• Nenhum resultado encontrado

Linking the embryonic clock with temporal collinearity of Hox gene activation

N/A
N/A
Protected

Academic year: 2019

Share "Linking the embryonic clock with temporal collinearity of Hox gene activation"

Copied!
84
0
0

Texto

(1)Catarina Sofia Rodrigues Fernandes. Linking the embryonic clock with temporal collinearity of Hox gene activation. LISBOA 2010.

(2) UNIVERSIDADE NOVA DE LISBOA FACULDADE DE CIÊNCIAS E TECNOLOGIA DEPARTAMENTO DE CIÊNCIAS DA VIDA. Catarina Sofia Rodrigues Fernandes. Linking the embryonic clock with temporal collinearity of Hox gene activation. Dissertação apresentada para a obtenção do Grau de Mestre em Genética Molecular e Biomedicina, pela Universidade Nova de Lisboa, Faculdade de Ciências e Tecnologia. Orientadora: Profª. Doutora Isabel Palmeirim (FCT/UAL) Co-orientadora: Doutora Raquel Andrade(ECS/UM). LISBOA 2010.

(3) nº de arquivo “Copyright”.

(4) UNIVERSIDADE NOVA DE LISBOA FACULDADE DE CIÊNCIAS E TECNOLOGIA DEPARTAMENTO DE CIÊNCIAS DA VIDA. Catarina Sofia Rodrigues Fernandes. Linking the embryonic clock with temporal collinearity of Hox gene activation. Dissertação apresentada para a obtenção do Grau de Mestre em Genética Molecular e Biomedicina, pela Universidade Nova de Lisboa, Faculdade de Ciências e Tecnologia. Orientadora: Profª. Doutora Isabel Palmeirim (FCT/UAL) Co-orientadora: Doutora Raquel Andrade (ECS/UM). LISBOA 2010.

(5) I.. ACKNOWLEDGMENTS. There are many people that helped me in this journey throughout my MSc that I wish to thank.. Firstly, to my supervisor, Prof. Isabel Palmeirim, who has given me the opportunity to work in her laboratory and to be part of her new project. I thank you for your transmission of knowledge, life experience and advices at the right moments.. To my second supervisor, Raquel Andrade, for bringing me in and making me feel at home from the beginning. For her helpful knowledge, inner strength, trust and friendship throughout the year.. To Mónica Ferreira for the teachings of the strenuous electroporation methodology.. To Manuela Carneiro for the patience and sympathy shown in face of so many pieces of paper to autoclave.. To Margaret Soares for encouraging me to find the strength to not give up, and for the availability shown on helping me during the optimization process.. To all my colleagues in the lab, Lisa Gonçalves, Cláudia Marques, Tomás Azevedo and Nuno Granadeiro, for all the support, mutual aid and companionship.. To Ivette Pacheco, Ana Luísa Santos, Cláudia Tavares, Ana Carolina Araújo, Nídia Cunha, Maurícia Vinhas, Paula Félix, Patrícia Dias, André Mozes, João Furtado and Nuno Amaral for all the good times shared during the thesis, helping overcome the daily stress.. To my Salsa Teacher Beatriz Alberteli and my friends Francesca Negro and José Carlos Pinto, for reminding me that there are other pleasures in life parallel with research, but supporting me always in what was more important to me.. I.

(6) To Doctor Alexandra Leonardo and Doctor Olívia Robusto for helping maintain a personal conscience and healthy intellectual structure for performing well my work.. To Professor Catarina Dias, Professor Teresa Chaveca, Professor Heloísa Santos and Professor Carolino Monteiro for their strength and encouragement in accomplishing this thesis that means so much to me.. To my friend Raquel Cabaços for being always there in the good and bad moments, despite the physical distance that separates us.. To Professor José Bragança for his permanent knowledge, support, confidence, patience and above all his friendship.. To my father for always being there, helping with the papers and treatment of the embryo images.. I would like to say thanks to all my family for their support, concern and help. It would be pretty hard without them.. II.

(7) II.. ABSTRACT Somitogenesis is a crucial process in vertebrate embryo development, whereby. mesodermal-derived structures, called somites, are repeatedly formed along the anteriorposterior (AP) body axis. A molecular clock, first evidenced by cyclic expression of the hairy1 gene, sets the pace of somite formation. Although somites are morphologically identical, they are actually molecularly different. The identity of each embryonic segment is determined by combinatorial expression of hox genes. Previous studies showed that Hairy1 protein interacts with the mesodermal identity protein Brachyury, which is also required for hox gene activation. To assess if the embryonic clock is timing hox gene activation, hairy1 and brachyury were cloned into an expression vector containing a fluorescent reporter gene. The resulting plasmids were subsequently electroporated in chick embryos at stage 3HH-4HH and the embryos incubated for further development. Phenotype analysis of electroporated embryos suggests that over-expression of either hairy1 or Brachyury genes delays or even prevents somite formation, to approximately the same extent. Furthermore, when the C-terminal domain of Hairy1, capable of interacting with Brachyury, was over-expressed, a dosedependent phenotype was obtained, suggesting that it resulted from Brachyury protein titration. These results strongly suggest that cyclic Hairy1 - Brachyury dimer formation is required for somite segmentation.. Keywords: Hairy1, Brachyury, electroporation, molecular clock.. III.

(8) III. SUMÁRIO No desenvolvimento embrionário existem várias fases importantes, sendo a somitogénese uma delas. Nesta etapa, o embrião forma periodicamente estruturas metaméricas designadas sómitos que se vão posicionando aos pares ao longo do eixo anteriorposterior (AP) do embrião, flanqueando o tubo neural. Um relógio molecular, primeiramente descrito pela expressão cíclica do gene hairy1, vai marcando o ritmo da formação dos sómitos. Apesar de parecerem morfologicamente idênticos, os sómitos são molecularmente bem diferentes. Esta identidade espacial ao longo do eixo AP do embrião é dada pela expressão conjunta de diferentes genes Hox. Estudos prévios demonstraram que a proteína Hairy1 interage com o marcador de mesoderme Brachyury, que é essencial para a expressão dos gene Hox. Para esclarecer se o relógio embrionário controla temporalmente a expressão dos genes Hox, hairy1 e brachyury foram sobre-expressos em embriões de galinha do estadio 3-4 HH usando a técnica de electroporação. A análise morfológica destes embriões sugere que a sobre-expressão de hairy1 ou de brachyury atrasa ou até previne a formação de sómitos, de forma semelhante. Aquando da sobre-expressão da porção C-terminal de Hairy1, capaz de interagir com Brachyury, observou-se um fenótipo intermédio e dependente da dose, o que sugere um efeito de titulação de Brachyury. No conjunto, os resultados obtidos suportam a hipótese de que o dímero Hairy1-Bachyury é necessário para a segmentação somítica.. IV.

(9) CONTENTS I.. ACKNOWLEDGMENTS .................................................................................................. I. II.. ABSTRACT ..................................................................................................................... III. III. SUMÁRIO ........................................................................................................................IV 1.. INTRODUCTION .............................................................................................................. 1 1.1.. General considerations on Development Biology .............................................................. 2. 1.3.. The Somitogenesis clock ............................................................................................................... 8. 1.2.. 1.4. 1.5.. 1.6.. Chick Embryogenesis ..................................................................................................................... 2. Hox genes in embryonic development .................................................................................. 11. Brachyury .......................................................................................................................................... 15 Manipulating gene expression levels in the chick embryo: Electroporation and. Explant culture ............................................................................................................................................. 16 2.. 1.7.. Aims of this study ........................................................................................................................... 17. 2.1.. pCAT..................................................................................................................................................... 20. MATERIALS AND METHODS ..................................................................................... 19 2.1.1.. Plasmids construction ......................................................................................................... 20. 2.1.3.. pCAT + Hairy1......................................................................................................................... 21. 2.1.2.. 2.1.4.. pCAT + c‐Term ........................................................................................................................ 20 pCAT + Brachyury ................................................................................................................. 22. 2.2.. Embryos and staging .................................................................................................................... 23. 2.4.. Electroporation of chick embryo tissues ............................................................................. 24. 2.3.. Embryo explant culture ............................................................................................................... 23. 2.4.1.. Embryo dissection and storage ....................................................................................... 26. 2.5.1.. Synthesis and purification of antisense RNA probes ............................................. 26. 2.5.3.. Embryo pre‐treatments and Hybridization ............................................................... 27. 2.5.. Whole‐mount In situ hybridization ........................................................................................ 26. 2.5.2.. 2.5.4.. 2.5.5.. 2.6.. Embryo fixation...................................................................................................................... 27 Antibody incubation............................................................................................................. 27 Post‐antibody washes and histochemistry ................................................................ 28. Image acquisition ........................................................................................................................... 28. V.

