typical and atypical enteropathogenic Escherichia coli (EPEC)
Typical and atypical enteropathogenic Escherichia coli bacterial translocation associated with tissue hypoperfusion in rats
... intestine and the mecha- nisms they use to overcome the mucosal epithelial barrier remain to be ...function and to support translocation across M cells ...
8
Prevalence and Characteristics of the O122 Pathogenicity Island in Typical and Atypical Enteropathogenic Escherichia coli Strains
... Karmali et al. (10) demonstrated that the severity of disease caused by STEC and EHEC is due to the association of PAI genes. Another study describing PAI O122 genes in outbreak- associated non-O157:H7 STEC ...
4
Characterization of atypical enteropathogenic Escherichia coli strains that express typical localized adherence in HeLa cells in the absence of the bundle-forming pilus
... phenotypic and genotypic traits, Vieira et ...published and new data with regard to various virulence traits. The origin and properties of the nine strains studied are presented in Table ...diarrhea ...
4
Fimbrial Adhesins Produced by Atypical Enteropathogenic Escherichia coli Strains
... of typical EPEC strains to cultured epithelial cells ...intimin and Tir, flagella (in the case of motile strains), the EspA fiber, and the ...E. coli common pilus (ECP) (8, 15, ...
9
Atypical enteropathogenic Escherichia coli strains: Phenotypic and genetic profiling reveals a strong association between enteroaggregative E-coli heat-stable enterotoxin and diarrhea
... most atypical enteropathogenic Escherichia coli (EPEC) strains are ...118 typical and atypical strains of EPEC serotypes and non-EPEC serogroups isolated from ...
10
The Flagella of an Atypical Enteropathogenic Escherichia coli Strain Are Required for Efficient Interaction with and Stimulation of Interleukin-8 Production by Enterocytes in Vitro
... some typical enteropathogenic Escherichia coli (EPEC) strains to adhere to, invade, and increase interleukin-8 (IL-8) production in intestinal epithelial cells in vitro has been ...with ...
8
Adherence Factors in Atypical Enteropathogenic Escherichia coli Strains Expressing the Localized Adherence-Like Pattern in HEp-2 Cells
... Atypical enteropathogenic Escherichia coli (aEPEC) strains are increasingly recognized as an emerging pathotype respon- sible for childhood diarrhea in many countries (2–4, 19, ...23). ...
5
MOLECULAR IDENTIFICATION OF ENTEROPATHOGENIC ESCHERICHIA COLI (EPEC) ASSOCIATED WITH INFANT DIARRHEA IN LONDRINA, PARANA, BRAZIL
... of enteropathogenic Escherichia coli (EPEC) in children in Londrina-PR, Brazil, was evaluated by means of digoxigenin-labelled DNA probes which identify the plasmid responsible for EPEC adherence ...
6
Identification and characterization of the locus for diffuse adherence, which encodes a novel afimbrial adhesin found in atypical enteropathogenic Escherichia coli
... human and animal infections (27, ...attachment and effacement (38). Multiple factors, in- cluding Bfp, flagella, and the LEE-encoded proteins, have been implicated in adherence in typical EPEC ...
13
Adhesin-Encoding Genes from Shiga Toxin-Producing Escherichia coli Are More Prevalent in Atypical than in Typical Enteropathogenic E. coli
... E. coli (EHEC), a subgroup of the Shiga toxin-producing E. coli (STEC) pathotype ...EHEC and other pathogenic E. coli (26, 27); ToxB (EHEC pO157 plasmid-encoded protein), which is involved in ...
4
Distribution of tccP in clinical enterohemorrhagic and enteropathogenic Escherichia coli isolates
... the atypical EPEC serogroups indicate that, with the exception of serotype O55:H7, the prevalence of tccP is low ...the typical EPEC stains, tccP is most prevalent in serotype O119: ...EPEC and EHEC ...
6
Escherichia coli strains of serotype O51 : H40 comprise typical and atypical enteropathogenic E. coli strains and are potentially diarrheagenic
... Enterohemorrhagic Escherichia coli (EHEC) and entero- pathogenic E. coli (EPEC) comprise two of the six diarrhea- genic ...E. coli pathotypes ...EHEC and EPEC share the ability ...
4
Search for cytolethal distending toxin production among fecal Escherichia coli isolates from Brazilian children with diarrhea and without diarrhea
... enlargement and death of some cultured eukaryotic cell lines by causing an irreversible blockage of the cell division cycle at the stage immediately before mitosis (6, ...(6), and three closely linked genes ...
3
Pesquisa de Staphylococcus aureus, Salmonella e Escherichia coli em superfícies de latas de cerveja e refrigerante
... (1ª semeadura + 2ª semeadura) / diluição. A análise microbiológica foi realizada em duplicata totalizando 96 placas. Para isolamento de Staphylococcus aureus utilizou- se o meio Agar Manitol Salgado (37 ºC por 48 horas) ...
8
Análise, in vitro, da redução de endotoxinas em canais radiculares contaminados, após o emprego de sistemas de gás ozônio e eletrofulguração
... cattle and bovine by-products, making researchers look for ways to solve this zoonosis by means of specific slaughtering practices and carcass decontami- nation ...[39] and confinement environ- ment ...
101
Intestinal cell migration damage induced by enteropathogenic Escherichia coli strains
... Enteropathogenic Escherichia coli (EPEC) was recently associated with higher risk of infant death in a multicenter case-control study on diarrhea in developing countries ...symptomatic and ...
10
Detection and genetic analysis of the enteroaggregative Escherichia coli heat-stable enterotoxin (EAST1) gene in clinical isolates of enteropathogenic Escherichia coli (EPEC) strains
... water, and boiled for 10 ...gene, and EAST12b (R- 5’CTGCTGGCCTGCCTCTTCCGT) located 20 nucle- otides downstream from the stop TGA sequence of the astA gene ...55°C, and polymerization for 120 s at ...
6
Concurrent infection in a dog and colonization in a child with a human enteropathogenic Escherichia coli clone
... adults and animals are immune to enteritis caused by enteropathogenic Escherichia coli (EPEC), a common agent of infantile diarrhea in some developing countries ...cells and to induce ...
3
Adriana Hamond Regua Mangia+ , Eliana Barreto Bergter, Lúcia Martins Teixeira, Fernando Costa e Silva Filho
... residues and neutral sugars such as phosphate, glucose, mannose, rhamnose, galactose, ribose and fucose are in accordance with previous reports which described such residues as components of repeating units ...
6