R E S E A R C H A R T I C L E
Open Access
Detection and genetic analysis of the
enteroaggregative
Escherichia coli
heat-stable
enterotoxin (EAST1) gene in clinical isolates of
enteropathogenic
Escherichia coli
(EPEC) strains
Lucas EP Silva
1, Tamara B Souza
1, Neusa P Silva
2and Isabel CA Scaletsky
1*Abstract
Background:The enteroaggregativeE. coliheat-stable enterotoxin 1 (EAST1) encoded byastAgene has been
found in enteropathogenicE. coli(EPEC) strains. However, it is not sufficient to simply probe strains with anastA gene probe due to the existence ofastAmutants (type 1 and type 2 SHEAST) and EAST1 variants (EAST1 v1-4). In this study, 222 EPEC (70 typical and 152 atypical) isolates were tested for the presence of theastAgene sequence by PCR and sequencing.
Results:TheastAgene was amplified from 54 strains, 11 typical and 43 atypical. Sequence analysis of the PCR
products showed that 25 strains, 7 typical and 18 atypical, had an intactastAgene. A subgroup of 7 atypical strains had a variant type of theastAgene sequence, with four non-synonymous nucleotide substitutions. The remaining 22 strains had mutatedastAgene with nucleotide deletions or substitutions in the first 8 codons. The RT-PCR results showed that theastAgene was transcribed only by the strains carrying either the intact or the variant type of the astAgene sequence. Southern blot analysis indicated thatastAis located in EAF plasmid in typical strains, and in plasmids of similar size in atypical strains. Strains carrying intactastAgenes were more frequently found in diarrheic children than in non-diarrheic children (p < 0.05).
Conclusion:In conclusion, our data suggest that the presence of an intactastAgene may represent an additional
virulence determinant in both EPEC groups.
Keywords:EAST1 gene,astAgene, EnteropathogenicEscherichia coli
Background
EnteropathogenicEscherichia coli(EPEC) are an
import-ant cause of infimport-ant diarrhea in developing countries [1]. The majority of EPEC isolates belong to classic serotypes derived from 12 classical O serogroups (O26, O55, O86, O111, O114, O119, O125, O126, O127, O128, O142, and O158) [2,3]. EPEC induces attaching and effacing (A/E) lesions on epithelial cells, characterized by micro-villi destruction, cytoskeleton rearrangement, and the formation of a pedestal-like structure at the site of bac-terial contact [4]. The A/E genes are localized to the locus
for enterocyte effacement (LEE) and encode intimin, a
type III secretion system, secreted proteins and the trans-located intimin receptor [5-7].
“Typical”EPEC strains (tEPEC) contain also the EPEC adherence factor (EAF) plasmid [8], which carries genes
encoding a regulator (per) [9] and the bundle-forming
pili (BFP) [10]. EPEC strains lacking the EAF plasmid have been designated “atypical” EPEC (aEPEC) [11]. Re-cent epidemiological studies indicate that aEPEC are more prevalent than tEPEC in both developed and developing countries [1]. Some aEPEC strains are genetically related
to the enterohemorrhagic E. coli (EHEC), and both are
considered as emerging pathogens [12].
Typical EPEC strains express only the virulence factors encoded by the LEE region and the EAF plasmid, with
* Correspondence:[email protected]
1Departamento de Microbiologia, Imunologia e Parasitologia, Universidade
Federal de São Paulo, Rua Botucatu, 862, 3 andar, 04023-062 São Paulo, Brazil Full list of author information is available at the end of the article
the exception of the cytolethal distending toxin pro-duced by O86:H34 strains and the enteroaggregative heat-stable enterotoxin 1 (EAST1) found in O55:H6 and O127:H6 strains. In contrast, aEPEC strains frequently express EAST1 and additional virulence factors not encoded by LEE region [12]. In a previous study [13], EAST1 was the most frequent (24%) virulence factor found in a collection of 65 aEPEC strains, and was sig-nificantly associated with children diarrhea.