(10) 3.. RESULTS ......................................................................................................................... 29 3.1.. Plasmid construction for embryo electroporation .......................................................... 30. 3.1.1.. pCAT ............................................................................................................................................ 30. 3.1.3.. pCAT + Hairy1......................................................................................................................... 33. 3.1.2.. 3.1.4.. 3.2.. pCAT + Brachyury ................................................................................................................. 35. Electroporation ............................................................................................................................... 37. 3.2.1.. Optimization of chick electroporation conditions .................................................. 37. 3.2.3.. Effect of the local of injection in the over‐expression pattern........................... 40. 3.2.2.. 3.2.4.. 3.2.5. 3.2.6.. 4.. pCAT + c‐Term ........................................................................................................................ 32. 3.2.7.. Confirmation of plasmid‐driven gene over‐expression........................................ 38 Distribution of the electroporated embryos ............................................................. 43 Hairy1 over‐expression phenotype............................................................................... 43. Brachyury over‐expression phenotype ....................................................................... 44 c‐Term over‐expression phenotype .............................................................................. 45. DISCUSSION................................................................................................................... 49. 4.1.. 4.2.. Prospective‐PSM is located in the anterior third of the primitive streak .............. 50 Electroporation drives to a “salt‐and‐pepper” pattern of Hairy1/Brachyury. over‐expression ........................................................................................................................................... 50 4.3.. Both Hairy1 and Brachyury over‐expression in PSM cells perturbs somite. 4.4.. c‐Term over‐expression leads to a mild, dose‐dependent somitic phenotype ... 52. formation ........................................................................................................................................................ 51 5. 6.. 4.5.. Conclusions and future perspectives..................................................................................... 52. REFERENCES ................................................................................................................. 53 APPENDIX ...................................................................................................................... 59. VI.

(11) 1. INTRODUCTION.

(12) INTRODUTION. 1.1.. General considerations on Development Biology For centuries Man has been interested in the study of the process by which living. beings grow and develop - Developmental Biology – especially from fertilization until birth Embryogenesis. A wider knowledge of the embryonic development may allow us to intervene in medically assisted reproduction, to avoid or to prevent some malformations, scan diagnoses and apply multiple therapeutic solutions. Developmental biology studies employ the use of animal models which allow the use of their embryos without raising the ethical questions underlying the use of human embryos. Among the most utilized animals are the invertebrates: Sea urchin (Strongylocentrotus purpuratus), Roundworm (Caenorhabditis elegans), Fruit fly (Drosophila melanogaster); and the vertebrates: Zebrafish (Danio rerio), Frog (Xenopus laevis, Xenopus tropicalis), Mouse (Mus musculus) and Chicken (Gallus gallus). Their comparison is possible because, in the early stages of development, all embryos present comparable morphology, and the physiological and genetic processes are conserved between species. The chicken as a model has important advantages, including having a rapid development (21 days total), being accessible throughout the year and in the desired amount, it can be incubated to develop when it is convenient, it is sufficiently transparent and the embryo is sufficiently large to be observed, embryonic development allows external manipulation of the embryo itself by simply opening the egg shell and re-closing it to allow further post-manipulation development, it possesses an embryonic development similar to the Human, both at cellular and molecular level, it is cheap and its development is well described and classified in various stages (the most widely used is Hamburger & Hamilton (HH) (Hamburger andHamilton, 1951 – Appendix 1).. 1.2.. Chick Embryogenesis Embryogenesis begins with the fertilization of the egg by sperm to create a new. individual with genetic material derived from both progenitors. The zygote suffers a cytoplasmic arrangement with rapid mitotic divisions producing numerous smaller cells, called blastomeres. This process is called cleavage and leads to the development of a. 2.

(13) INTRODUTIO ON. multiicellular orgganism - morula. m At thhe end of th his stage, th hat ball of ccells becom mes hollow,, with a single layyer of cells – blastodeerm – surrou unding the internal cavvity – blasto ocoel – andd it is now calledd blastula. Depending D oon the amo ount and disstribution oof yolk in th he egg, thee cleavvage can bee holoblasticc (the cleavvage extend ds in the enttire egg – m mammals, amphibians, a , nemaatodes) or meroblastic m (the cleavaage is only in i a portion n of the eggg – fish, rep ptiles, birds,, inseccts) (Gilbertt, 2006). In the chhick, cleavaage occurs oonly in the blastodisc, b a small discc of cytoplasm 2-3 mm m in diaameter at thhe top of a large yolk (G Gilbert, 200 06). The blaastoderm is iinitially a unique u layerr of ceells. After this, it is cleaved intto a tissue five to six x cell layerrs thick. Between thee blasttoderm and the yolk is a space callled the sub bgerminal caavity (Gilbeert, 2006). The T cells inn the ccenter of thee blastoderm m die, remaaining only one layer of o cells: areea pellucidaa (Fig. 1-1),, that iis the most important part p of the eembryo. Surrrounding the referred layer, theree is a groupp of ceells in the form f of a ring that havve not lost their t deep cells c form th the area opaaca (yellow w layerr in Fig.1-1)) (Gilbert, 2006). 2 Very close to thee acellular vitelline v meembrane thaat surroundss the yyolk (“dorsaal” side), iss a simple, oone-cell-thiick epitheliu um that is ccontinuous throughoutt area opaca and area a pellucida – epiblasst (grey layeer in Fig. 1--1) (Stern ett al., 2004).. Other areaa pelluucida cells have h delam minated andd moved ind dividually into i the subbgerminal cavity, c thuss form ming the pollyinvagination islands (primary hypoblast), h a group off islands of separatedd clustters that hold 5 to 20 ceells each (Fiig. 1-1 and Fig. F 1-2) (G Gilbert, 20066).. Fig. 11-1 – Lateral view of an em mbryo formin ng the hypob blast layer fro om the epiblaast (adapted from f Gilbert, 2006).. Betweenn the area op paca and thee area pellu ucida a layerr called marrginal zone (see Fig. 1-1) is formed, whhich is very y important tto determin ne the cells’ fate and too establish th he anterior-posteerior (AP) axis a of the embryo. e Thee boundary between th he area pelluucida and th he marginall zone is marked by a cresccent-shaped ridge of sm mall cells, tightly t adheerent to thee epiblast – ( cells in n Fig1-2). T Together, theese compon nents definee a blastoderm of stagee Kolleer’s sickle (red. 3.

(14) INTRODUTIO ON. X (R Roman num merals from m I to XIV V are used to classify stages beffore formattion of thee prim mitive streakk according to Eyal-G Giladi and Kochav K – 1976) that rrepresents the t embryoo whenn the egg is laid (Stern et al., 20044).. Fiigure 1-2 - Reepresentative scheme of prrimitive strea ak formation. Representattive scheme of o chicken embrryo developm ment since sta age X until staage 3+HH, seen from 3 diffferent perspeectives. The formation f of thee primitive sttreak is show wn in detail, w where A repreesents the antterior part off the embryo and P the posterior partt of the embry yo (from Sterrn, 2004).. The embbryonic dissk becomes oval in a process caalled gastruulation, wh hen cellularr w positionss and new neighbors, n and a the mulltilayered bo ody plan off moveements givee rise to new the oorganism is established d. The islandds of hypoblast graduallly fuse togeether from posterior p too anterrior to geneerate a contiinuous but rrelatively lo oose layer, the hypoblaast proper (green ( layerr at st. XII in Fig. 1-2). This layer coverrs half of thee area pellucida at stage ge XII and almost all off it at stage XIII (Stern et al., a 2004). S Shortly afteer, the hypo oblast is dissplaced antteriorly andd form ms the endobblast (or secondary hyypoblast) (brown layer atst.XIII inn Fig. 1-2). The spacee betw ween the epiblast and hypoblast iis called bllastocoel. After A this, eendodermal precursorss ingreess from thee epiblast in nto the blasttocoel and other o cells migrate m from m the lateraal region off. 4.

(15) INTRODUTIO ON. the pposterior eppiblast to th he center apppearing a posterior thickening t ((the posteriior bridge),, appaarently derivved from Koller’s K sickkle. This transient stru ucture definnes stage XIV X and thee prim mitive streak starts to fo orm immediiately thereaafter (Stern et al., 20044). The streaak forms ass an acccumulationn of these ceells in the pposterior polle of the em mbryo and exxtends subssequently inn anterrior directioon defining the axis off the embry yo. The cellls migrate through the embryo’ss dorsaal side andd move to the t ventral side (Fig. 1-3). After the mid-sstreak (3HH H) stage, a depreession form ms within the t streak - primitivee groove - and starts the migrattion of thee meseenchyme off the streak to t establish the lateral plate (3+HH H) with the tree layers: endoderm,, mesooderm and ectoderm (Stern et al ., 2004). Each layer has h distinctiive characteeristics andd givess rise to certtain tissues of the bodyy: the ectoderm gives rise to epideermis structu ures, neurall crestt and neurall tissues, which w give rrise to the nervous n sysstem; the m mesoderm gives rise too somiites, notochord, blood and a blood vvessels, bon ne and conn nective tissuue; the endo oderm givess rise tto epitheliuum of the diigestive sysstem and respiratory sy ystem and oorgans asso ociated withh the ddigestive sysstem, such as a the liver and pancreaas (Gilbert, 2006).. Figu ure 1-3 - Scheematic diagra am of the Gasstrulation in birds. b Gastru ulation in chiccken embryo o with crosssecction (stage 4H HH) showing g the cellular movements when w the threee germ layerrs are formed d (adapted froom Purves et al., 2004).. 5.

