) and 72oC (2 min, elongation), the amplifie d pro duc ts we re analyze d b y 1% agarose gel electrophoresis and visualized by ethidium bromide staining. Both samples were positive for T. cruzi(Figure 2) as shown by the presence of amplified DNA.

DISCUSSION

This report definitively demonstrated the pre se nce o f dige stive patho lo gy asso ciate d with Chagas’ disease in Ecuador. The positive PCR re sults c o nfirme d that the parasite T. cruzi was still present in both patients. In Latin America, there is evidence suggesting geographic differences in the prevalence of megaviscera in Chagas’ disease7. In chagasic endemic regions

in Brazil, Argentina and Chile, the prevalence of megaviscera is high, while in the Andean S o u th a n d Ce n tra l Am e ri c a n c o u n tri e s megaviscera are absent or very rare. Digestive pathology with probable chagasic etiology has been reported in Mexico while in Venezuela only changes in esophageal motility has been shown in T. cruzi infected patients12. The cases we report here emphazise that digestive pathology associated with T. c ru z i infection may not be as rare as previously thought.

It is of interest that the patients in this study came from different geographical endemic regions in Ecuador; Morona Santiago province located in the eastern side of the Andes and Lo ja pro vinc e lo c ate d o n the we ste rn side . Recently, additional cases from other provinces, Pastaza and El Oro have been documented (R. Guderian, unpublished observations) supporting the no tio n that dige stive patho lo gy due to American trypanosomiasis may be underestimated in Ecuador.

Antiparasitic treatment of chronic cases with severe pathology is still controversial. Surgical inte rve ntio n is re c o mme nde d in c hagasic patients with complicated megaviscera10. In the two case s de scribe d in this re port, both patients showed complications such as fecaloma. Surgery was done in case 2 with a satisfactory result. In case 1, clinical treatment was sufficient to improve esophageal function.

Control strategies for Chagas’ disease currently rely on reduction of transmission by insecticide spraying. Ho we ve r, asympto matic c hro nic cases constitute a potential risk of transfusion-associated transmission of T. cruziand reactivation of the disease in immunodepressed T. c ru z i infected individuals. Thus, in co-infections with HIV, the classical clinical manifestations of the disease may become altered, as neurological disturb anc e s suc h as me ningo e nc e phalitis have been observed13. More detailed surveys to determine seropositivity, quality of blood p ro du c ts a n d th e ir de riva tive s u s e d fo r transfusion, and consequent pathology due to Chagas’ disease are still required in Ecuador to define the epidemiology of this disease.

RESUMO

DNA o b tid o d o sa n gu e pe rifé ric o d e d o is pa cientes equa toria nos, que a presenta va m severa pa tologia digestiva , foi a mplifica do pela “polymera se cha in rea ction” (PCR) utiliza ndo os oligonucleotídoes Rela to de Ca so. Gueva ra AG, Era s JW, Reca lde M, Vinueza L, Cooper PJ, Oua issi A, Guderia n RH. Severe digestive pa thology a ssocia ted with chronic Cha ga s’ disea se in Ecua dor: report of two ca ses. Revista da Socieda de Bra sileira de Medicina Tropica l 30:389-392, set-out, 1997.

391

(4)

específicos do Trypanosoma cruzi,deriva dos de uma seqüência primá ria de cDNA codifica do de 24 kDa proteína excretória /secretória . Os resulta dos positivos da PCR junto com os a cha dos clínicos confirma m q u e o s d o is pa c ie n te s tin h a m u m a pa to lo gia d ige stiva d e o rige m c h a gá sic a . Esta pa to lo gia

p o d e r i a se r m a i s f r e q ü e n te q u e a d e sc r i ta previa mente na s regiões endêmica s cha gá sica s da s cida des dos Andes.

Pa la vra s-cha ves: Doença de Cha ga s. T. cruzi. PCR. Mega esôfa go. Mega cólon. Ecua dor.

Rela to de Ca so. Gueva ra AG, Era s JW, Reca lde M, Vinueza L, Cooper PJ, Oua issi A, Guderia n RH. Severe digestive pa thology a ssocia ted with chronic Cha ga s’ disea se in Ecua dor: report of two ca ses. Revista da Socieda de Bra sileira de Medicina Tropica l 30:389-392, set-out, 1997.

392

REFERENCES

1. Amunárriz M, Chico ME, Guderian RH. Chagas' disease in Ecuador: a sylvatic focus in the Amazon region. Journal of Tropical Medicine and Hygiene 94:145-149, 1991.