EAST1-positive aEPEC strains have been associated with outbreaks of diarrhea involving children and adults in the United State [14] and Japan [15]. However, it is not sufficient to simply probe strains with anastAgene probe due to the existence of EAST1 variants [16]. In one study, 100% of the O26, O111, O145, and O157:H7
enterohemorrhagic E. coli (EHEC) strains examined
carried DNA sequences homologous to the EAST1 gene (SHEAST) with two different mutation types. Type 1 SHEAST has 12 nucleotide non-synonymous substitutions including one in the initiation codon; type 2 SHEAST lacks the first 8 codons of EAST1 se-quence [16]. The focus of the study was to investigate
the astA gene sequence present in tEPEC and aEPEC
strains. The strains were collected in different cities of Brazil in different periods of time and in a previous
study poor relatedness was observed by RAPD analysis of 118 strains belonging to this collection [13].
Results and discussion
We examined 222 EPEC strains (70 typical and 152 atypical) for the presence of theastAgene by PCR using primers that anneal to the 5’ends of the EAEC 042astA gene sequence [16]. Those strains were isolated from diarrheic and non diarrheic Brazilian children in previous studies [17-20]. As shown in Table 1, 11 (16%) tEPEC and 43 (28%) aEPEC strains were positive in the PCR assay. Among the aEPEC PCR-positive strains, 13 belonged to the O26 and O119 serogroups.
The 54 astA gene PCR products were sequenced.
Twenty five strains, 7 tEPEC and 18 aEPEC, carried the DNA sequence identical to the EAST1 gene (042-type EAST1) (Figure 1). A subgroup of 7 aEPEC strains pre-sented a variant type of the 042-type EAST1 gene sequence, with four non-synonymous nucleotide substitutions. Nine other strains, including one typical, carried either the sequence identical to type 1 SHEAST (7 strains) or to type 2 SHEAST (two strains). The remaining 13 strains carried mutated sequences of the 042-type EAST1 (five
strains),type 1 SHEAST (two strains) or type 2 SHEAST
(six strains) genes.
Table 1 EPEC-astAstrains isolated from diarrheic and non-diarrheic children
EPEC Serotype No. of strains (positive/total)
Diarrheic children Non-diarrheic children Total of children
tEPEC O55:NM;HND 0/13 0/1 0/14
O86:NM;H34 0/2 0 0/2
O111:NM;H2,HND 4/9 0 4/9
O119:NM;H6;HND 2/22 0/3 2/25
O127:NM;H6 0/1 2/3 2/4
Other serotypesa 3/14 0/2 3/16
Subtotal 9/61 2/9 11/70
aEPEC O26:H11;HND 6/10 0/2 6/12
O55:HND 2/3 1/2 3/5
O111:NM 2/2 1/2 3/4
O114:NM 0 0/1 0/1
O119:H2;HND 7/9 0/3 7/12
O126:NM 0/1 0 0/1
O127:NM;H40 0/3 0/1 0/4
O128:NM 0/3 0 0/3
O142:NM;H2 1/8 0 1/8
Other serotypesb 18/68 5/34 23/102
Subtotal 36/107 7/45 43/152
Total 45/168 9/54 54/222
aO2:H2;H45; O101:H33; O145:HND; O157:HND; O162:H33; ONT:H45; ONT:HND.
bO4:HND; O15:HND O33:H6; O35:H19; O37:HND; O49:HND; O61:HND; O63:HND; O79:HND; O85:H40; O96:HND; O98:HND; O101:NM; O103:NM; O105:H7; O108:H31;
The expression of EAST1 was examined by RT-PCR and quantitative RT-PCR. The RT-PCR results showed
that the astA gene was transcribed only by the strains
carrying either the intact or the variant type of theastA gene sequence (Figure 2). TheastAgene expression levels of the 32 RT-PCR positive strains (CT values ranged from 20.3 ± 0.11 to 21.6 ± 0.04) were nearly identical to that of EAEC 042 strain (CT value 20.8 ± 0.01).
Plasmids of the 54 PCR-positive strains were examined
for astA gene presence by Southern blot hybridization
with the astAprobe. In 23 (42.6%) strains, a single copy
of theastAgene was located to a large plasmid (Figure 3). In all the eleven tEPEC strains, theastAprobe hybridized to the EAF plasmid as previously reported [21], and in
twelve aEPEC theastA probe hybridized with large
plas-mids of similar size. The plasplas-mids of the remaining strains wereastAprobe negative.
