Functional and molecular evidence for heteromeric association of P2Y(1) receptor with P2Y(2) and P2Y(4) receptors in mouse granulocytes

R E S E A R C H A R T I C L E

Open Access

Functional and molecular evidence for

heteromeric association of P2Y

₁

receptor

with P2Y

₂

and P2Y

₄

receptors in mouse

granulocytes

Antonio Carlos Ribeiro-Filho

, Marcus Vinicius Buri

, Carlos Castilho Barros

, Juliana Luporini Dreyfuss

,

Helena Bonciani Nader

, Giselle Zenker Justo

, Rogério Bastos Craveiro

, João Bosco Pesquero

,

Antonio Miranda

, Alice Teixeira Ferreira

and Edgar Julian Paredes-Gamero

Abstract

Background: All hematopoietic cells express P2 receptors, however pharmacological characteristics such as expression and affinity in granulocytes are unknown.

Methods: Pharmacological characteristics of P2 receptors were evaluated by Ca2+measurements using Fura-2 fluorophore. P2 receptors expression were analyzed by flow cytometry and RT-PCR. P2 interaction were shown by coimmunoprecipitation, western blotting and FRET.

Results: Granulocytes were responsive to P2Y agonists, whereas P2X agonists were ineffective. Ca2+increase, elicited by ADP and UTP was dependent on intracellular stocks and sensitive to G-coupled receptor inhibition. Moreover, MRS2179, a specific antagonist of the P2Y1receptor, abolished ADP response. Interestingly, ADP and UTP exhibited full

heterologous desensitization, suggesting that these agonists interact with the same receptor. The heteromeric association between P2Y1receptor and the P2Y2and P2Y4receptors was shown by immunoprecipitation and FRET

analysis.

Conclusion: Clear evidence of heteromeric association of P2Y receptors was found during the evaluation of P2 receptors present in mice granulocytes, which could impact in the classical pharmacology of P2Y receptors in granulocytes.

Keywords: P2Y receptors, Calcium signaling, Heteromeric association, Granulocytes Background

Many G protein-coupled receptors, such as those in the P2 receptor family, form homo- or hetero-associations. P2 receptors, which are activated by ATP and analogs, are classified as metabotropic P2Y or ionotropic P2X receptors. Heterodimerization involving P2X receptors is well known and receptor heterodimers P2X2–3, P2X2–6,

P2X4–6 and P2X1–5 have been previously described

[1, 2]. Some studies have shown that some P2Y receptors such as P2Y1receptors, can form heteromeric association

with adenosine A1 receptor [3] and P2Y11 receptor [4].

Additionally, P2Y receptors can form constitutively functional dimers or oligomers and homo- or hetero-associations that can alter the pharmacology and intracel-lular signaling of P2Y receptors [5–7]. Among P2Y receptors, pyrimidine receptors seem to have appropriate domains for interaction with other P2Y receptors [7].

ATP is the main physiological agonist that activates all P2 receptors, except P2Y14 receptor [8]. Some P2Y

receptors (e.g., P2Y1, P2Y12and P2Y13receptors) can be

activated by purine diphosphates such as 2meSADP or

* Correspondence:edgar.gamero@unifesp.br

1_{Centro Interdisciplinar de Investigação Bioquı́mica, Universidade de Mogi}

das Cruzes, Av. Dr Cândido Xavier de Almeida Souza, 200, Mogi das Cruzes, São Paulo, Brazil

2_{Departamento de Bioquímica, Universidade Federal de São Paulo, Rua}

Pedro de Toledo, 669 - 9° andar - Prédio de Pesquisa II, R. Três de Maio 100, São Paulo, São Paulo, Brazil

Full list of author information is available at the end of the article

© 2016 The Author(s). Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

ADP [9, 10]. Pyrimidines such as UTP activate P2Y2and

P2Y4receptors and UDP activates P2Y6receptors [8, 11].

P2Y1, P2Y2, P2Y4, P2Y6 and P2Y11 receptors are mainly

Gq/11-protein coupled receptors, whereas P2Y12, P2Y13

and P2Y14 receptors are mainly Gi-protein-coupled

receptors [1, 10]. The only known P2 receptor capable of triggering adenylate cyclase in response to ATPγS or ATP is the P2Y11 receptor [12]. On the other hand, the

ionic-channel family of P2X1–7receptors increases Na+and Ca2+

concentrations by competition. These receptors are acti-vated by ATP, αβmeATP, βγmeATP and BzATP, whereas ADP is only a partial agonist of P2X5and P2X6receptors

[13]. For P2X1–7 receptors, UTP does not activate any of

the seven P2X receptors.

In the present study, we observed that ADP and UTP exhibited full heterologous desensitization in mice granulocytes, suggesting that these agonists interact with the same receptor. This unique phenomenon could be possible due to the heteromeric association observed between P2Y1/P2Y2 and P2Y1/P2Y4. These associations

could promote changes in the classical pharmacological properties of P2Y receptors observed in granulocytes.