(16) INTRODUTIO ON. The anteerior end off the streak bbroadens to o form the Hensen's H nodde, a structu ure roughlyy equivvalent to thhe organizerr of xenopuus embryos and the shiield of zebrrafish, and defines thee 4HH H with full extension e of primitive streak. Thiis is the lastt phase of tthe “gastrulla stage” inn aviann embryos (Stern et al., 2004). A Along the primitive p streak in thiss stage, thee cells’ fatee variees depending on their position p alonng the AP axis. a That faate map of tthe epiblast cells alongg the A AP axis latteral to thee primitive streak wass described by Stern iin 1996, reeviewed byy Solnica‐Krezel in 2005 an nd more caarefully chaaracterized by b Iimura aand Pourquiié, in 2006. t anteriorr primitive streak s (90% % The aanterior-moost epiblast that lies adjjacent to thee node and the. levell) essentiallyy gives risee to neural aand ectodermal derivattives. More posteriorly y, extendingg from m the 90–600% level of o the prim mitive streak k, a territorry essentiallly containeed paraxiall mesooderm precuursors is fou und. Posteriior to this teerritory, thee epiblast coontributes to o the laterall platee and extraem mbryonic mesoderm m (IIimura and Pourquié, 2006). 2. F Fig. 1-4 – Scheematic representation of tthe fate map cells in the prrimitive streaak. Neural ceells at the anterior top p of the primitive streak, ssomite precursors at the third anteriorrof the embry yo and extraaembryonic tiissue at the p posterior partt (Adapted from Solnica-K Krezel 2005).. Shortly afterward, a the t Hensenn’s node staarts to regreess posteriorrly and leav ve a rod off conddensed mesooderm anterriorly - the notochord or head process (Sternn et al., 20 004). At thee samee time, the future f neuraal plate starrts to becom me morpholo ogically andd molecularrly distinct,, with the beginnning of the “neurula “ staage” (5HH)). At 6HH, a definite ffold of the blastoderm m anterrior to the notochord n marks m the annterior end of the embryo. These structures can c be seenn in diffferent stages in Fig.1-5.. 6.

(17) INTRODUTIO ON. Phaaryngeal en ndoderm Head proocess (anteriior notochord) Hensen’s node n Primitive streak Area pellu ucida Area opaaca. A st. 5 HH. Head fold. B st. 6 HH H. Foregu ut oove Neural Gro Somitee PSM C st.. 8‐ HH H. Hensen’s node n Primitive streak. D st.. 8+. HH H. Figurre 1-5 Embryyos structuress at different stages. Illusttration of the several morpphological features of the ch hicken’s emb bryos at differrent stages: A – stage 5HH H, B – stage 6HH, 6 C – stagge 8-HH, D – stage 8+.. Neurulaation in vertebrates ressults in the formation of o the neuraal tube from m the neurall platee, which givves rise to both the spinnal cord and d the brain. Before longg after the neural n platee has bbeen formedd, its limitss get thick aand travel upward u to form f the neeural folds, as a neurall groovve shaped as a a U appeears in the m middle of th he plate, in-between thhe future rig ght and leftt sidess of the embbryo (Gilberrt, 2006). Thhe neural fo olds wanderr in the direection of thee midline off the eembryo, finaally fusing to t structure the neural tube t undern neath the ovverlying ecto oderm. Thee cells at the dorssal-most po ortion of thee neural tub be are the neural n crestt cells (Gilb bert, 2006). Durinng neurulattion, somitees form in ppairs flankin ng the neuraal tube, apppearing the first pair att 7HH H by a process called so omitogenesiis.. 7.

(18) INTRODUTIO ON. Figu ure 1-6 - Neu urulation Process. Represeentative schem matic of the neurulation n pprocess accom mpanied by scann ning electron microscopyiimages since tthe neural pllate (A) to thee formation oof the neural tube t flanked by y the somitess (D) (adapted d from Gilberrt, 2006).. Simultanneously witth neurulatiion, the em mbryo also folds f ventraally to enclose the gutt wo heart prim mordial togeether to fuse, starting th he organoggenesis. and bbring the tw. 1..3.. The Somitogeenesis clocck During developmen nt, embryoos exhibit a distinct anterior-to--posterior gradient g off. developmental maturity m (G Gilbert, 20066). This is particularly p evident durring the som mitogenesiss proceess, wherein the vertebrate embryyo body is segmented d periodicallly into repeeated units,, called somites, in i a head-to o-tail sequeence. In the anterior paart of the em mbryo, form med somitess beginn to differentiate into various tisssues (e.g.,veertebrae, rib bs, intercosttal muscless, dermis off. 8.

(19) INTRODUTION. the back and tendons), whereas at the some time in the posterior part, the presomitic paraxial mesoderm (PSM) remains unsegmented and undifferentiated (Aulehla and Pourquié, 2010). These transitory structures (somites) are a group of cells that suffered a mesenchymalepithelial transition at the anterior tip of the PSM, and are symmetrically positioned relative to the neural tube and notochord and they represent the first overt sign of a segmented body plan. If it is true that the morphological difference is only noticeable at the anterior tip of the PSM where cells become epithelialized, at the molecular level, that difference is already observed along the anterior third of the PSM tissue, where somite anterior-posterior (A-P) polarity is specified by Mesp2 and Delta/Notch signaling (Saga, 2007). Along the PSM, the cells exhibit different levels of differentiation where the segmental determination takes place in the PSM around the level of somite –IV, that correspond to the determination front. Here, Dubrulle et al., (2001) showed that fibroblast growth factor 8 (fgf8) was expressed as a gradient from the posterior part, decreasing towards the anterior PSM, by the progressive decay of fgf8 mRNA generated at the tail bud of the embryo, defining what was termed a wavefront of differentiation (Dubrulle and Pourquié, 2004a). Additionally, when fgf8 was over-expressed in the undetermined caudal region of the PSM the position of somitic boundaries had changed creating small somites and an activation of ectopic expression of genes like hoxB9 or hoxA10 was observed in order to maintain the anterior limit of expression of these Hox genes at the appropriate somitic level (Dubrulle et al., 2001). Concomitant with the fgf8’s gradient, mouse embryos also present a Wnt signaling gradient (Aulehla et al., 2003), asWnt3a expression is increased in the most posterior PSM and tail bud. A reversely oriented gradient of retinoic acid (RA) is also established, presenting higher expression in the somites and anterior PSM, whereas it is absent in more posterior parts of the embryo, including the tail bud (Diez del Corral et al., 2003). This combinatorial gradient system in the PSM that involves the activity of FGF, Wnt and RA signaling pathways is a fundamental key to maintain the undifferentiated state of cells in the posterior PSM and to control initiation of differentiation once cells reach the anterior PSM(Fig. 1-7). High levels of Wnt and FGF signaling maintain cells in an undifferentiated, posterior PSM state, whereas the exposure to high levels of RA signaling (and concomitant low levels of Wnt and FGF signaling) is responsible for initiating differentiation (Aulehla and Pourquié, 2010).. 9.

(20) INTRODUTIO ON. Figu ure 1-7 - Mod del for segmen nt determinaation through opposing gra adients. From m the relation nship of two typ pes of gradien nts (FGF/Wntt in the posteerior part and d RA in the anterior part)) a bistability window is establisheed, where pro obably the seggmetation clo ock acts to define the transsition of the more m und differentiated cells to a coh hort of cells p progressively more differentiated and oorganized (orrange). This w window moves porteriorly over time, ap ppearing new w cells in the place p of the ffirst ones (blu ue) (from Auleehla and Pourrquié 2010).. A very important i piiece of the puzzle was discovered d in 1997 byy Palmeirim m et al. Thee m clock c was ffirstly evideenced by cy yclic hairy11 mRNA ex xpression inn somiitogenesis molecular the cchick PSM, appearing as a caudoo-rostral waave, reiterateed during th the formatio on of everyy somiite (Fig. 1-88). Coincideently, the tim me that is needed n to peerform a cyc ycle of gene expressionn correesponds to the formatiion time off one somitte (90 min)) (Palmeirim m et al., 19 997). So, a moleecular clockk times vertebrate em mbryo somiite formatio on. This peeriodic mechanism iss repeaated multiple times un ntil the embrryo acquirees a defined d species-sppecific final number off somiites at the end e of the process p of aaxis elongattion and preesents a perriodicity wh hich is alsoo speciies-specific (Tenin et al., a 2010). Inn the chick embryo, a somite pairr is laid dow wn every 900 min in a rostro-caudal prog gression (Paalmeirim et al., 1997), and a totall of 51-53 somite pairss are fo formed durinng embryog genesis (Tennin et al., 20 010).. 10.