We previously reported that 24% of 65 aEPEC strains hybridized with a DNA probe for EAST1 [13]. Here, we analyzed by PCR a larger group of EPEC, including typical strains and found that 11 (16%) of 70 tEPEC and 43 (28%) of 152 aEPEC wereastApositive. Sequence analysis of the
1 5 10 15 20 25 30 35 38
EPEC strains Met Pro Ser Thr Gln Tyr Ile Arg Arg Pro Ala Ser Ser Tyr Ala Ser Cys Ile Trp Cys Ala Thr Ala Cys Ala Ser Cys His Gly Arg Thr Thr Lys Pro Ser Leu Ala Thr Stop EAST1 ATG CCA TCA ACA CAG TAT ATC CGA AGG CCC GCA TCC AGT TAT GCA TCG TGC ATA TGG TGC GCA ACA GCC TGC GCT TCG TGT CAT GGA AGG ACT ACA AAG CCG TCA CTC GCG ACC TGA
T4, T34, T35, T46, T47, T57,
. . . . T70, A1, A3, A30, A46, A57
A59, A62, A66, A68, A78, A90, A101, A102, A105, A115, A127, A140, A151 A16, A23, A47, A120
. . . . T . . . G . . . C . . . A . . . . A122, A139, A152
A64, A65 TGT . T . . . G . . . . T41 . . . A . . . A . T . . C . . . GC. . . CG C . . . * * * * * * * * * * * * * * * * * * . . . . C . . . T . . . . T43 . . T GA . AG . .TT . . . A . . . A . . * * * * * * * * * * * * * * * * * . . C . . . T . . . . T60 TGA AAG .TT . .C . . A . . . CCA TC. T . . . .TA TGC AC . .TT * * * * * * * * * * . . . A . . . . C . . C . C . . . .
SHEAST1 ACG CTA TCA ACA CGG TGT ATC CGG AAG CCC GCA TCC AGC TGT GCA TCG TGC ATA TGG TGC GCA ACA GCC TGC GGT TCG TTT CCT GGA AGG ACT ACA AAG CCG TCA CCC GCG ACC TGA T2, A14, A28, A63
. . . . A84, A99, A147
A4 . . . * * * * * * * * * CC . T . . . A . CT . GTC A38 . . . TAC GTT . . . * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * *
SHEAST2 * * * * * * * * * * * * * * * * * * * * * * * * AGG CCC GCA TCC AGT TAT GCA TCG TGC ATA TGG TGC GCA ACA GCA TGC GCT TCG TGT CAT GGA AGG AAT ACA AAG CCG TCA * * * * CG CCC TGA A69, A72 . . . . A71, A81, A131 . . . * * * . . . . A83 . . . * * * * * * C. .. . . G . . . CAG . . . . T . . C . . . C . . . . A75 . . . * * * **G . C . . . A . . . . A149 . . . * * * * * * * * * * * * * * * * * * * * * . T . . . C . . . .
Figure 1Nucleotide sequences of the PCR products from tEPEC (T) and aEPEC (A) strains.The nucleotide sequences of the EAST1, SHEAST1 and SHEAST2 genes are shown for comparison. Identical nucleotides are shown as dots. Asterisks indicate the positions of nucleotide deletion.
PCR products showed that 7 (63.6%) of 11 tEPEC and 18 (41.9%) of 43 aEPEC had an intact 042-typeastAgene.
As shown in Table 2, strains carrying intact astAgene were more frequently found in diarrheic children than in non-diarrheic children (p = 0.03, Fisher’s exact test). However, we should point out that among the 222
strains analyzed only 118 were collected from a case–
control study [13].
The EAST1 gene family includes one major type of se-quence, i.e. theastAof EAEC strain 042 that is widely
dis-tributed among different diarrheagenic E. coli strains
[21-26] and four variant types of EAST1, i.e. the EAST1v1
of EAEC 17–2 [21,22], EAST1v2 of EPEC N1 [21], and
EAST1v3 and EAST1v4 ofE. coliO166:H15 [25].