Methods

Chemicals

Adenosine 5’-triphosphate (ATP), α,β-methyleneade-nosine 5′-triphosphate (αβMeATP), 2′-3′-O-(4-ben-zoylbenzoyl)-adenosine 5’-triphosphate (BzATP), βγ-methyleneadenosine 5’-triphosphate (βγMeATP), adenosine 5′-diphosphate (ADP), pertussis toxin (PTX), digitonin, hydrocortisone, Hystopaque (1119 and 1077) solutions and 2′-deoxy-N6-methyl adenosine 3′,5′-di-phosphate diammonium salt (MRS2179) were purchased from Sigma Chemical Co. (MO, USA). Pluronic acid, 1-[6-[((17β)-3-Methoxyestra-1,3,5 [10]-trien-17-yl)ami-no]hexyl]-1H-pyrrole-2,5-dione (U73122), ADP and two different uridine 5′-triphosphates (UTP) were purchased from Calbiochem (CA, USA). Trizol, agarose, amplification grade deoxyribonuclease I, RnaseOUT-Rnase inhibitor, TaqDNA polymerase, fura-2 acetoxy-methyl ester (fura-2/AM), fluo-4/AM, Alexa Fluor 488-conjugated goat anti-rabbit IgG and Iscove’s modified Dulbecco’s medium (IMDM) were obtained from Invitrogen Life Technologies/Molecular Probes (CA, USA). FACs lysing solution and the monoclonal extracellular antibodies Phycoerythrin (PE)-conjugated rat anti-Mac-1 and Cy7/PE-conjugated rat anti-Gr-1 were purchased from PharMingen Becton Dickinson (CA, USA). The polyclonal rabbit anti-P2Y (P2Y1,

P2Y2, P2Y4, P2Y6, P2Y11 and P2Y12) antibodies were

purchased from Alomone Labs (Jerusalem, Israel). Protein-A Sepharose was purchased from GE Healthcare (USA). Horse serum was obtained from StemCell Technologies Inc. (Vancouver, BC, Canada). All other

chemicals were acquired from Merck-Calbiochem (Rio de Janeiro, Brazil). PTX and MRS2179 were diluted in water. U73122 and fMLP were diluted in >0.001 % DMSO at final concentration, controls were carried out to exclude alterations induced by DMSO.

Isolation of granulocytes

Bone marrow was obtained from the femur bones of 3-month-old female C57BL/10 mice killed by rapid cervical dislocation. Bone marrow cells were flushed out from two femurs with Tyrode’s solution (3 ml) with a fitted syringe. The experimental protocols for animal care and use were reviewed and approved by the Bioethics Committee of our Institution according to the “Guide for the care and use of laboratory ani-mals” approved by the Animal Care Ethics Committee of the Federal University of São Paulo (1464/03).

Bone marrow cell types were separated by gradient centrifugation with different density solutions. A pool of bone marrow from six mice was suspended (6 ml) in Hystopaque (d = 1.119 g/cm3, 3 ml and d = 1.077 g/cm3, 3 ml) and centrifuged (700 × g, 30 min), allowing separ-ation of the cell types into distinct layers.

After separation of cell types, contaminants in the granulocytic fraction were removed. Erythroid cells were lysed with identical volumes of cool hypotonic (0.2 %) and hypertonic (1.6 %) NaCl solutions. Mononuclear contaminants were eliminated by centrifugation (200 × g, 10 min, 3 cycles) [14].

Calcium measurements

Measurements with calcium fluorophore fura-2 in cell suspension

Cytoplasmic Ca2+concentration ([Ca2+]cyt) was measured

in a loaded cell suspension (106cells/ml) in Tyrode’s solu-tion (137 mM NaCl, 2.68 mM KCl, 1.36 mM CaCl2,

0.49 mM MgCl2, 12 mM NaHCO3, 0.36 mM NaH2PO4,

and 5.5 mM D-glucose). Incubations with Ca2+indicator were performed at room temperature with fura-2/AM (2μM) and pluronic acid (0.02 %) under constant shaking for 40 min approximately [15]. After incorporation of fura-2, the cells were washed and suspended in Tyrode’s solution (2.5 ml) and transferred to a quartz cuvette for fluorometer measurements (SPEX FluoroLog-2, AR-CM System). Changes in [Ca2+]cytwere measured at 37 °C with

alternated excitations at λEx 340 nm and 380 nm, and

emission was measured at λEm= 505 nm. The maximum

fluorescence ratio (Rmax) was determined after disruption

of the cell plasma membranes with digitonin (50μM), and a minimum fluorescence ratio (Rmin) was obtained with

MnCl2(2 mM), followed by addition of EGTA (10 mM) in

alkaline medium. [Ca2+]cyt was calculated using the

Measurements with calcium fluorophore fluo-4 in long-term bone marrow cultures

To create a stromal layer, femur bones were excised from mice (C57BL/6) and their medullar cavities were aseptically flushed with Iscove's Modified Dulbecco's Medium (IMDM). These cells were seeded on glass coverslips (25 mm). The flasks were incubated (37 °C, 5 % CO2). Half of the media in each flask was replaced

weekly with equal amounts of fresh media. The IMDM medium was supplemented with 5 % bovine fetal serum, 20 % horse serum and 10−6 M hydrocortisone. At the end of the eighth week, after stroma formation, the remaining hematopoietic cells were removed. New bone marrow from additional mice was collected in IMDM supplemented medium (10 ml) and cultured (2 h) in tissue culture flasks (75 cm2). Non-adherent cells were collected by removing the medium and were added (106 cells per well) to the pre-cultured stroma [17].

For [Ca2+]cyt measurements, the cells were incubated

(40 min, at room temperature) with fluo-4/AM (10μM) and washed with Tyrode solution. Images were obtained in two Z planes with a microscope equipped with a laser scanner and an objective (Plan-Neofluor, 63x/1.43 numer-ical aperture) under oil immersion (Leica, SP8, Germany). The fluo-4 probe was excited at 488 nm and emission was detected by using a bypass filter (λEm= 500–550 nm). The

pinhole device was not used for [Ca2+]cyt measurements.

Images were collected at 4.5 s intervals for about 2 min. Fluorescence intensity was normalized by reference to the basal fluorescence using Examiner 3.2 (Zeiss, Germany) and Spectralyzer (Philadelphia, USA) software [17].