(21) INTRODUTIO ON. Figure 1-8 - Haiiry1 mRNA ex xpression patttern. The dy ynamic Hairy1 expression over 90 min (that is the sam me time to forrm a new som mite) observed d by in situ hy ybridization was considerred the first gene g from a m molecular clock that regullates the segm mentation (Pa almeirim et all., 1997).. Thereaftter, signalin ng componeents, includiing many neegative feeddback inhib bitors of thee Notcch, Wnt, annd Fgf pathways, aree involved in the segmentation clock and have beenn propoosed to conntrol the perriodic activaation of the system (Iim mura et al., 2009). Nulll mutationss invollved in the Notch signaaling pathw way or down nstream targ gets, like lfn fng, hes1, hees5, hes7 orr dll1 pproduce seggmentation defects, connfirming Notch signaliing as an im mportant com mponent off the ssegmentatioon clock (An ndrade et aal., 2007;Du uncan et al.., 2007). FG GF and Wn nt pathwayss play an importaant role too. nkd1 and L LEF/TCF ex xpression belonging too the Wnt siignaling aree two examples of o the recip procal interraction of Notch and Wnt signaaling pathw ways in thee somiitogenesis clock c (Andrade et al., 22007). From m this three signaling ppathways, th he FGF andd Notcch clusters of o cycling genes g are aactivated in parallel, while w genes belonging to the Wntt clustter present an a opposite phase of exxpression (D Dequéant et al., 2006).. 1..4.. Hoxx genes in embryon nic develo opment Besides the importaant functionn of controllling cellularr differentiaation and thee formationn. of seegmental unnit, the grad dient system m of Wnt, FGF and RA A signaling is also invo olved in thee contrrol of Hox gene expression in thee PSM (Iim mura et al., 2009). 2 Althhough initiaally somitess all loook morphoologically alike, a they w will subsequ uently deveelop into veery differen nt structuress. 11.

(22) INTRODUTIO ON. with unique funnctions depeending on thheir axial po osition – cerrvical, thoraacic, lumbarr and sacrall verteebrae, for exxample (Aulehla and Poourquié, 20 010). This ax xial identityy is given by y the actionn of H Hox genes, which w encod de homeoboox-containin ng transcripttion factorss. An anceestral Hox gene clustter is prop posed to haave been rrepeatedly duplicated,, resullting in fourr sets in birrds and mam mmals (Iimu ura and Pou urquié, 20077). In each cluster, thee 3′ H Hox genes are expresssed first, w whereas mo ore 5′ Hoxx genes aree expressed d later andd sequeentially (F Fig. 1-9). This phennomenon has h been called “tem mporal co ollinearity”” (Deschamps andd Van Nes, 2005). Mo reover, the Hox genes are arrangeed on the ch hromosomee n only theeir order off expression n initiation dduring embryogenesis,, in a ssequence thhat reflects not but aalso the anteerior limit of o their exprression dom mains along g the A-P axxis, thus deffining whatt has bbeen called as “spaciall collinearitty” (Iimuraa and Pourq quié, 2007).. From the distribution d n of thhe differentt Hox genes along thhe embryo, result thee different AP identities of thee verteebrae.. Figu ure 1-9 - Distrribution of th he Hox genes.. Schematic representation r n of the Hox genes distrib bution along the 4 cromossom mes and in thee anterior-poosterior axis of o mouse’s em mbryo, showiing a spatial collinearity c (adapteed from Purv ves et al., 2004 4).. 12.

(23) INTRODUTIO ON. Hox genne expressio on initially aappears in early e stages of chick em mbryo devellopment, ass a sallt-and-pepper pattern at the postterior primiitive-streak level and progressiveely extendss anterriorly in thhe epiblastt along thee primitivee streak. Then, T expreession of Hox H geness progrressively sppreads to th he surroundiing cells, reesulting in their t expresssion in virttually all off the epiblast ceells along the streak up to thee node lev vel. Next, H Hox gene expressionn subseequently sppreads even further antteriorly to th he node in the t posterioor neural plate (Fig. 1-10) ((Iimura et al., a 2009). These T expreession dynaamics follow w the gastrrulation movements off cells from the epiblast to the mesodderm, suggeesting that Hox geness could play y a role inn mation throug gh gastrulattion (Iimuraa and Pourquié, 2007). mesooderm form. Figure 1-10 - Hox H gene activ vation in the chicken emb bryo. Hox gen ne distributionn on four cro omossome usters, showin ng spatial colllinearity (A);; Activation of o hoxb1 along chicken em mbryo develop pment (B); clu hoxb4 expression pattern along the chicken n embryo, sho owing a posteerior activatioon to the hox xb1, agreeing w the spatia with al collinearityy of the Hox genes(C) g (from Iimura et aal., 2009). Activatioon of the Hox H genes iis initiated in the epiblast in a coollinear fash hion beforee their ingression into the priimitive streaak (Iimura and Pourqu uié, 2006).T The Hox gen nes are thuss all aactivated in a similar fashion, foollowing a temporal collinear seqquence. Ho owever, thee identtity of each segment th hroughout thhe AP axis is controlleed only by tthe posterio ormost Hoxx. 13.

(24) INTRODUTION. gene that is expressed in that segment. This property is termed posterior prevalence (Duboule and Morata, 1994). The molecular mechanism driving the sequential activation of Hox genes in the epiblast is unknown. In vertebrates, it has long been believed and recently shown that temporal collinearity reflects the progressive opening of chromatin in a 3’-to-5’ direction, thus providing temporally controlled access of the transcription machinery to Hox gene promoters (Soshnikova and Duboule, 2009). The collinearity has also been proposed to reflect the action of signaling pathways on cis-regulatory elements dispersed in the Hox clusters during gastrulation. The timing of activation of a Hox gene in the cluster depends on its position within the cluster, on local cis-regulatory sequences, on chromatin remodeling machinery and specific regulatory elements located outside of the cluster (Iimura et al., 2009). Initial activation of Hox gene transcription and the early anterior propagation event of Hox gene expression could be regulated by molecular events involved in gastrulation, including the formation and caudal regression of the primitive streak (Pourquié, 2007). Fgf signaling is essential for mesoderm formation through the primitive streak and its caudal regression, suggesting that it could play a regulatory role in the initial expression of Hox genes (Dubrulle et al., 2001). It has also been proposed that RA could play a role in vertebral patterning, in part, via regulation of Hox expression because RA treatment leads to distinct homeotic transformations and acts differentially on 3’ vs 5’ Hox genes in mesoderm (Kessel and Gruss, 1991). Wnt signaling has also been connected directly to the anterior progression of Hox genes since Wnt regulates the formation of the primitive streak (Ikeya and Takada, 2001; Aulehla and Pourquié, 2010). Finally, the caudal transcription factors (Cdx) are targets of the Wnt, FGF, and RA pathways, which play a conserved role in Hox regulation during AP axis formation (Iimura et al., 2009). The correlation of these pathways is schematically represented in Fig. 1-11.. 14.

(25) INTRODUTIO ON. Figgure 1-11 - Coonnection bettween the Hoox genes and multiple m sign nalling pathw ways. FGF, Wnt W and RA signaalling are invoolved in axiall extension (oorange), somiitogenesis (green) and AP patterning (p purple). Hox genes are regu ulated by thesse pathways, along with Notch N signalling and Cdx ggenes. Unbroken lines indicate establish hed interactio ons; broken llines represen nt documenteed interactionns that have not n yet been established at a a moleculaar level (from Deschamps and a Van Nes, s, 2005).. Still, a number n of experiments e s suggest th hat the clock and waveefront mech hanism thatt drivees the periiodic segmentation off PSM tisssue into so omites alsoo regulates Hox genee expreession (Kruumlauf, 200 09). The sppatial regulaation of hoxxd genes inn the anteriior PSM iss contrrolled by thhe segmentaation machiinery with the t influencce of the Nootch pathway (Zakanyy et al.. 2001). Beesides that, lossl or gaiin-of-functio on mutation ns in genes of the Notcch pathwayy affecct Hox genee expression n in the PS SM and sub bsequently, skeletal pattterning (Cordes et al. 20044).. 1..5.. Bracchyury "It is nott birth, marrriage, or deeath, but gaastrulation, which w is truuly the mosst importantt. W 19886). During gastrulation n, the formaation of a mesodermal m l time in your lifee"(Lewis Wolpert, b thee endoderm m and the ectoderm is a fundameental step. One of thee layerr of cells between earlieest mesodeerm markerrs is brachhyury (T). Its expresssion is resttricted to the t nascentt mesooderm, withh an essenttial functionn for the migration m of o mesoderm mal cells through t thee prim mitive streakk, and later in the tail bud (Wilso on and Bed ddington, 19997). brach hyury is thee foundding membber of the T-box familyy of transcrription facto ors, which iis characterrized by thee N-terrminal consserved DNA A-binding T T-domain.. 15.

(26) INTRODUTION. In Xenopus laevis embryo, AP positional information for the vertebrate trunk has been proposed to be generated by sequential interactions between a timer in the early non-organizer mesoderm and the Spemann organizer (Durston et al., 2009). This results in temporal collinear activation of Hox genes in the early ventral and lateral mesoderm (i.e., the nonorganizer mesoderm) of the Xenopus gastrula. In this system, the mesodermal transcription factor brachyury (Xbra) is required for early Hox expression domain in the animal–vegetal direction and the secreted growth factor BMP-4 limits it in the organizer/non-organizer direction (Wacker et al., 2004a). The overlap of these two signals defines the initial Hox expression domain. Therefore, the contribution of T in Hox induction, and as well as the requisite for a molecular timer in the mesoderm have both been proposed to control collinear Hox gene expression activation.. 1.6.. Manipulating gene expression levels in the chick embryo: Electroporation and Explant culture The basic principle of electroporation is that application of an electric field to cells. generates the reversible opening of pores in the cellular membrane, which then allows charged macromolecules, such as DNA, RNA, and proteins, to penetrate the cells (Iimura and Pourquié, 2008). Muramatsu et al. (1997) first reported the use of such electroporation techniques in ovo to over-express genes in the chick embryo. Subsequently, the conditions for routine use of in ovo electroporation in various tissues have been established, and a wide range of potential applications has been developed (Iimura and Pourquié, 2008). Nevertheless, it has been difficult to establish electroporation methods for the epiblast in early gastrulating embryos (stages 3 to 7HH) because of their small size and fragility. The use of flat electrodes, combined with an in vitro culture system, has made it possible to overcome these issues and over-express genes in embryos at the primitive streak stage (Iimura and Pourquié, 2008). From the several methods available for explants culture upon electroporation, two are currently widely used: the ‘EC culture’ method (Chapman et al., 2001), in which the embryo attached to its own vitelline membrane is explanted by attaching the outer portion of the membrane to a piece of filter paper and subsequently transferred to an agar substrate on which it is cultured, and New culture (New 1995), involving removal of the embryo attached to its. 16.