In this study, a subgroup of aEPEC strains had a new variant type of EAST1 gene sequence that differed from those previously reported, and was denominated EAST1v5
(Figure 4). The RT-PCR analysis showed that EAST1v5 was transcribed to produce mRNA. However, more stud-ies are necessary to determine whether EAST1v5 is associ-ated with a functional polypeptide toxin.
Conclusion
In conclusion, our data suggest that the presence of an
intact astA gene may represent an additional virulence
determinant in both EPEC groups.
Methods
Bacterial strains
The 222 EPEC strains examined in this study included 176 strains isolated in 1999 to 2004 during an epidemio-logical study of acute diarrhea in children <2 years of age conducted in different regions of Brazil, and 46 strains isolated from children <5 years of age with diarrhea in 98 KDa
42 KDa 24 KDa
4.6 KDa
98 KDa
42 KDa 24 KDa
4.6 KDa 98 KDa
42 KDa 24 KDa
4.6 KDa
Figure 3Southern blot hybridization of the plasmids of tEPEC (T) and aEPEC (A) strains. (A)and(C)Hybridization results with theastA
probe.(B)Hybridization results with the EAF probe. EAEC 042 and EPEC E2348/69 were used as positive controls (C+) forastAand EAF probes, respectively. The arrows in panelsAandCindicate the pAA2 plasmid (65-MDa) for EAEC 042 strain and the arrow in panelBindicate the EAF plasmid (60-MDa) for EPEC E2348/69 strain. Molecular size standard bands are at left.
Table 2 Sequences of theastAgene found in EPEC strains isolated from diarrheic and non-diarrheic children
astAgene sequence
type
N (%) of strains from: Serogroup (n)
Diarrheic children Non-diarrheic children
042-type EAST1 24 (14.3) 1 (1.8)a O9 (1), O33 (2), O108 (2), O111 (1), O119 (8), O142 (1), O152 (1),
O157 (1), O169 (1), OND (7)
EAST1v5 6 (3.6) 1 (1.8) O26 (1), O9 (1), O96 (1) O111 (1), O141 (1), ONT (2)
type 1 SHEAST 6 (3.6) 1 (1.8) O26 (1), O55 (1), O103 (1), O153 (1), OND (3)
type 2 SHEAST 2 (1.2) 0 O26 (1), O55 (1)
mutant 7 6 O26 (3), O55 (1), O111 (5), O119 (1), O127 (2), ONT (1)
Total 45 9
a
São Paulo between 2002 to 2003 [17-20]. All strains were characterized as tEPEC or aEPEC by hybridization
witheaeand EAF probes and serotyped (Table 1).
Ethics statement
The study was approved by the ethics committee of the Universidade Federal de São Paulo, Brazil. Stool samples were obtained with the written informed consent from the parents or guardians of the children.
PCR assays
For template DNA preparation, three to five isolated bacterial colonies grown on LB agar plates were pooled, suspended in 300μl of sterile distilled water, and boiled for 10 min. PCR was carried out in a total volume of
25-μl containing 5 μl of template DNA. PCR primers
were EAST13a (F-5’AGAACTGCTGGGTATGTGGCT)
located 110 nucleotides upstream from the initiation
ATG sequence of the astA gene, and EAST12b
(R-5’CTGCTGGCCTGCCTCTTCCGT) located 20
nucle-otides downstream from the stop TGA sequence of the
astA gene [26]. Cycling conditions were denaturation
for 30 s at 95°C, annealing for 120 s at 55°C, and polymerization for 120 s at 72°C (30 cycles). PCR prod-ucts were analyzed by 2% agarose gel electrophoresis.
