NMDA receptor
Essential role of NMDA receptor channel ε4 subunit (GluN2D) in the effects of phencyclidine, but not methamphetamine.
... with NMDA receptor channels are related to altered risk for schizophrenia, and psychotic patients display changes in the levels of mRNA encoding NMDA receptors ...
7
Neonatal NMDA receptor blockade disrupts spike timing and glutamatergic synapses in fast spiking interneurons in a NMDA receptor hypofunction model of schizophrenia.
... neonatal NMDA receptor blockade remains a robust approach for modeling many schizophrenia-like behavioral deficits in animals ...neonatal NMDA receptor blockade simultaneously minimizes ...
11
NMDA receptor subunits in the adult rat hippocampus undergo similar changes after 5 minutes in an open field and after LTP induction.
... NMDA receptor subunits change during development and their synaptic expression is modified rapidly after synaptic plasticity induction in hippocampal ...GluN2B NMDA receptor subunits were ...
11
Dicholine succinate, the neuronal insulin sensitizer, normalizes behavior, REM sleep, hippocampal pGSK3 beta and mRNAs of NMDA receptor subunits in mouse models of depression
... insulin receptor sensitizer DS ame- liorates depressive-like features in mice whose induction was associated with chronic stress as well those which were ...of NMDA receptor subunit NR2A, the ...
18
Interaction of NMDA receptor and pacemaking mechanisms in the midbrain dopaminergic neuron.
... In this paper, we design a new mechanism for the differential responses of the DA neuron to applied depolarization and AMPA vs. NMDA receptor activation. The major distinction with the old mechanism is that ...
14
The ketamine analogue methoxetamine and 3- and 4-methoxy analogues of phencyclidine are high affinity and selective ligands for the glutamate NMDA receptor.
... the NMDA receptor is thought to be the key pharmacological feature underlying the actions of dissociative ...the NMDA receptor in radioligand binding assays, which may explain their ...
5
Conserved expression of the glutamate NMDA receptor 1 subunit splice variants during the development of the Siberian hamster suprachiasmatic nucleus.
... Autoradiographic films were scanned with a Hamamatsu CCD camera (Hamamatsu k.k., Hamamatsun-city, Japan) and ana- lyzed using Image J software. For each section the mean pixel density (measured as a grey-scale value from ...
13
Potentiation of NMDA receptor-dependent cell responses by extracellular high mobility group box 1 protein.
... The NMDAR potentiating activity identified at concentrations of HMGB1 close to those locally reached in vivo [32,33], acquires an important physiological significance for the different cell types expressing this ...
12
Acute NMDA receptor antagonism disrupts synchronization of action potential firing in rat prefrontal cortex.
... functional organization of cortical processing. Recent computa- tional studies have shown that the Fano factor of neuronal firing rates in simulated cortical networks is inversely related to the clustering of unit ...
10
A NMDA receptor antagonist, MK-801 impairs consolidating extinction of auditory conditioned fear responses in a Pavlovian model.
... AMPA, NMDA and KA types) change on the membranes of synaptic site (majorly post-synaptic) is believed to contribute to establishing short-term learning [28,29] (also personal communication with R Shigemoto and Y ...
7
Delineating the GRIN1 phenotypic spectrum: a distinct genetic NMDA receptor encephalopathy
... Spectrum and clustering of GRIN1 mutations. All 16 dif- ferent de novo mutations identified in the 23 novel and published cases are missense alterations and cluster within or in close proximity to the transmembrane do- ...
9
Psicose em doente de 15 anos secundária a encefalite anti receptores de NMDA
... anti-NMDA receptor encephalitis), reported that hippocampal volumetric and microstructural impair- ments correlate with memory performance [27], in our patient, we did not perform any further imaging study ...
6
Neonatal disruption of serine racemase causes schizophrenia-like behavioral abnormalities in adulthood: clinical rescue by d-serine.
... of NMDA receptor related, neurodevelopmental processes playing a critical role in both normal brain development and schizophrenia, it is plausible that adult mice neonatally exposed to Met-Phen, may ...
8
Cloning and sequencing of c-DNA encoding N-methyl-D-aspartate receptor subunit-1 in the hypothalamus of male sheep
... the NMDA receptor c-DNA were sequenced (Becker/Coulter CEQ2000XL8 capillary DNA sequencer) using the F3 (5’ CAATTAACCCTCACTAAAGG) and F7 (5’ TAATACGACTCACTATAGGG) primers and dye- terminator chemistry at ...
5
Clinics vol.66 suppl.1
... by NMDA receptors. A hypofunction of the NMDA receptor bearing on inhibitory GABAergic interneurons gives rise to reduced GABAergic inhibitory ...an NMDA receptor hypofunction and a ...
7
Exon silencing by UAGG motifs in response to neuronal excitation.
... the NMDA receptor channel opens in response to membrane depolarization and serves as the major conduit for calcium entry into ...Because NMDA receptors are functionally intact in neurons in these ...
18
Dement. neuropsychol. vol.7 número3
... In conclusion,he anti-NMDA encephalitis case re- ported was consistent with those reported in the litera- ture, except for the fact that the patient did not pres- ent seizures and exhibited serologic presence of ...
4
Arq. NeuroPsiquiatr. vol.55 número4
... Collectively, the experiments reported in the present study suggest that: (1) a NMDA receptor-dependent mechanism in brain areas other than the hippocampus is involved in the enhancemen[r] ...
1
Rev. Bras. Anestesiol. vol.67 número6
... In our institution, she was given intravenous methylpred- nisolone for five days while being continued on intravenous acyclovir, lamotrigine and risperidone. Her behavioral abnormalities and seizures persisted. Her serum ...
4
Psychol. Neurosci. vol.3 número1
... of NMDA injected into the same structure, suggesting a modulatory role for NO in defensive behavior induced by glutamate NMDA receptor activation within the dPAG (Carvalho-Netto et ...
8