(27) INTRODUTION. own vitelline membrane, which is then stretched around a glass ring and cultured on a pool of egg albumen (Voiculescu et al., 2008). The EC culture has several benefits compared with classical New culture: (1) It does not require either glass rings or watch glasses; (2) standard laboratory filter paper is inexpensive and readily available, and it can be sterilized by autoclaving; (3) Tension on the blastoderm is maintained without the need to adjust the vitelline membranes on a glass ring placing the filter paper directly onto the intact yolk before cutting through the vitelline membranes; (4) Cultures can be made very quickly; (5) Identical conditions are maintained for each embryo; (6) Liquid does not pool on the embryo; (7) Embryos can be easily removed and replaced on the substratum and, therefore, can be cultured first ventral-side up and then dorsal-side up (after they reach stage 8HH); (8) Embryos typically develop at about the same rate as in ovo, and development of the extraembryonic vasculature is extensive; (9) Embryos can be routinely cultured until they reach stages 15–17, although expansion of the rostral brain region is retarded in such embryos, and sections reveal that some degeneration of the neural tube occurs (Chapman et al. 2001).. 1.7.. Aims of this study This study intended to contribute to the clarification of a fundamental developmental. question regarding how temporal control of positional information is achieved. If, on one hand the molecular clock is giving a notion of time by the number of expression cycles of certain genes that the cells received, on the other hand the sequential expression of Hox genes confers spatial identity to the PSM cells. Additionally, Hairy1 protein interacts with Brachyury (unpublished results) and our available data suggest that the protein dimer Brachyury-Hairy1 could be involved in Hox gene transcription regulation, thus implicating the molecular clock in both temporal and spatial control of cell identity. To test this hypothesis, plasmids were constructed to over-express hairy1 and brachyury in vivo, employing the embryo culture system (Chapman et al. 2001) to re-incubate the embryos after electroporation for an appropriate period of time. The empty vector was used as control. Successful electroporation was confirmed by in situ hybridization with probes to label cells that are actively transcribing each gene. Afterwards, a careful analysis of the. 17.

(28) INTRODUTION. morphological characteristics of the embryos was performed with the aim of finding correlations between the phenotypes obtained and the different expression plasmids. Perturbing the system with either hairy1 or brachyury over-expression could result in common external embryo alterations if they are working in the same way. Electroporated embryos were also collected for posterior analysis of Hox gene expression by reversetranscription-quantitative polymerase chain reaction (RT-qPCR) assays.. 18.

(29) 2. MATERIALS AND METHODS.

(30) MATERIALS AND METHODS. 2.1.. pCAT 2.1.1.. Plasmids construction. pCAT was generated by cloning the IRES-MCS region from pIRES2-GFP (Clontech) into pCAGGS-AFP (kindly provided by Tsuyoshi Momose). This fragment was generated by PCR using the MCS-IRES-ForSpeI (GGACTAGTGCTAGCGCTACCGGACTCAG) sense primer. and. the. antisense. primer. MCS-IRES-RevSpeI. (GGACTAGTTGTGGCCATATTATCATCGT). To confirm the length of the fragment, an agarose gel electrophoresis was performed. The bands were cut and purified by QIAquick® Gel Extraction Kit (Qiagen). The products were digested with the restriction enzyme SpeI (Fermentas) and the digestion product was checked on a 0.8% agarose gel. The pCAGGS-AFP vector was linearized with the restriction enzyme XbaI (Fermentas) that produces compatible ends with SpeI. This product was incubated with Shrimp Alkaline Phosphatase (SAP) (Roche) that catalyzes the dephosphorylation of 5 ́ phosphates from DNA preventing the vector’s re-ligation. To confirm completion of the digestion, an agarose gel electrophoresis was performed. Digested products were gel purified using QIAquick® Gel Extraction Kit (Qiagen) and checked on a 0.8% agarose gel to confirm the efficiency of extraction. The ligation of the two generated DNA products was performed with the Rapid DNA Ligation Kit (Fermentas) using the One Shot® Mach1-T1 Chemically Competent E. coli cells (Invitrogen). Eight colonies were selected and grown for plasmid extraction using the QIAprep® Spin MiniPrep Kit (Qiagen). Ligation confirmation and analysis of the fragment orientation was performed by restriction digestion using 2 different enzymes: EcoRI (Fermentas) and BamHI (Roche). Finally, the selected plasmids were sequenced using the sense primer SeqT3_For (GAGGGCCTTCGTGCGTCG) and antisense primer MCS-IRESRevSpeI. Plasmid concentration was measured using NanoDrop 2000C Spectrophotometer (Thermo Scientific).. 2.1.2.. pCAT + c-Term. A C-terminal fragment of the hairy1gene (c-Term) was generated by PCR using the sense. cTerm-AFP-NheI. (CTAGCTAGCCAGATCGTGGCCATGAACTACCTGC). 20. and.

(31) MATERIALS AND METHODS. antisense Hairy1-AFP-EcoRI (CCGGAATTCCTACCACGGCCGCCAGACG) primers. To confirm the length of the fragment, agarose gel electrophoresis was performed. The bands were excised and purified by QIAquick® Gel Extraction Kit (Qiagen). The products were simultaneously digested with the restriction enzymes EcoRI and NheI (Fermentas) which were then heat-inactivated. The digestion product was checked on a 0.8% agarose gel. The previously constructed pCAT plasmid was digested with the MCS restriction enzymes EcoRI and NheI. This product was incubated with SAP to ensure plasmid dephosphorylation. To confirm the length of the fragment an agarose gel electrophoresis was performed. Digested products were gel purified with QIAquick® Gel Extraction Kit (Qiagen) and checked on a 0.8% agarose gel to confirm the efficiency of extraction. The ligation of the two fragments was performed with Rapid DNA Ligation Kit (Fermentas) using the One Shot® Mach1-T1 Chemically Competent E. coli cells (Invitrogen). 24 grown colonies were expanded and a colony-PCR reaction was performed with the primers cTerm-AFP-NheI and Hairy1-AFP-EcoRI to check for successful clones. These were grown and the plasmid DNA was extracted using the QIAprep® Spin MiniPrep Kit (Qiagen) and a new PCR with the same primers was performed, confirming the length of the fragment in a 0.8% agarose gel. Finally, the plasmids were sequenced using the sense primer SeqT3_For and antisense primer MCS-IRES-RevSpeI. Plasmid concentration was measured using the NanoDrop 2000C Spectrophotometer (Thermo Scientific).. 2.1.3.. pCAT + Hairy1. The hairy1 open reading frame (ORF) was obtained by EcoRI restriction digestion of the pCRII-TOPO+Hairy1 plasmid available in the lab. To confirm the length of the fragment an agarose gel electrophoresis was performed. The band was cut and purified with QIAquick® Gel Extraction Kit (Qiagen). The digestion product was checked on a 0.8% agarose gel to confirm extraction efficiency. pCAT was linearized with the MCS restriction enzyme EcoRI and the digestion was confirmed by agarose gel electrophoresis. The ligation of the two aforementioned fragments was performed with the Rapid DNA Ligation Kit (Fermentas) using MultiShotTMStripWell TOP10 Chemically Competent E. colicells (Invitrogen). Plasmid DNA extraction was made from 12 colonies using QIAprep®. 21.

(32) MATERIALS AND METHODS. Spin MiniPrep Kit (Qiagen). The plasmids were digested with EcoRI to confirm hairy1 ORF presence and the length of the fragment was confirmed by agarose gel electrophoresis. To confirm the correct orientation of the hairy1 ORF, two different PCR reactions were performed. with. the. following. primers. (CCGGAATTCCTACCACGGCCGCCAGACG) (ACATATAGACAAACGCACAC);. pairs: and. Hairy1-AFP-EcoRI pCATSeq_REV Hairy1-AFP-NheI. (CTAGCTAGCATGCCCGCCGACACGGGCATG) and pCATSeq_REV. Only the second primer-pair should result in PCR amplification in a plasmid with hairy1 in the correct orientation. Finally, selected plasmids were sequenced using the sense primer pCATSeq_FOR (ACTTCCTTTGTCCCAAAT) and antisense primer pCATSeq_REV. The. plasmid. concentration was measured using the NanoDrop 2000C Spectrophotometer (Thermo Scientific).. 2.1.4.. pCAT + Brachyury. The brachyury ORF was amplified by PCR using the sense primer T-AFP-NheI (TTCGCTAGCATGGGCTCCCCGGAGGACGC) and the antisense primer T-AFP-EcoRI (CCGGAATTCTTACATGGAAGGTGGGGTGATGGG) on the pSK-T-orf plasmid (kindly provided by Susan Mackem). To confirm the length of the fragment, an agarose gel electrophoresis was performed. The bands were cut and purified using the QIAquick® Gel Extraction Kit (Qiagen). The brackyury ORF was then cloned into the pCRII-TOPO® plasmid (Invitrogen), according to the manufacturer’s protocol. Four white colonies were selected and plasmid DNA extraction using QIAprep® Spin MiniPrep Kit (Qiagen) was made. The plasmids were digested with the restriction enzyme EcoRI to confirm the presence of brackyury ORF and the length of the fragment was confirmed by agarose gel electrophoresis. The plasmids were sequenced using the commercial primer T3 (AATTAACCCTCACTAAAGGG). The product of the digestion with EcoRI of the correct pCRII-TOPO+Brachyury plasmid was cut, purified using QIAquick® Gel Extraction Kit (Qiagen) and was finally checked on a 0.8% agarose gel. pCAT was linearized with the MCS restriction enzyme EcoRI and the digestion was confirmed by agarose gel electrophoresis. The ligation of the two fragments was performed with the Rapid DNA Ligation Kit (Fermentas) using MultiShotTMStripWell TOP10 Chemically Competent E. coli cells. 22.