DNA hybridization
The following probes were used in this study: astA, a
111-bp PCR product from EAEC 042 strain with the
pri-mer set EAST11a (5’-CCATCAACACAGTATTCCGA)
and EAST12b (5’-GGTCGCGAGTGACGGCTTTGT)
[26]; and EAF, a 1.0 kb BamHI-SalI fragment from
plasmid pMAR2 [27]. The DNA fragments were
puri-fied, labeled with [α-32P] dCTP with a DNA labeling
kit (Amersham Pharmacia Biotech Inc., EUA) and used as probes. For Southern blotting, plasmid DNA was ex-tracted using the method of Birnboim and Doly [28], separated in 0.8% agarose gel electrophoresis, and transferred to a nylon membrane, following a standard protocol [29]. Blots were hybridized in a solution con-taining the labeled probe (105cpm), 5 × standard saline
citrate (SSC), 2 × Denhardt’s solution (Invitrogen),
0.1% sodium dodecyl sulfate (SDS), and 5 mg/ml of sal-mon sperm DNA for 16 h at 65°C. After hybridization, washes were done in aqueous solution with 2 × SSC with 0.1% SDS and exposed to X-ray film.
RNA extraction and RT-PCR assays
Total RNA was extracted after bacterial growth in LB broth for 18 h at 37°C with the RNase Mini extraction
kit (Qiagen) according to the manufacturer’s
instruc-tions. After extraction, approximately 1μg of total RNA was digested with DNase I (Qiagen) for 30 min at 37°C,
and the enzyme was then inactivated by adding 1 μl of
25 mM EDTA and heating the solution at 65°C for 10 min. To obtain the cDNA, the SperScript III One
Step RT-PCR System with Platinum TaqDNA
polymer-ase (Invitrogen) was used according to the manufac-turer’s specifications. Primers for 16S ribosomal protein were used to control PCR [30], and the assay was then carried out with the primers EAST11a and EAST11b [26]. PCR products were analyzed by 2% agarose gel electrophoresis.
Quantitative PCR was performed in a Mastercycler ep realplex4(Eppendorf ), and threshold cycle numbers were determined using Eppendorf realplex software (version 2.0). Reactions were performed in triplicate, and thresh-old cycle numbers were averaged. The 50-μl reaction
mixture was prepared as follows: 25 μl of Platinum®
Quantitative PCR SuperMix-UDG (Invitrogen), 10 μM
of the Taqman probe (5’FAM-TGCATCGTGCATATG
GTGCGCAA) and 10 μM of each primer (R-5’GCG
AGTGACGGCTTTGTAG and F-5’GAAGGCCCGCA
TCCAGTT), and 10μl of cDNA (100 ng). The reaction
consisted of: 2 min at 48°C; 10 min at 95°C followed by 40 cycles of 15 s at 95°C, 1 min at 60°C, and 1 min at
72°C. The astA expression of the tested strains was
compared to theastAexpression of EAEC 042,
accord-ing to the formula, 2(−ΔΔCt)[31].
DNA sequencing
Nucleotide sequencing of the PCR products was per-formed at the Centro de Estudos do Genoma Humano-USP, São Paulo. Nucleotide sequence data were analyzed using SeqMan and MegAlign software and the BLAST tool (http://www.ncbi.nlm.nih.gov/BLAST).
Statistical analysis
Data for diarrheic and non diarrheic children were compared using a 2-tailed Chi-square test. Results with p values≤0.05 were considered to be statistically significant.
Strain 1 5 10 15 20 25 30 35
EAST1 ATG CCA TCA ACA CAG TAT ATC CGA AGG CCC GCA TCC AGT TAT GCA TCG TGC ATA TGG TGC GCA ACA GCC TGC GCT TCG TGT CAT GGA AGG ACT ACA AAG CCG TCA CTC
EAST1v1 . . . A . . . . EAST1v2 . . . A . . . G . . . . EAST1v3 . . . C . . . A . . . A . . . . EAST1v4 . . . G . . . .
. . . . T . . . .. . G . . . .. . C . . . A .. . . . A122, A139, A152 EAST1v5 . . . .
96-127-23 plasmid EAEC 042 EAEC 17-2 EPEC N1 96-127-23 chromosome
A16, A47, A102, A120
38
GCG ACC TGA
. . . . . . . . . . . . . . . . . . . .
Nucleotide sequence and accession number
The EAST1v5 gene sequence was deposited in the NCBI database under accession number KJ47188.
Competing interests
The authors declare that they have no competing interests.
Authors’contributions
LEPS and TBS performed experiments and analyzed data. NPS and ICAS wrote the manuscript. All authors read and approved the final manuscript.