2. Avila HA, Pereira JB, Thiemann O, De Paiva E, Degrave W, Morel CA, Simpson L. Detection of

Trypa n osom a cruz i in blood spec imens of chronic chagasic patients by polymerase chain reaction amplification of kinetoplast minicircle DNA: comparison with serology and xenodiagnosis. Journal of Clinical Microbiology 31:2421-2426, 1993.

3. Brener ZA. Pathogenesis and immunopathology of chronic Chagas’ disease. Memórias do Instituto Oswaldo Cruz 82: 205-213, 1987.

4. Cueva I, Romero S. Estudio epidemiológico de la enfermedad de Chagas en la provincia de Loja.

In : Dire c c ió n Nac io n al de l Se gur o So c ial Campesino (ed) Los problemas de Salud en el Ec uado r. Instituto Ec uato riano de Se guridad Social, Quito, Ecuador, p. 151-161, 1987.

5. De franc M. Pre vale nc ia de la e nfe rme dad de Chagas en Ecuador: informe 1983-1986. Revista Ec uato riana de Higie ne y Me dic ina Tro pic al 37:13-25, 1987.

6. Gue vara AG, Taib i A, Alava J, Gude r ian RH, Ouaissi A. Use of a recombinant Trypa nosoma cruziprotein antigen to monitor cure of Chagas' dise ase . Transac tio ns o f the Ro yal So c ie ty o f Tropical Medicine and Hygiene 89:447-448, 1995. 7. Guevara EA, Taibi A, Billaut-Mulot O, Ouaissi A. PCR-b ase d de te c tio n o f Trypa n o so m a c ru z i

useful for specific diagnosis of human Chagas' disease. Journal of Clinical Microbiology 34: 485-486, 1996.

8. K a w a b a t a M , U c h i y a m a T , M i m o r i T , Hashiguc hi Y, De Co ro ne l VV. Asso c iatio n o f e le c t r o c ardi o grap h i c ab n o r m ali t i e s w i t h seropositivity to Trypa nosoma cruziin Ecuador. Transac tio ns o f the Ro yal So c ie ty o f Tro pic al Medicine and Hygiene 81:7-10, 1987.

9. Krautz GM, Galvao LMC, Cançado JR, Guevara EA, O uaissi A, K re t li AU. Use o f a 2 4 -kilo dalt o n

Trypa nosom a cruzi rec ombinant protein to mo nito r c ure o f Chagas'dise ase . Jo urnal o f Clinical Microbiology 33:2086-2090, 1995. 10. Melo RC, Brener Z. Tissue tropism of different

Tr y p a n o so m a c r u z i s t r ai n s . J o u r n al o f Parasitology 64 475-482, 1978.

11. Petry K, Eisen H. Chagas' disease: a model for the study of autoimmune diseases. Parasitology Today 5:111-116, 1989.

12. Rezende JM, Luqueti AO. Chagasic megavisceras.

In : Pan Americ an Health Organization (ed) Ch agas ’ dis e as e an d t h e Ne r vo us Sys t e m . PAHO/WHO Scientific Publication No. 547, p. 149-171, 1994.

13. Rocha A, Meneses ACO, Silva AM, Ferreira MS, Nishioka SA, Burgarelli MKN,Almeida E,Turcato Jr G, Metze K, Lopes ER. Pathology of patients with Chagas’ disease and acquired immunodeficiency syndro me . The Ame ric an Jo urnal o f Tro pic al Medicine and Hygiene 50:261-268, 1994. 14. Ru s s o m an do G, Fi g u e r e do A, Al m i r ó n M,

Imagem

Figure 1A - Cha ga sic mega esopha gus showing stenosis

Referências

Documentos relacionados

The purpose of the present study was to analyse the results of cardiac transplantation in patients with Chagas’ disease that were treated with lower doses of immunosuppressors

In the skin lesions four types of tissue reaction were observed: a) diffuse histiocytosis (10 cases); b) vasculitis with leukocytoclasia (five cases); c) scarce inflammatory exsudate

Depois, como assessor da Organização Panamericana de Saúde, participou do Programa que a Escola de Medicina Tropical e Higiene de Londres, sob o patrocínio da Fundação

Cecilio Felix Romaña Berón de Astrada faleceu em Barcelona, Espanha, em fevereiro do

Serological evidence of hantavirus infection in an urban area in Mato Grosso State, Brazil. Rev Soc Bras

In conclusion, two cases of patients on chronic hemodialysis who developed severe sepsis from dialysis water contaminated with Ralstonia pickettii are presented. In both cases,

FRACTURE OF THE TIBIAL COMPONENT IN TOTAL KNEE ARTHROPLASTY: REPORT ON TWO CASES.. Rev

Temporary ileostomy for the preservation of colon istula in patients with postoperative complications: case report.. Rev bras Coloproct ,