(33) MATERIALS AND METHODS. (Invitrogen). Eight colonies were grown and plasmids extracted using the QIAprep® Spin MiniPrep Kit (Qiagen). To confirm the orientation of the brackyury ORF in pCAT, two different PCR reactions were performed using the following primers: T-AFP-EcoRI and pCATSeq_REV; T-AFP-NheI and pCATSeq_REV. Only the second primer-pair should result in PCR amplification in a plasmid with brachyury in the correct orientation. Finally, selected plasmids were sequenced using the sense primer pCATSeq_FOR and the antisense pCATSeq_REV primer. Plasmid concentration was measured using the NanoDrop 2000C Spectrophotometer (Thermo Scientific).. 2.2.. Embryos and staging Fertilized chicken (Gallus gallus) eggs were obtained from commercial sources. (Sociedade Agrícolada Quinta da Freiria, SA.) and stored at 16ºC for up to 1 week. Embryos were incubated at 38ºC in a humidified chamber for the appropriate time, according to Hamburger and Hamilton (1951).. 2.3.. Embryo explant culture Embryo explant cultures were performed according to the EC - Early Chick method. (Chapman et al., 2001), as further described. Fertilized chick eggs were removed from the incubator and allowed to cool for 15-30 min before cleaning the shell with 70% ethanol and allowing it to dry. The yolk was separated from the egg white (Fig. 2-1 A; B) and was directly deposited onto a 10-cm glass Petri dish (Fig. 2-1C), such that the blastoderm was positioned centered on the yolk, and the vitelline membrane was intact (Fig. 2-1D). The thick albumine covering the blastoderm was removed using a piece of sterile filter paper (Whatman no. 3) with gentle movements, drawing it away from the center (Fig. 2-1E), because the albumine interferes with the ability of the vitelline membranes to attach to the filter paper. Another piece of sterile filter paper with a central aperture was placed gently onto the vitelline membranes, such that the embryo was framed (Fig. 2-1F). The paper immediately absorbed liquid from the surface of the vitelline membrane, drawing it tightly onto the paper.. 23.

(34) MAT TERIALS AND MET THODS. The viteelline memb brane was ccut around the filter paper with a scissors (F Fig. 2-1G).. Withh forceps, thhe filter pap per was genntly pulled away from m the yolk inn an obliqu ue directionn (Fig. 2-1H). Hoolding the filter paperr, any attacched yolk was w gently removed using u bluntt forceeps (Fig. 2-11I).. A. B. C. D. E. F. G. H. I. J. Figure 2-1 - Step sequence of the t EC culturre execution Illustrative images show wing how to h handle the ma aterial and th he embryo forr EC culture (A-J).. The embbryo thus prrepared waas then electtroporated as a describedd in section n 2.4. Afterr electtroporation, the filter paper wass placed on nto an agarr-albumen culture dish with thee blasttoderm venttral-side up p (Fig. 2-1JJ), carefully y to avoid trapping t airr bubbles between b thee filterr paper and the semi-so olid medium m. Some thiin albuminee was placedd on the Peetri cover too preveent condenssation (Fig.. 2-1 B). Thhen the em mbryo was reincubated r d at 38ºC in n a coveredd 150-m mm Petri diish, with mo oistened tisssue paper liining the baase, during aabout 13hou urs.. 2..4.. Electtroporation of chicck embryo tissues The embbryo attacheed to a filteer paper (prrepared as described d inn the previo ous section)). was placed in the t inner silicone ring of the CU UY700-P2E petri dish-ttype electro ode (NEPA A GEN NE), which was w previou usly fully fiilled with a Tyrode’s saaline solutioon (Stern ett al., 2008).. All tthe solutionns used in materials m andd methods are a describeed in Tablee 2-1. The embryo e wass posittioned over the 2 mm window (vventral side up). A thin n glass needdle was preepared from m glasss capillary tubes ussing a pulller (SUTT TER INST TRUMENT CO., Mo odel P-87,, Flam ming/Brown Micropipette) set as ffollows: Tim me 150, Heeat 720, Pulll 75, Vel 60. 6 Plasmidd DNA A containingg 1/5 volum me of 0.4% % (wt/vol) Fast F Green solution w was injected d into a slitt. 24.

(35) MAT TERIALS AND MET THODS. betw ween the em mbryo vitelline memb rane and th he epiblast, targeted llateral to the t anteriorr prim mitive streakk groove. Subsequently S y, the anod de electrodee (CUY7000-P2L, NEP PA GENE)) was placed ontoo the surfacce of the soolution fillin ng the innerr ring, ensur uring that th he electrodee o the embry ryo (Fig.2-2 2). In this way, w the disttance betweeen the twoo covered the targgeted area of electtrodes was always a main ntained at aapproximateely 4 mm. Five F 50 ms ppulses of 10 V, with a intervval of 350 ms m were applied by thee electroporrator BTX ECM E 830, E Electro Squ uare Poratorr (Harvvard Apparratus), using g a foot pedaal.. Figu ure 2-2 – Ilusstrative image showing thee electropora ation of chick embryo withh the two elecctrodes and glass neeedle Table 33-1 – Solution composition. S Solution 110x PBS (1 liter). T Tyrode’s saaline (10x). F Fixing Solu ution P PBT or PT TW H Hybridizattion Solutio on. M MABT N NTMT D Developingg Solution. Com mposition 80 g NaCl; 2 g KCl; K 14.4 g Na2PO4; 2..4 g KH2PO O4 (adjuust to pH 7.4 4 with NaOH and bringg to 1 liter with w waterr) 80 g NaCl; 2 g KCl; K 2.71 g CaCl2.2H2O O; 0.5 g NaH2 PO4.2H2O; 2 g MgCl2.6H2O; 10 g glucose to o 1 l. Befoore use, add 20 ml of th his 10x stockk to 180 ml H2O 4% F Formaldehy yde in PBS; 2mM EGTA A; (adjuust to pH 7.5 5 with NaOH) 1x PB BS plus 0.1% Tween 50% formamidee; 1.3x SSC,, pH 4.5 (usse citric acid d to pH); 5mM EDT TA; 50 g/m ml yeast tRN NA; 0.2% Tw ween 20; 00.5% CHAP PS;100 g/m ml heparin 0.5M M C4H4O4; 744mM 7 NaC Cl; 0.01% T Tween 20; (adjust to pH H 7.5) 100 m mM NaCl; 100 mM Trris-HCl, pH 9.5; 50 mM M MgC Cl2; 0.1/1% Tween-20 T 1.5m ml NTMT; 4.5 4 l/ml NB BT (75mg/m ml from Rocche); 3.5  l/ml BCIP (50mg/ml from f Rochee). 25.

(36) MATERIALS AND METHODS. 2.4.1.. Embryo dissection and storage. Embryos presenting fluorescence were dissected (with suitable, sterilized surgery material) from the filter paper in a black Petri disk with phosphate buffer saline (PBS 1X). Then, they were placed in a 1.5ml eppendorf and immediately frozen in liquid nitrogen. Finally, the embryos were stored at -80 ºC.. 2.5.. Whole-mount In situ hybridization The principle behind whole-mount in situ hybridization (WISH) is the specific. annealing of a labeled nucleic acid probe to complementary sequences (mRNA) in fixed tissue, followed by detection of the location of the probe. This method provides on one hand a spatial and temporal resolution of gene expression and on the other hand allows the detection of genetic interactions through simultaneous hybridization of up to three different probes in the same embryo.. 2.5.1.. Synthesis and purification of antisense RNA probes. In order to make an antisense RNA probe complementary to hairy1 mRNA, a plasmid containing hairy1 sequence was linearized with the restriction enzyme HindIII (Fermentas) and the probe was generated by in vitro transcription using the T7 RNA polymerase (Promega), in the presence of a digoxigenin-substituted nucleotide mix, DIG (Roche) (Palmeirim et al., 1997). The transcription product was checked on a 0,8% agarose gel. The RNA probe was precipitated by adding 200µL of Tris-EDTA buffer, 20µL LiCl 4M and 600µL Ethanol 100% and left at -80ºC for 1h. The mixture was centrifuged (at 4ºC) (VWR, model ct15re Himac) for 30 min at 12000rpm. The supernatant was carefully discarded and the pellet washed with 70% Ethanol, followed by centrifuging (at 4ºC) for 15 min at 12000rpm. The supernatant was carefully discarded and, after being dried, the pellet was ressuspended in 40 µL of Tris-EDTA buffer. The final probe was checked on a 0,8% agarose gel.. 26.