Acknowledgments
This study was supported by research grants from Fundação de Amparo a Pesquisa do Estado de São Paulo (FAPESP) and Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq). We thank Dr. Renata Torres de Souza for her help with the nucleotide sequence deposition.
Author details
1Departamento de Microbiologia, Imunologia e Parasitologia, Universidade
Federal de São Paulo, Rua Botucatu, 862, 3 andar, 04023-062 São Paulo, Brazil.2Disciplina de Reumatologia, Universidade Federal de São Paulo, São
Paulo, Brazil.
Received: 29 January 2014 Accepted: 23 May 2014 Published: 30 May 2014
References
1. Ochoa TJ, Contreras CA:EnteropathogenicEscherichia coliinfection in children.Curr Opin Infect Dis2011,24:478–483.
2. WHO:Programme for Control of Diarrhoeal Diseases, Manual for Laboratory Investigation of Acute Enteric Infections.Geneva: World Health Organization; 1987.
3. Nataro JP, Kaper JB:DiarrheagenicEscherichia coli.Clin Microbiol Rev1998, 11:142–201.
4. Moon HW, Whipp SC, Argenzio RA, Levine MM, Gianella RA:Attaching and effacing activities of rabbit and human enteropathogenicEscherichia coli in pig and rabbit intestines.Infect Immun1983,41:1340–1351.
5. Jerse AE, Yu J, Tall BD, Kaper JB:A genetic locus of enteropathogenic Escherichia colinecessary for the production of attaching and effacing lesions on tissue culture cells.Proc Natl Acad Sci U S A1990,87:7839–7843. 6. Jarvis KG, Girón JA, Jerse AE, McDaniel TK, Donnenberg MS, Kaper JB:
EnteropathogenicEscherichia colicontains a putative type III secretion system necessary for the export of proteins involved in attaching and effacing lesion formation.Proc Natl Acad Sci U S A1995,92:7996–8000. 7. Kenny B, DeVinney R, Stein M, Finlay BB:EnteropathogenicE. coli(EPEC)
transfers its receptor for intimate adherence into mammalian cells.
Cell1997,91:511–520.
8. Baldini MM, Kaper JB, Levine MM, Candy DC, Moon HW:Plasmid-mediated adhesion in enteropathogenicEscherichia coli.J Pediatr Gastroenterol Nutr
1983,2:534–539.
9. Gómez-Duarte OG, Kaper JB:A plasmid-encoded regulatory region activates chromosomeeaeA expression in enteropathogenicEscherichia coli.Infect Immun1995,63:1767–1776.
10. Girón JA, Ho AS, Schoolnik GK:An inducible bundle-forming pilus of enteropathogenicEscherichia coli.Science1991,254:710–713. 11. Kaper JB:Defining EPEC.Rev Microbiol São Paulo1996,27:130–133. 12. Trabulsi LR, Keller R, Gomes TAT:Typical and atypical Enteropathogenic
Eschericia coli(EPEC).Emerg Infect Dis2002,8:508–513.
13. Dulguer MV, Fabricotti SH, Bando SY, Moreira-Filho CA, Fagundes-Neto U, Scaletsky ICA:Atypical enteropathogenicEscherichia colistrains: phenotypic and genetic profiling reveals a strong association between enteroaggregativeE. coliheat-stable enterotoxin and diarrhea.J Infect Dis2003,188:1685–1694.
14. Hedberg CW, Savarino SJ, Besser JB, Paulus CJ, Thelen VM, Myers LJ, Cameron DN, Barret TJ, Kaper JB, Osterholm MT:An outbreak of foodborne illness caused byEscherichia coliO39:NM, an agent not fitting into the existing scheme for classifying diarrheogenicE. coli.J Infect Dis1997, 176:1625–1628.
15. Yatsuyanagi Y, Salto S, Miyajima T:Characterization of atypical enteropathogenicEscherichia colistrains harboring theastAgene that
were associated with a waterborne outbreak of diarrhea in Japan.
J Clin Microbiol2003,41:2033–2039.
16. Yamamoto T, Taneike I:The sequences of enterohemorrhagicEscherichia coliandYersinia pestisthat are homologous to the enteroaggregative E. coliheat-stable enterotoxin gene: cross-species transfer in evolution.