Flow cytometry analysis

To determine the level of P2 receptor expression in granu-locytes, 106bone marrow cells were fixed with 2 % formal-dehyde for 30 min and permeabilized for 15 min with 0.01 % saponin. The cells were incubated for 2 h with rabbit anti-P2Y IgG antibodies (6μg/ml anti-P2Y1, 8μg/ml

anti-P2Y2, 3μg/ml anti-P2Y4, 6μg/ml anti-P2Y6, 6μg/ml

anti-P2Y11and 8μg/ml anti-P2Y12) in 1 % bovine serum

albu-min (BSA) dissolved in phosphate-buffered saline (PBS). After addition of the first label, the cells were incubated for 40 min with Alexa Fluor 488-conjugated goat anti-rabbit IgG antibody (4μg/ml). The cells were then incubated for 20 min with rat Cy7/PE-conjugated anti-Gr-1 (2 μg/ml) and rat PE-conjugated anti-Mac-1 (0.1 μg/ml). Ten thousand Gr-1+Mac-1+ events were collected with a cyt-ometer (FASCalibur, Becton Dickinson). Data analysis was performed using CellQuest software (Becton Dickinson).

RNA extraction and reverse transcription polymerase chain reaction (RT-PCR)

RNA extraction and RT-PCR were performed as previ-ously described by Paredes-Gamero et al. [18] using the

same primers for P2Y1, P2Y2and P2Y12receptors. The

fol-lowing oligonucleotide primers were used for amplifying nucleotide sequences of P2Y4 receptors: sense primer,

5’agcccaagttctggagatggtg3’; anti-sense primer, 5’ggtggttccat tggcattgg3’ (GeneBank accession no. NM020621.3). The PCR amplification of the nucleotide sequence of P2Y4

re-ceptors was performed by incubating the samples at 94 °C for 1 min followed by 35 cycles of 94 °C for 1 min and 54 or 56 °C for 1 min, with a final incubation for 7 min at 72 °C. At the end of the amplification, the strands were dissociated. Electrophoresis was performed in 1 % agarose gel with a 100-bp DNA ladder as a size marker. The bands were visualized with ethidium-bromide staining.

Coimmunoprecipitation and western blotting

The granulocyte plasma membranes were disrupted with a lysing buffer that contained a protease inhibitor cock-tail (1 % Triton X-100, 10 % glycerol, 5 mM EDTA, 4 mM benzamidine, 5 mg/ml ε-aminocaproic acid, 10 mM iodoacetamide in 20 mM Tris buffer, pH 8.0). The protein cell lysate (600 μg) was cleared by incuba-tion (4 °C, 1 h) with rabbit normal serum (1:50). Protein A-Sepharose was added and the unspecific immunopre-cipitate was used as a negative control. Subsequently, the lysate was incubated (4 °C, overnight) with rabbit polyclonal anti-P2Y IgG (12 μg/ml anti-P2Y1, 16 μg/ml

anti-P2Y2, or 6 μg/ml anti-P2Y4) on a rotator. The

samples were then incubated (4 °C, 6 h) with protein A-Sepharose (50 ml) on a rotator, centrifuged (700 × g, 2 min) and washed (3 times) with lysing buffer. The immune-complex was eluted from the protein A-Sepharose resin by adding the sample buffer (100 ml) for SDS-PAGE under reduced conditions (40 % glycerol, 8 % SDS, 0.2 M Tris–HCl, pH 6.8 and 5 % β-mercaptoethanol). The samples were boiled (5 min) to release the immune-complex. Immunoprecipitated pro-teins were added to SDS-PAGE (3–20 % acrylamide) [19], and Western blot analysis was used to determine whether the P2Y1 receptor interacted with other P2Y

receptors. The proteins were electrotransferred to a nitrocellulose membrane. After blocking with non-fat skimmed milk (5 % solution) in washing buffer (0.05 % Tween in PBS), the receptors immunoprecipitated in the blot were detected with rabbit anti-P2Y IgG (2 μg/ml anti-P2Y1, 4μg/ml anti-P2Y2or 1μg/ml anti-P2Y4)

anti-bodies. Subsequently, horseradish peroxidase-conjugated goat anti-rabbit IgG was used as a secondary antibody and the reactive bands were visible after addition of enhanced chemiluminescent substrates.

A second sample was lysed as described above. After centrifugation at 12,000 g for 15 min at 4 °C, the super-natant containing the whole protein lysate (WP) was saved. Protein A-Sepharose was incubated with goat

polyclonal anti-P2Y1 (16 μg/ml) on a rotator. Further,

part of the WP (1,000 μg) was added and incubated at 4 °C for 12 h on a rotator, centrifuged (700 × g, 2 min) and washed (3 times) with lysing buffer. The immune-complex was eluted from the protein A-Sepharose resin by adding 100 μL of the sample buffer [19] and boiled for 5 min. Immunoprecipitated proteins and WP lysate were added to 10 % SDS-PAGE. After transfer, the PVDF membrane was blocked with blocking buffer (Odyssey™ Blocking Buffer- Li-COR) and incubated with rabbit anti-P2Y2 IgG, washed with PBS-Twin, and incubated

with IRDye 800CW Donkey anti-Rabbit IgG (in green; Li-COR). After stripping, the membrane was blocked again and incubated with rabbit anti-P2Y1IgG followed

by IRDye 680RD Donkey anti-Rabbit IgG (in red – LI-COR). The fluorescence was read using the Odyssey CLx® Infrared Imaging System (Li-COR).