(37) MATERIALS AND METHODS. 2.5.2.. Embryo fixation. Embryos were fixed overnight at 4ºC in fixing solution. Following removal of the fixing solution from the embryos, two 15 min washes were carried out with PTW solution. The embryos were then dehydrated for 10 min in 50% methanol/PBT and twice in 100% methanol and subsequently stored at –20°C until required.. 2.5.3.. Embryo pre-treatments and Hybridization. Embryos were rehydrated by washing through 75% - 50% - 25% series of Methanol/PTW solutions (for periods of 10 to 15 min) and two times in PTW. After this, embryos were treated with 10μg/ml proteinase K (Promega) in PTW. The time of incubation in min equaled the HH stage number. After that, proteinase K was removed and the embryos were briefly rinsed two times with PTW and post-fixed in 0.1% glutaraldehyde, 4% paraformaldehyde in PTW for 20 min. Embryos were then rinsed once and washed twice with PTW. The embryos were rinsed once with 1:1 PTW/hybridization mix and with 1ml hybridization mix. Hybridization comprised two steps. First the embryos were pre-hybridized in 1ml hybridization mix for at least 1 hour at 70ºC. During this period, the solution can penetrate into the cells and the optimal temperature of the hybridization is achieved. Then the hybridization mix was removed and pre-warmed hybridization mix with the previously prepared antisense RNA probe was added. Hybridization was performed overnight at 70ºC.. 2.5.4.. Antibody incubation. After the hybridization steps, the solution was removed and the embryos were rinsed twice with prewarmed hybridization mix. The embryos were washed twice for 30 min at 70ºC with 1.5ml prewarmed hybridization mix and for 10 min at 70ºC with 1.5ml prewarmed 1:1 hybridization mix/MABT. Afterwards, the embryos were rinsed twice and washed once for 15 min with 1.5ml MABT solution. In order to block unspecific antibody binding sites, the embryos were incubated 1h with 1.5ml MABT containing 2% Blocking Reagent (Roche),. 27.

(38) MATERIALS AND METHODS. followed by 1.5ml MABT with 20% Goat Serum (Gibco) and 2% Blocking Reagent for a minimum of 1h at room temperature in a rocker. The previous solution was removed and replaced by fresh solution containing a dilution 1/2000 anti-Digoxigenin-AP (Roche), and incubated overnight at room temperature with smooth agitation.. 2.5.5.. Post-antibody washes and histochemistry. The antibody solution was removed and the embryos were rinsed in MABT three times for 5 min and washed three times for 1 h at room temperature by rolling. The embryos were then washed with NTMT solution twice for 10 min. The embryos were incubated in the developing solution in the dark, at 37ºC. Once achieved the desired staining, the embryos were washed several times with PTW in order to stop the reaction and then they were photographed.. 2.6.. Image acquisition Embryos were photographed using a QImaging Micro Publisher 50 RTV camera. coupled to a Leica MZ16FA stereomicroscope. Images were processed using Adobe Photoshop software.. 28.

(39) 3. RESULTS.

(40) RES SULTS. 3..1.. Plasm mid consttruction ffor embry yo electrop poration 3.1.1.. pCAT. In orderr to over-eexpress ouur genes of interest in chick eembryonic tissues byy electtroporation, an expreession vecttor derived d from pC CAGGS-AFFP was constructed, c , contaaining a Muultiple Cloning Site (M MCS), follow wed by an in nternal ribossome entry site (IRES)) and tthe AFP genne, a modifiied version of the Greeen Fluoresceent Protein – the pCAT T plasmid. The fraggment encom mpassing an IRES-MC CS region (Fig. 3-1B) was introdu uced in thee pCA AGGS-AFP plasmid an nd the consttruction waas confirmeed and orienntation testted in eightt randoomly chosen colonies using u two reestriction en nzymes: EcoRI and BaamHI.. B. A. Figu ure 3-1 - PsstI - DNA digested with P PstI, used as a DNA moleccular weight m marker (A). Agarose A gel with the amp plified MCS--IRES fragmeent (B).. The EcooRI enzyme should lineearize the pllasmid prod ducing a bannd of 6209 bp and thiss was observed inn the eight colonies c (Fiig. 3-2B). Additional A bands b of higgher molecu ular weightt couldd also be obbserved, wh hich correspoond to the non-digested n d plasmid.. 30.

(41) RES SULTS. B. A Figurre 3-2 – pCAT T scheme witth restriction sites constru ucted by Vecttor NTI9 (Invvitrogen) (A).. Agarose gel electrophoresis of tthe 8 sampless digested witth EcoRI (B)).. Upon diigestion with BamHI, two differrent pattern ns could ariise, depend ding on thee orienntation of the t fragmen nt insertionn. For correect pCAT, the enzym matic digesttion shouldd produuce three baands: 3700b bp, 2172bp and 337bp,, which occcurred in collonies 2, 3, 4, 5, 7 andd 8 (Fiig. 3-3B). For F the reverse orientaation, three bands with h different sizes appeaar: 4216bp,, 16566bp and 3377bp, occurriing in sampples 1 and 6. The band with 337bpp doesn’t seee very welll in thiis photo, beecause of thee photo quaality and litttle intensity of the bandd.. 31.

(42) RES SULTS. B. A Figu ure 3-3 - pCA AT scheme ev videncing Bam mHI restrictio on sites (A). Agarose A gel oof the 8 samples digested with BamH HI (B).. 3.1.2.. pCAT + c-Term c. For pCA AT+c-Term constructioon, the C-T Terminal po ortion of thee hairy1 geene (Fig. 3-r enzymes foor sticky-en nd ligation: 4A) was clonedd in pCAT using twoo different restriction RI e NheI. So, S it wasn’t necessaryy to proceed d restriction n enzyme ddigestions to o check thee EcoR orienntation, sincce there’s only o one poossibility off the fragmeent to be innserted into the vector,, givenn that they have h differeent edges. T The ligated vector v was then t sequennced for con nfirmation.. 32.

(43) RES SULTS. CMV-IE-bactin. Apa LI (63349). AmpR. Nco I (381) Ava I (8889). Avaa I (1152) Avva I (1272) Apa LI (55103). A I (1288) Ava. p CAT+ cTer m. A I (1551) Ava. 6603 bp Bam HI (44607). N I (1635) Nhe. SV40. c cTerm. Nco I (4363). Ecoo RI (2067). Bam HI (4270). Ps t I (2076). H dIII (4085) Hin. Xm m a I (2094). Pst I (4080). Avva I (2094) Ava I (33522). S m a I (2096) B Bam HI (2098) Hin dIII d (2329). A. IRES S Apa LI (25 82) Nco I (2795). A AFP. B. Fiigure 3-4 - Aggarose gel wiith the ampliffied c-Term fragment f com mparing with the ladder  PstI (A). pCAT+c-Teerm scheme with w the restrriction enzym mes constructed by Vectorr NTI9 (Invitrrogen). 3.1.3.. pCAT + Hairy1 H. The pCR RII-TOPO+ +Hairy1 plaasmid was digested with w EcoRI to obtain a fragmentt contaaining the hairy1 h genee (Fig. 3-5B B). That frag gment was inserted intto pCAT att the EcoRII site. 12 random mly selected d colonies were tested with Eco oRI digestiion and 7 had hairy1 inserrted (Fig. 3--5C - coloniies number 1, 2, 4, 5, 9, 10 and 11).. A. B. C. Figure 3-5 - GeneRuler’’s 1Kb Plus D DNA Ladder specific band ds (A). Agaroose gel with pCRIITOPO+Hairy11 digested with EcoRI (B)). Agarose gell of the 12 sam mples digesteed with EcoR RI and the poositive control (C+) (C). 33.

(44) RES SULTS. Due to the t equal stticky ends oof the fragm ment, it waas necessaryy to disting guish whichh ones had the fraagment inserrted in the ccorrect posittion (Fig. 3-6A). Five ssamples weere obtainedd that aamplified with w the prim mers, indicaating the corrrect positio on (Fig. 3-6B B - sampless 1, 4, 5, 100 and 11). Other two had the t fragmennt inserted in a reversed positioon (sampless 2 and 9).. Sampples 10 and 11 were sequenced forr confirmatiion.. B A F Figure 3-6 - Schematic S rep presentation oof the two typ pes of ampliffication accorrding to the frragment orieentation: Hairry1 in correcct orientation amplifies wiith F+R1 prim mers, Hairy1 in incorrect orientation am mplifies with R2+R1 prim mers (A). Agarrose gel with the 7 positive samples forr Hairy1 insertion and neggative control (pCAT) with h the two diffferent pair prrimers compa aring with thhe 1Kb Plus DNA D ladder (B).. 34.