FEBS Lett2000,472:22–26.
17. Scaletsky ICA, Fabbricotti SH, Aranda KR, Morais MB, Fagundes-Neto U: Comparison of DNA hybridization and PCR assays for detection of putative pathogenic enteroadherentEscherichia coli.J Clin Microbiol2002, 40:1254–1258.
18. Scaletsky ICA, Fabbricotti SH, Silva SO, Morais MB, Fagundes-Neto U: HEp-2–adherentEscherichia colistrains associated with acute infantile diarrhea, São Paulo, Brazil.Emerg Infect Dis2002,8:855–858.
19. Araújo JM, Tabarelli GF, Aranda KR, Fabbricotti SH, Fagundes-Neto U, Mendes CM, Scaletsky ICA:Typical enteroaggregative and atypical enteropathogenic types ofEscherichia coli(EPEC) are the most prevalent diarrhea-associated pathotypes among Brazilian children.J Clin Microbiol
2007,45:3396–3399.
20. Scaletsky ICA, Aranda KR, Souza TB, Silva NP, Morais MB:Evidence of pathogenic subgroups among atypical enteropathogenicEscherichia coli strains.J Clin Microbiol2009,47:3756–3759.
21. Yamamoto T, Wakisaka N, Sato F, Kato A:Comparison of the nucleotide sequence of enteroaggregativeEscherichia coliheat-stable enterotoxin 1 genes among diarrhea-associatedEscherichia coli.FEMS Microbiol Lett
1997,147:89–96.
22. Savarino SJ, McVeigh A, Watson J, Cravioto A, Molina J, Echeverria P, Bhan MK, Levine MM, Fasano A:EnteroaggregativeEscherichia coliheat-stable enterotoxin is not restricted to enteroaggregativeE. coli.J Infect Dis1996, 173:1019–1022.
23. Sousa CP, Dubreuil JD:Distribution and expression of theastAgene (EAST1 toxin) inEscherichia coliandSalmonella.Int J Med Microbiol2001, 291:15–20.
24. Savarino SJ, Fasano A, Watson J, Martin BM, Levine MM, Guandalini S, Guerry P:EnteroaggregativeEscherichia coliheat-stable enterotoxin 1 represents another subfamily ofE. coliheat-stable toxin.Proc Natl Acad Sci U S A1993,90:3093–3097.
25. Zhou Z, Ogasawara J, Nishikawa Y, Seto Y, Helander A, Hase A, Iritani N, Nakamura H, Arikawa K, Kai A, Kamata Y, Hoshi H, Haruki K:An outbreak of gastroenteritis in Osaka, Japan due toEscherichia coliserogroup O166: H15 that had a coding gene for enteroaggregativeE. coliheat-stable enterotoxin 1 (EAST1).Epidemiol Infect2001,128:363–371.
26. Yamamoto T, Echeverria P:Detection of the enteroaggregativeEscherichia coliheat- stable enterotoxin 1 gene sequences in enterotoxigenicE. coli strains pathogenic for humans.Infect Immun1996,64:1441–1445. 27. Nataro JP, Baldini MM, Kaper JB, Black RE, Bravo N, Levine MM:Detection of
an adherence factor of enteropathogenicEscherichia coliwith a DNA probe.J Infect Dis1985,152:560–565.
28. Birnboim HC, Doly J:A rapid alkaline extraction procedure for screening recombinant plasmid DNA.Nucleic Acids Res1979,247:1513–1523. 29. Sambrook J, Fritsch EF, Maniatis T:Molecular Cloning: A Laboratory Manual.
2nd edition. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press; 1989.
30. Leverton LQ, Kaper JB:Temporal expression of enteropathogenic Escherichia colivirulence genes in an in vitro model of infection.
Infect Immun2005,73:1034–1043.
31. Livak KJ, Schmittgen TD:Analysis of relative gene expression data using real-time quantitative PCR and the 2(−Delta Delta C(T)) method.
Methods2001,25:402–408. doi:10.1186/1471-2180-14-135
Cite this article as:Silvaet al.:Detection and genetic analysis of the
enteroaggregativeEscherichia coliheat-stable enterotoxin (EAST1) gene