Förster resonance energy transfer (FRET) assay

Granulocytes were fixed with 2 % formaldehyde for 30 min, washed with 0.1 % glycine, and permeabilized with 0.01 % saponin for 15 min. The cells were incu-bated for 2 h with goat anti-P2Y1 receptor (4 μg/ml,

Santa Cruz). Goat anti-IgG-Alexa Fluor 488 conjugated antibody (Invitrogen, USA) was used for 40 min as secondary antibody. Subsequently, rabbit anti-P2Y2 or

rabbit anti-P2Y4 were used (Alomone, Israel). Rabbit

anti-IgG-Alexa Fluor 546 conjugated antibody (Invitro-gen, USA) was used for 40 min. Nuclei were stained with DAPI (20 μg/ml, Sigma, USA) for 20 min. Light microscopy analyses were performed with a confocal laser scanning microscope equipped with a Plan-Apochromat 63x objective (Leica, SP8). The pinhole de-vice was adjusted to capture fluorescence of one Airy unit in one focal section.

For FRET analysis, FRET signal was obtained at 488 nm excitation employing an argon laser and the emitted fluor-escence was detected from 560 nm to 650 nm in 10.6 nm steps using the lambda modus. FRET ratios were calcu-lated using the following equation: FRET ratio = Intensity at 575 nm/Intensity at 521 nm [20].

In addition, emission spectra were measured at 488 nm excitation and the emission fluorescence was detected from 515 nm to 600 nm in 1 nm steps using FLEX station 3 (Molecular devices, USA). Fluorescence intensities were normalized to the emission maximum of the P2Y1receptor (donor) at 525 nm. FRET ratios were

calculated using the following equation: FRET ratio = Intensity at 575 nm/Intensity at 525 nm.

Purinergic quantification

Quantification of ATP and its analogs was carried out by Liquid Chromatography-Electrospray Ionization Mass Spectrometry (LC/ESI-MS) analysis as described previously

[21, 22]. Calibration samples of ATP and analogs, at 10−3 M concentration, were prepared in a water:-methanol mixture (50:50 v/v). LC/ESI-MS data were ob-tained on a Waters instrument, model 3100 coupled on a Waters Alliance model 2695 system and a Waters de-tector model 2847, using a Waters Nova-Pak C18column

(2.1 × 150 mm, 60 Å, 3.5 μm); solvent A: aqueous DEA (0.01 M) and solvent B: aqueous ammonium acetate (0.1 M); 40 % B isocratic elution for 15 min,λ = 254 nm. Mass measurements were performed in a negative mode in the following conditions: mass range between 100 and 1000 m/z; nitrogen gas flow: 4.1 L/h; capillary: 3.9 kV; cone voltage: 47 V; extractor: 8 V; source heater: 105 °C; solvent heater: 400 °C; ion energy: 1.0 V and multiplier: 996 V.

Statistical analysis

In cell suspensions, cells were loaded with fura-2 fluorophore. The cytosolic Ca2+ values were expressed as [Ca2+]cyt. In cells loaded with fluo-4 fluorophore,

[Ca2+]cyt values are shown as a representative

pseudo-colored image with reference to a fluorescence inten-sity scale [0 = black, 255 = white], and the fluorescence intensity is normalized by basal intensity.

Data are expressed as the mean ± standard error of the mean (SEM). Statistical comparisons were performed using Student’s T-test or analysis of variance (ANOVA), with the Dunnett’s post hoc test. Values of P < 0.05 were considered statistically significant. All graphical data represent at least three independent experiments.

Results

Presence of P2Y receptors in granulocytes

Since most activated P2 receptors cause a [Ca2+]cyt

uptake, this calcium was monitored in granulocytes to determine the P2 receptor subtypes expressed by these cells. P2X agonists BzATP (10–100 μM), αβMeATP (10–100 μM) and βγMeATP (1–10 μM) did not raise the [Ca2+]cyt levels (Fig. 1a–c). High concentrations of

ATP, ADP and UTP (~100μM to 1 mM) were required to promote maximal increases in [Ca2+]cyt in

granulo-cytes (Fig. 1d–f), as previously reported for some hematopoietic cell types [5, 17, 18, 22–24]. When granu-locytes were stimulated with a single application, con-centrations of ATP, ADP and UTP around 1 mM produced maximal increases in [Ca2+]cyt (Fig. 1d–f).

Subsequent treatment with ATP (1 mM) and analogs initially induced a transient increase in [Ca2+]cyt and

homologous desensitization (Fig. 1g–i).

ADP and UTP are typical P2Y agonists. To confirm that the Ca2+release is due the activation of P2Y recep-tors, Pertusis toxin (PTX), a Giprotein-coupled receptor

and U73122 caused a decrease in the agonist-dependent increases of [Ca2+]cyt(Fig. 1j–l).

The existence of P2Y receptors was confirmed by RT-PCR and flow cytometry. RT-RT-PCR assays showed expres-sion of mRNA for ADP and UTP receptors: P2Y1, P2Y2,

P2Y4and P2Y12(Fig. 2a). Flow cytometry confirmed the

presence of P2Y1, P2Y2, P2Y4 and P2Y12 receptors in

granulocytes (Gr-1+Mac-1+cells) of bone marrow at the protein level (Fig. 2b). These are receptors activated by ADP (P2Y1and P2Y12) and UTP (P2Y2and P2Y4).

Heteromeric association of P2Y1receptor with P2Y2and

P2Y4receptors in granulocytes

Initially, cross-desensitization among ATP, ADP and UTP was used to investigate the presence of distinct P2 receptors in granulocytes. As expected, ATP abolished

ADP and UTP responses (Fig. 3a, c). However, ADP and UTP also completely abolished ATP responses (Fig. 3b, d). Moreover, ADP and UTP showed full heterologous desensitization (Fig. 3e, f ). These results suggested that ADP and UTP act in the same P2Y receptor, though this found was not observed in any other P2 receptors in mammals.