(45) RES SULTS. CMV-IE-bactin. Apa LI (68846). AmpR. Nco I (381) Ava I (8889) Avva I (1152) A I (1272) Ava. Apa LI (56600). Ava I (1288) Ava I (1551). p CAT+ Hair y1 y. Bam HI (51104). Ava I (1657). 7100 bp. S SV40. Hin dIII (1666). Nco I (44860). Eco RI (1673). TOPO® binding sit s. Bam HI (4767). Hairy1. Hin dIIII (4582). TOP PO® binding site. P I (4577) Pst Ava I (4019). Eco RI R (2564). AFP. Pst I (2573) Xm a I (2591) Ava I (2591) S m a I (2593) Bam m HI (2595) Hin dIII (22826). IRES Apa LI (3079) Nco I (3292). Figure 3-7 - pCAT+Hairy1 scheme w with restrictiion sites given n by Vector N NTI9 (Invitro ogen).. 3.1.4.. pCAT + Brachyury B y. To inserrt the brachyury genee in the pC CAT, the brachyury b O ORF (Fig. 3-8A) wass previiously inserrted into thee pCRII-TO OPO plasmid d so that upon plasmidd digestion with w EcoRI,, a fraagment conttaining the brachyury gene could d be obtaineed in 4 sam mples (Fig. 3-8B). Thee orienntation of thhe fragment was verifieed by sequen ncing. For posterior p woork we chosse sample 2 preseenting Brachhyury in a sense s orienttation wheree sample 4 is i in antisennse direction n.. B. A. Figgure 3-8 - Agaarose gel elecctrophoresis oof Brachyury amplified fra agment (A). E Electrophoresis of the 4 samples diigested with E EcoRI after in nsertion in TOPO plasmidd (B).. 35.

(46) RES SULTS. The bracchyury gene was obtaiined by thee digestion of pCRII-T TOPO+Bracchyury withh the E EcoRI enzym me and inseerted in thee pCAT vecctor. As the edges are iidentical on n both sidess the bbrachyury can c be inseerted both w ways. For that t reason it was neccessary to check theirr orienntation. For this, two PCR P reactioons with diffferent prim mers pairs w were held (Fig. 3-9A),, obtaiining six samples with the correctt orientation n (Fig.3-9B - samples 11, 2, 3, 4, 5 and 7) andd two with the inncorrect orieentation (saamples 6 an nd 8). Samp ples 1 and 2 were seq quenced forr firmation. confi. F Figure 3-9 - Schematic S rep presentation oof the two typ pes of ampliffication accorrding to the frragment orrientation: Brrachyury in correct c orienttation ampliffies with F+R R1 primers, B Brachyury in incorrect orientation amp plifies with R2+R1 primerrs (A). Agarose gel with th he 8 samples aamplified usiing the two different pairs (B).. 36.

(47) RESULTS. CMV-IE-bactin Apa LI (7278). Nco I (381). AmpR. Av a I (889) Ava I (1152) Av a I (1272) Ava I (1288). Apa LI (6032). Av a I (1551). Bam HI (5536). Av a I (1657). p CAT+ Br ach yur y. SV40. Hin dIII (1666). 7532 bp Nco I (5292). Eco RI (1673). Bam HI (5199). Pst I (1758). F. Hin dIII (5014) Pst I (5009). Ava I (2234). Brachyury ORF Av a I (4451). Xma I (2420). AFP. Av a I (2420) S ma I (2422) Apa LI (2819) Pst I (2896) Av a I (2981). TOPO® binding site Eco RI (2996) Pst I (3005) Xma I (3023) Av a I (3023) S m a I (3025) Bam HI (3027) Hin dIII (3258). IRES Apa LI (3511) Nco I (3724). Figure 3-10 - pCAT+Brachyury scheme with restriction sites constructed using Vector NTI9 (Invitrogen).. 3.2.. Electroporation. 3.2.1.. Optimization of chick electroporation conditions. The electroporation technique was a new method introduced in the lab, and it was necessary to proceed to its optimization. For this, 441 3-4HH embryos were electroporated with empty vectors in order to test several electroporation conditions. This worked allowed the conclusions described below.. o Voltage applied by the electroporator: values higher than 10 volts are lethal to the embryos, while values below 10 volts are many times insufficient and no fluorescence com be observed.. 37.

(48) RES SULTS. o The T use of ultra-pure u ddistilled watter and steriilized materrial is of dirre need, forr itts non-fulffillment maay introdu uce contam minations ccompromisin ng all thee m methodology y. o The T type off fluorescencce chosen to t the plasm mid was bassed simply on the bestt v visualization n of the coloor green (A AFP) (Fig. 3-11B) oppoosed to colorr red (RFP)) (Fig. 3-11C)), since therre was no to oxicity diffeerences in thhe embryo using u eitherr o one.. Dark fielld. AFP. A. RFP. B. AFP + RFP. C. D. Fiigure 3-11 - Images I of an embryo with h different typ pes of fluorescence: AFP ((B), RFP (C) and both AFP+RFP P (D). o The T plasmid d concentrattion was alsso tested. Flluorescencee was obtain ned withoutt a apparent tox xicity usingg all the co oncentration ns tested: 1..55 g/l, 1.02 g/l,, 0 0.56 g/l, 0.3 g/l, 00.21 g/l and 0.13 g g/l. In genneral, an approximatedd v value of 0.3 3 g/l weere chosen to inject, for f being a value that presentedd f fluorescence e, it didn’t present any y real toxiccity and it w was the vallue directlyy o obtained from the DNA A extraction by the Min niPrep kit.. 3.2.2.. Confirma ation of plaasmid-driv ven gene over-expre o ession. To conffirm the plaasmids werre over-exp pressing thee gene of innterest, electroporatedd embrryos presennting fluoresscence weree processed d for in situ hybridizatiion with eitther Hairy1 or Brrachyury prrobe (Fig. 3--12 and Figg. 3-13).. 38.

(49) RES SULTS. AF P. Hairry1. AFP + Hairy1. pCAT+Hairy1. Dark field f. B. D. C. pCAT. A. E. F. G. H. Figu ure 3-12 – Em mbryo electro oporated with h pCAT+Hairy1 observed d in: dark fielld (A), AFP flluorescence (B),, Hairy1 stain ning by in situ u hybridizatiion (C) and an n overlap image of AFP aand Hairy1 (D D). Embryo elecctroporated with w pCAT ob bserved in: d dark field (E),, AFP fluoresscence (F), Haairy1 staining by in situ hybridiza ation (G) and d an overlap im mage of AFP P and Hairy1 (H).. 39.

(50) RES SULTS. AF P. Brach hyury. AFP + Brrachyury. pCAT+Brachyury. Dark field f. B. C. E. F. G. D. pCAT. A. H. Figure 3-13 - Embryo eleectroporated d with pCAT+ +Brachyury observed o in: ddark field (A A), AFP flluorescence (B B), Brachyurry staining byy in situ hybridization (C) and an overllap image of AFP and Brachyury (D). Embryo elecctroporated w with pCAT ob bserved in: dark d field (E),, AFP fluoresscence (F), B Brachyury staaining by in situ s hybridizaation (G) and d an overlap image i of AFP P and Brachy yury (H).. The anallysis of in situ hybridizzation stainiing on the embryos preeviously electroporatedd with pCAT+Hairy1 and pCAT+Brrachyury revealed r a pattern ccorresponding to thee y, plus a “salt-and-p pepper”-likee endoogenous hairy1 or brrachyury exxpression, respectively stainning that maatched and overlaped w with the AF FP fluoresceence. This iindicates th hat an over-expreession of booth AFP and d Hairy1 or Brachyury has been acchieved.. 3.2.3.. Effect of the t local oof injection n in the ov ver-expresssion patterrn. The plaasmids with the genne of interrest were introducedd in the embryo e byy microoinjection between b thee hypoblast and the vittelline mem mbrane in tw wo differentt ways. Thee first one, througgh a more crafty c technnique, in wh hich the neeedle was inntroduced in n a siliconee tube,, the pressuure was perrformed wiith the mou uth and two o or three micro-injecctions weree perfoormed at thee posterior part of the embryo, beehind the prrimitive streeak (Fig. 3--14A, B, C,,. 40.

Referências

Documentos relacionados

Neste trabalho o objetivo central foi a ampliação e adequação do procedimento e programa computacional baseado no programa comercial MSC.PATRAN, para a geração automática de modelos

Peça de mão de alta rotação pneumática com sistema Push Button (botão para remoção de broca), podendo apresentar passagem dupla de ar e acoplamento para engate rápido

We hypothesized that resistance exercise in combination with whey protein ingestion alters the gene expression of proteins related to muscle protein synthesis ( mTOR )

The probability of attending school four our group of interest in this region increased by 6.5 percentage points after the expansion of the Bolsa Família program in 2007 and

Assim que existir um esboço concreto do guião sobre o qual se possa trabalhar, o produtor deve contratar o resto da equipa para produzir o filme e o diretor de

As doenças mais frequentes com localização na cabeça dos coelhos são a doença dentária adquirida, os abcessos dentários mandibulares ou maxilares, a otite interna e o empiema da

Para tanto, no intuito de comparar e identificar as melhores práticas que contribuam para o desempenho dos alunos na Prova Brasil, foram realizados os estudos de casos nas SMEs das

Extinction with social support is blocked by the protein synthesis inhibitors anisomycin and rapamycin and by the inhibitor of gene expression 5,6-dichloro-1- β-