Additionally, thapsigargin, a Ca2+-ATPase inhibitor, avoided Ca2+ re-uptake into endoplasmatic reticulum, showing that the lack of a second response to ADP and UTP was not due to a deployment of intracellular Ca2+ stores or a technique artifact (Fig. 3g, h). To confirm that the cross-desensitization between ADP and UTP was a specific response, N-formyl-methionine-leucine-phenylalanine (fMLP), another granulocyte-activation related G-protein-coupled agonist, was used. No

cross-Fig. 1 Characterization of P2 responses in mice granulocytes. Granulocytes were loaded with the Ca2+indicator fura-2. The P2X receptors agonists aαβMeATP, b BzATP and c βγMeATP did not induce increases in [Ca2+]cyt. d–f Average increase in [Ca

2+

]cytresponse to these agonists. However

g ATP, h ADP and i UTP were able to induce a transient increase in [Ca2+]cyt; one application of a high agonist concentration promoted

desensitization of the ATP response. j–l Granulocytes were pretreated for 3 h with PTX (0.05 μg/ml) or U73122 (5 μM). ATP and its analogs showed the same sensitivity to Gi-coupled protein inhibitor PTX and PLC inhibitor U73122. These results are the means ± SEM of [Ca

2+

]cytincrease above the resting

desensitization between fMLP with ADP or UTP was observed (Fig. 3i–l). In addition, ATPγS, an analogue of ATP that does not activate P2Y1 or P2Y2/P2Y4

receptors, did not promote cross-desensitization (Fig. 3m, n). ADP and UTP (Fig. 3o–p). To evaluate the participation of P2Y1 receptor, its specific

antagonist MRS2179 was used. MRS2179 was able to abolish the ADP response (Fig. 3q), but not the UTP response (Fig. 3r).

None of the P2 receptors are activated by both ADP and UTP in mammals, except the P2y3 receptor

which was cloned from a chick brain [25] and was activated by one as well as another. Another possibil-ity is that the presence of a new P2Y receptor or association of P2Y1 receptor with other UTP

recep-tors, such as P2Y2 or P2Y4 receptors, could change

their pharmacological characteristics, since homo- and hetero-oligomerization is common for G protein-coupled receptors [7].

To verify whether P2Y1 receptors were associated

with other P2Y receptors, a coimmunoprecipitation assay was performed involving P2Y1, P2Y2 and P2Y4

receptors. P2Y1 receptor was immunoprecipitated

with P2Y2 and P2Y4 antibodies; immunoprecipitation

of P2Y2 and P2Y4 receptors were also reveled with

P2Y1 antibody (Fig. 4a). Additionally, an

immunopre-cipitation assay was performed using fluorescence probes to confirm the presence of both receptors in the same band; P2Y1 and P2Y2 receptor are present

together in the same band with a molecular weight around 50 kDa (Fig. 4b). To corroborate this hypoth-esis of the association of P2Y receptors a FRET assay was employed. Confocal microscopy showed P2Y1/

P2Y2 and P2Y1/P2Y4 receptors colocalization (Fig. 4c

Merge), and FRET signal was obtained when the sample was excited at 488 nm with the argon laser (Donor: Alexa Fluor 488) and emission wavelength was captured at 560–590 nm (Acceptor: Alexa Fluor 546 - emission of P2Y2 or P2Y4 receptor) (Fig. 4c).

Moreover, emission spectra of the samples were mea-sured in a microplate spectrofluorometer. As observed in Fig. 4d the sample labeled with antibodies P2Y1/

P2Y2 and P2Y1/P2Y4 showed a second peak at

575 nm of FRET signal. Quantification of FRET signal is shown in Fig. 4e. Therefore, heteromeric associ-ation between P2Y1 and P2Y2 or P2Y4 receptors also

occurred in the granulocytes. This could explain the changes observed in the classical pharmacology of P2Y receptors in mice granulocytes, where P2Y recep-tors were simultaneously activated by ADP/UTP, but with low affinity.

ATP and analogs are unstable compounds and as high concentrations were used to stimulate granulocytes, it was decided to quantify the presence of degraded products in ATP, ADP and UTP by using liquid chromatography coupled to mass spectrometry. Analytical evaluation detected that the ATP sample (78 %) contains ADP (9.6 %) and adenosine (3.5 %); ADP sample (88 %) contains AMP (8.5 %) and adenosine (3.5 %); and UTP sample (40 %) contains UDP (49 %) and UMP (11 %). However, neither contamination of UTP was detected in ADP sample and ADP was neither detected in the UTP sample.

Fig. 2 Presence of P2Y receptors in bone marrow granulocytes. a Granulocytes expressed mRNA for P2Y1, P2Y2, P2Y4and P2Y12

receptors. Ladder 100-bp marker [M]; heart [H]; brain [B]; platelets [P]; granulocytes [G]. b To analyze the expression at the protein level of P2Y receptors in Gr-1+Mac-1+population (dot plot) flow cytometry was used. Solid black histogram: negative control (preincubated with the peptide antigen); open histogram: cells labeled with the respective antibodies

Heteromeric association may occur in mice myelocytic progenitors

The effects of ADP and UTP on [Ca2+]cyt increase in

long-term bone marrow cultures containing myelocytic progenitors were also analyzed. In these cultures, all hematopoietic cells (smaller cells with circular shape) were responsive to ATP, ADP and UTP showing the same heterologous response observed in granulocytes (Fig. 5). Heterologous desensitization was also observed

in many stromal cells (large cells with variable shapes) of hematopoietic origin.

Discussion

The response exhibited by mice bone marrow granulo-cytes during characterization of P2 receptors is unique among mammalian P2 receptors. The avian P2y3 recep-tor [25], ortholog of the mammalian P2Y6receptor [26],

is the only known receptor activated by ADP and UTP.

Fig. 3 Cross-desensitization among ATP, ADP and UTP in mice granulocytes. Granulocytes were loaded with the Ca2+indicator fura-2. a–d Addition of ATP fully inhibited responses to ADP and UTP and vice-versa. e, f ADP and UTP showed full heterologous desensitization. g, h Thapsigargin, a Ca2+-ATPase inhibitor, which releases Ca2+from intracellular stores, showed that the lack of a second response was not due to emptying of intracellular Ca2+stores. i–l fMLP, another G-protein-coupled agonist, showed the specificity of cross-desensitization between ADP and UTP. m, n ATPγS did not promote heterologous desensitization to ADP and UTP response. o, p Lower concentration of ADP and UTP reduced responses to ADP and UTP. q, r MRS2179, a specific antagonist of the P2Y1receptor, inhibited responses to ADP but not to UTP.

The presence of a new receptor with distinct pharmacological characteristics in granulocytes seems to be unlikely. Therefore, we have presented another possibility: the presence of direct or indirect hetero-meric association among P2Y receptors. Among P2Y receptors, ADP- (P2Y1) and UTP-activated (P2Y2 and

P2Y4) receptors were the most likely candidates. As

observed in Fig. 4, coimmunoprecipitation and FRET assays revealed heteromeric association of P2Y1-P2Y2

and P2Y1-P2Y4 receptors. However, no association

between P2Y2 and P2Y4 receptors was observed

(Fig. 4a). Heteromeric associations involving P2Y1

-P2Y2 and P2Y1-P2Y4 receptors could account for the

unexpected pharmacology characteristic observed in P2Y receptors in granulocytes.

Heterodimerization involving P2X receptors is already known; the receptor heterodimers P2X2–3, P2X2–6,

P2X4–6 and P2X1–5have been characterized extensively.

Heteromeric association between P2Y receptors has also been observed in transfected systems, but it has never been reported that this phenomenon occurs in primary cells. Yoshioka et al. [3] observed heteromeric associ-ation involving P2Y1 and A1 receptors after receptor

transfection of human embryonic kidney (HEK293T) lineage cells. Ecke et al. [4], also working with trans-fected HEK293 cells, described the first

hetero-Fig. 4 Heteromeric association among P2Y receptors. a Immunoprecipitation (IP) of cell lysates visualized by western blot (WB) analyses. a Immunoprecipitated receptors P2Y2and P2Y4were visualized with an anti-P2Y1 antibody. P2Y1receptors immunoprecipitated by the

same antibody were used as positive controls. Additionally, immunoprecipitated receptor P2Y1 was seen with either anti-P2Y2or anti-P2Y4

antibodies. Unspecific immunoprecipitates of rabbit normal serum were used as negative controls (NC). b Immunopreciptation with infrared fluorescent secondary antibody: P2Y1receptors were immunopreciptated with goat antibodies. After SDS-PAGE the transferred proteins were revealed with rabbit

antibodies and analyzed with donkey anti-rabbit antibodies to different fluorophores. First for P2Y1(red), and after membrane stripping for P2Y2(green).

The whole protein lysate (WP) was used as a control. c Confocal images show the colocalization of P2Y1receptor with P2Y2or P2Y4receptor. FRET signal

evidence that these receptors are spatially close. d To corroborate confocal images, emission spectra of samples are shown (Ex. 488). e Analysis of FRET ratios were calculated as explained in the Methods section

oligomerization among P2Y (P2Y1and P2Y11) receptors.

Additionally, homodimeric and oligomer complexes formed by P2Y2, P2Y4and P2Y12receptors may be

typ-ical for these receptors [5–7]. Among P2Y receptors, P2Y4and P2Y6receptors have a secondary structure that

makes them likely to associate with other P2Y receptors [7]. The present results support the hypothesis that het-eromeric association among P2Y receptors is common in bone marrow granulocytes.

Purinergic agonist affinity was low in granulocytes. In some hematopoietic lineages (e.g., erythroid and myeloid lineages), purinergic agonist affinity for P2Y receptor has been found to be lower than in other cell types [17, 18, 22–24, 27]. Homo- and hetero-association between receptors could also have chan-ged G-protein selectivity and agonist efficiency.

The fast degradation of ATP and analogs may be related to the low activity observed by these agonists. However, as no traces of UTP were detected in the sample of ADP, or ADP in the sample of UTP, desensitization by contamination was excluded.

Usually, P2Y1, P2Y2, P2Y4 and P2Y6 receptors are

associated with Gq/11 proteins, whereas P2Y11, P2Y12,

P2Y13 and P2Y14 receptors are associated with Gi

pro-teins. Murthy & Makhlouf [26] showed the complexity of P2Y receptor signaling in smooth muscle cells, where activation of P2Y2 receptors triggered both PLCβ1 via

Gα11and PLCβ3 via Gβγi3. The occurrence of homo- and

hetero-association involving P2Y receptors would create more opportunities for intracellular pathways associated with these receptors. It is also necessary to account for raft microdomains on the cellular membrane. Together with the cytoplasm, these microdomains can create dis-tinct intracellular pathways, thus explaining how similar intracellular signaling systems can trigger different ef-fects. This is supported by reports showing the presence of P2Y homo-oligomers and homo-dimers in lipid raft fractions [6, 7].

The presence of P2Y receptors in hematopoietic cells supports the assertion that these receptors are involved in proliferation and differentiation. The effect of ATP has been studied in human myelocytic lineage HL-60,

Fig. 5 Heterologous desensitization between ADP and UTP also occurs in hematopoietic progenitor cells. Cells were loaded with the Ca2+_indicator

fluo-4, and intensity was measured with confocal microscopy (LSM 510 META). Scale bar = 20μM. The images are a pseudocolored representation in reference to the fluorescence intensity scale (0 = black, 255 = white). a Images in two Z planes showed cell preparations before agonist addition (basal) and after stimulation (max) with 1 mM of ADP and UTP. b Records of fluorescence intensity as a function of time corresponded to images of hematopoietic and stromal cells in a, and represented responses of four independent experiments

which expresses P2Y2 receptors. Differentiation of

HL-60 cells to granulocytes did not alter P2Y2 receptor

expression. However, differentiation into monocytes/ macrophages decreased P2Y2 receptor expression [28].

Adrian et al. [29] showed alteration of expression of P2 receptors during granulocytic and monocytic differenti-ation of HL-60 cells. Heterologous desensitizdifferenti-ation with ADP and UTP was also observed on cobblestone areas in long-term bone marrow cultures (Fig. 5), suggesting that hetero-association may be present in primitive cells. Recently, the participation of P2 receptors in differentiation into myelocytes has been confirmed in hematopoietic stem cells [17, 22, 24]. Hetero-association among P2Y receptors would be a characteristic of the myelocytic lineage in mice.

Conclusion

The results of the present study demonstrate that granulocytes express P2Y1, P2Y2and P2Y4receptor, and

heteromeric association between P2Y1/P2Y2 and P2Y1/

P2Y4occur.

Acknowledgments

This work was supported by INFAR/UNIFESP Confocal and Flow Cytometry Facility, "Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)", "Conselho Nacional de Desenvolvimento Científico e Tecnológico" (CNPq) and“Fundação de Amparo à Pesquisa do Estado de São Paulo” (FAPESP Grant number: 2013/09068-7 and 2015/16799-3 to E. J. P-G). We thank Prof. Ed A. Yates for English editorial assistance.

Availability of data and materials

All data supporting the findings is contained within the manuscript. Authors_{’ contributions}

ACRF and EJPG participated in the data collection, data analysis, and preparation of the paper draft. MVB and AM participate in quantification of purines. RCB and JBP participates in RT-PCR. CCB, JLD and GZJ participates in immunoprecipitation and western blotting assays. ATF, AM, HBN and EJPG played a principal role in the design, analysis, and preparation of the manuscript. All authors reviewed and appraised the manuscript. All authors read and approved the final manuscript. Competing interests

The authors declare that they have no competing interests. Author details

1_{Centro Interdisciplinar de Investigação Bioquı́mica, Universidade de Mogi}

das Cruzes, Av. Dr Cândido Xavier de Almeida Souza, 200, Mogi das Cruzes, São Paulo, Brazil.2Departamento de Bioquímica, Universidade Federal de São Paulo, Rua Pedro de Toledo, 669 - 9° andar - Prédio de Pesquisa II, R. Três de Maio 100, São Paulo, São Paulo, Brazil.3_{Departamento de Nutrição,}

Universidade Federal de Pelotas, R. Gomes Carneiro, n°1, 96010-610 Pelotas, Rio Grande do Sul, Brazil.4Departamento de Biofísica, Universidade Federal de São Paulo, R. Botucatu 862, São Paulo, São Paulo, Brazil.

Received: 17 August 2015 Accepted: 24 June 2016 References

1. Abbracchio MP, Burnstock G, Boeynaems JM, Barnard EA, Boyer JL, Kennedy C, Knight GE, Fumagalli M, Gachet C, Jacobson KA, Weisman GA. International Union of Pharmacology LVIII: update on the P2Y G protein-coupled nucleotide receptors: from molecular mechanisms and pathophysiology to therapy. Pharmacol Rev. 2006;58(3):281–341.

2. Saul A, Hausmann R, Kless A, Nicke A. Heteromeric assembly of P2X subunits. Front Cell Neurosci. 2013;7:250.

3. Yoshioka K, Saitoh O, Nakata H. Heteromeric association creates a P2Y-like adenosine receptor. Proc Natl Acad Sci U S A. 2001;98(13):7617_–22. 4. Ecke D, Hanck T, Tulapurkar ME, Schafer R, Kassack M, Stricker R, Reiser G.

Hetero-oligomerization of the P2Y11 receptor with the P2Y1 receptor controls the internalization and ligand selectivity of the P2Y11 receptor. Biochem J. 2008;409(1):107–16.

5. Kotevic I, Kirschner KM, Porzig H, Baltensperger K. Constitutive interaction of the P2Y2 receptor with the hematopoietic cell-specific G protein G(alpha16) and evidence for receptor oligomers. Cell Signal. 2005;17(7):869_–80.

6. Savi P, Zachayus JL, Delesque-Touchard N, Labouret C, Herve C, Uzabiaga MF, Pereillo JM, Culouscou JM, Bono F, Ferrara P, Herbert JM. The active metabolite of Clopidogrel disrupts P2Y12 receptor oligomers and partitions them out of lipid rafts. Proc Natl Acad Sci U S A. 2006;103(29):11069–74.

7. D'Ambrosi N, Iafrate M, Saba E, Rosa P, Volonte C. Comparative analysis of P2Y4 and P2Y6 receptor architecture in native and transfected neuronal systems. Biochim Biophys Acta. 2007;1768(6):1592–9.

8. Communi D, Motte S, Boeynaems JM, Pirotton S. Pharmacological characterization of the human P2Y4 receptor. Eur J Pharmacol. 1996;317(2–3):383–9.

9. Communi D, Gonzalez NS, Detheux M, Brezillon S, Lannoy V, Parmentier M, Boeynaems JM. Identification of a novel human ADP receptor coupled to G(i). J Biol Chem. 2001;276(44):41479–85.

10. Marteau F, Le Poul E, Communi D, Communi D, Labouret C, Savi P, Boeynaems JM, Gonzalez NS. Pharmacological characterization of the human P2Y13 receptor. Mol Pharmacol. 2003;64(1):104–12.

11. Erb L, Lustig KD, Sullivan DM, Turner JT, Weisman GA. Functional expression and photoaffinity labeling of a cloned P2U purinergic receptor. Proc Natl Acad Sci U S A. 1993;90(22):10449–53.

12. Communi D, Govaerts C, Parmentier M, Boeynaems JM. Cloning of a human purinergic P2Y receptor coupled to phospholipase C and adenylyl cyclase. J Biol Chem. 1997;272(51):31969–73.

13. Buell G, Michel AD, Lewis C, Collo G, Humphrey PP, Surprenant A. P2X1 receptor activation in HL60 cells. Blood. 1996;87(7):2659–64.

14. Clifford EE, Parker K, Humphreys BD, Kertesy SB, Dubyak GR. The P2X1 receptor, an adenosine triphosphate-gated cation channel, is expressed in human platelets but not in human blood leukocytes. Blood. 1998;91(9):3172_–81.

15. Paredes-Gamero EJ, Franca JP, Moraes AA, Aguilar MO, Oshiro ME, Ferreira AT. Problems caused by high concentration of ATP on activation of the P2X7 receptor in bone marrow cells loaded with the Ca2+ fluorophore fura-2. J Fluoresc. 2004;14(6):711–22.

16. Grynkiewicz G, Poenie M, Tsien RY. A new generation of Ca2+ indicators with greatly improved fluorescence properties. J Biol Chem.

1985;260(6):3440–50.

17. Paredes-Gamero EJ, Leon CMMP, Borojevic R, Oshiro MEM, Ferreira AT. Changes in Intracellular Ca2+ Levels Induced by Cytokines and P2 Agonists Differentially Modulate Proliferation or Commitment with Macrophage Differentiation in Murine Hematopoietic Cells. J Biol Chem.

2008;283(46):31909–19.

18. Paredes-Gamero EJ, Craveiro RB, Pesquero JB, Franca JP, Oshiro ME, Ferreira AT. Activation of P2Y1 receptor triggers two calcium signaling pathways in bone marrow erythroblasts. Eur J Pharmacol. 2006;534(1–3):30–8.

19. Laemmli UK. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature. 1970;227(5259):680_–5.

20. Paredes-Gamero EJ, Medeiros VP, Farias EH, Justo GZ, Trindade ES, Andrade-Lopes AL, Godinho RO, de Miranda A, Ferreira AT, Tersariol IL, Nader HB. Heparin induces rat aorta relaxation via integrin-dependent activation of muscarinic M3 receptors. Hypertension. 2010;56(4):713–21.

21. Ballantine JA, Games DE, Slater PS. The enhancement of polyphosphonate salt electrospray mass spectrometry and the high-performance liquid chromatographic separation of triphosphate esters by diethylamine treatment. Rapid Commun Mass Spectrom. 1997;11(6):624–9.

22. Barbosa CM, Leon CM, Nogueira-Pedro A, Wasinsk F, Araujo RC, Miranda A, Ferreira AT, Paredes-Gamero EJ. Differentiation of hematopoietic stem cell and myeloid populations by ATP is modulated by cytokines. Cell Death Dis. 2011;2, e165.

23. Dichmann S, Idzko M, Zimpfer U, Hofmann C, Ferrari D, Luttmann W, Virchow C Jr, Di Virgilio F, Norgauer J. Adenosine triphosphate-induced oxygen radical production and CD11b up-regulation: Ca(++) mobilization and actin reorganization in human eosinophils. Blood. 2000;95(3):973–8.

24. Lemoli RM, Ferrari D, Fogli M, Rossi L, Pizzirani C, Forchap S, Chiozzi P, Vaselli D, Bertolini F, Foutz T, Aluigi M, Baccarani M, Di Virgilio F. Extracellular nucleotides are potent stimulators of human hematopoietic stem cells in vitro and in vivo. Blood. 2004;104(6):1662–70.

25. Webb TE, Henderson D, King BF, Wang S, Simon J, Bateson AN, Burnstock G, Barnard EA. A novel G protein-coupled P2 purinoceptor (P2Y3) activated preferentially by nucleoside diphosphates. Mol Pharmacol. 1996;50(2):258–65. 26. Murthy KS, Makhlouf GM. Coexpression of ligand-gated P2X and G

protein-coupled P2Y receptors in smooth muscle. Preferential activation of P2Y receptors coupled to phospholipase C (PLC)-beta1 via Galphaq/11 and to PLC-beta3 via Gbetagammai3. J Biol Chem. 1998;273(8):4695–704. 27. Idzko M, Dichmann S, Panther E, Ferrari D, Herouy Y, Virchow Jr C, Luttmann W,

Di Virgilio F, Norgauer J. Functional characterization of P2Y and P2X receptors in human eosinophils. J Cell Physiol. 2001;188(3):329_–36.

28. Clifford EE, Martin KA, Dalal P, Thomas R, Dubyak GR. Stage-specific expression of P2Y receptors, ecto-apyrase, and ecto-5'-nucleotidase in myeloid leukocytes. Am J Physiol. 1997;273(3 Pt 1):C973–87.

29. Adrian K, Bernhard MK, Breitinger HG, Ogilvie A. Expression of purinergic receptors (ionotropic P2X1-7 and metabotropic P2Y1-11) during myeloid differentiation of HL60 cells. Biochim Biophys Acta. 2000;1492(1):127–38.

• We accept pre-submission inquiries

• Our selector tool helps you to find the most relevant journal

• We provide round the clock customer support

• Convenient online submission

• Thorough peer review

• Inclusion in PubMed and all major indexing services

• Maximum visibility for your research Submit your manuscript at

www.biomedcentral.com/submit

Submit your next manuscript to BioMed Central

and we will help you at every step: