Role in Gastrointestinal Colonization and Systemic
Spread of
Salmonella enterica
serovar Typhimurium in
the Chicken
David Pezoa1, Hee-Jeong Yang2, Carlos J. Blondel1, Carlos A. Santiviago1, Helene L. Andrews-Polymenis2*, Ine´s Contreras1*
1Departamento de Bioquı´mica y Biologı´a Molecular, Facultad de Ciencias Quı´micas y Farmace´uticas, Universidad de Chile, Santiago, Chile,2Department of Microbial and Molecular Pathogenesis, Texas A&M University System Health Science Center, College of Medicine, College Station, Texas, United States of America
Abstract
The role of theSalmonellaPathogenicity Islands (SPIs) in pathogenesis ofSalmonella entericaTyphimurium infection in the chicken is poorly studied, while many studies have been completed in murine models. The Type VI Secretion System (T6SS) is a recently described protein secretion system in Gram-negative bacteria. The genus Salmonella contains five phylogenetically distinct T6SS encoded in differentially distributed genomic islands. S. Typhimurium harbors a T6SS encoded in SPI-6 (T6SSSPI-6), which contributes to the ability ofSalmonellato colonize mice. On the other hand, serotype Gallinarum harbors a T6SS encoded in SPI-19 (T6SSSPI-19) that is required for colonization of chicks. In this work, we investigated the role of T6SSSPI-6in infection of chicks byS.Typhimurium. Oral infection of White Leghorn chicks showed that aDT6SSSPI-6 mutant had reduced colonization of the gut and internal organs, compared with the wild-type strain. Transfer of the intact T6SSSPI-6gene cluster into the T6SS mutant restored bacterial colonization. In addition, our results showed that transfer of T6SSSPI-19fromS. Gallinarum to theDT6SSSPI-6mutant ofS.Typhimurium not only complemented the colonization defect but also resulted in a transient increase in the colonization of the cecum and ileum of chicks at days 1 and 3 post-infection. Our data indicates that T6SSSPI-6contributes to chicken colonization and suggests that both T6SSSPI-6 and T6SSSPI-19perform similar functionsin vivodespite belonging to different phylogenetic families.
Citation:Pezoa D, Yang H-J, Blondel CJ, Santiviago CA, Andrews-Polymenis HL, et al. (2013) The Type VI Secretion System Encoded in SPI-6 Plays a Role in Gastrointestinal Colonization and Systemic Spread of Salmonella enterica serovar Typhimurium in the Chicken. PLoS ONE 8(5): e63917. doi:10.1371/ journal.pone.0063917
Editor:Dipshikha Chakravortty, Indian Institute of Science, India
ReceivedJanuary 25, 2013;AcceptedApril 9, 2013;PublishedMay 14, 2013
Copyright:ß2013 Pezoa et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Funding:This work was supported by grant 1100092 from Fondo Nacional de Desarrollo Cientı´fico y Tecnolo´gico (FONDECYT), Chile. CJB was supported by Postdoctoral Fellowship 3120175 from FONDECYT. David Pezoa was supported by fellowships from FULBRIGHT, ‘‘Beca Doctorado Nacional 2009’’ CONICYT (Nu21090041), ‘‘Beca de Apoyo a la Realizacio´n de Tesis Doctoral 2012’’ CONICYT (NuAT-21121297) and from ‘‘Beca de Pasantı´as Doctorales en el Extranjero 2011’’ CHILE GRANT (Nu75110062 BCH-3). CAS was supported by grant 1110172 from FONDECYT. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Competing Interests:The authors have declared that no competing interests exist.
* E-mail: [email protected] (IC); [email protected] (HAP)
Introduction
NontyphoidalSalmonellagastroenteritis has an estimated global burden of 93.8 million cases per year, of which 80.3 million cases are likely to be food-borne [1]. The most prevalent serovars responsible for food-borne salmonellosis are S. enterica serovar Enteritidis and S. enterica serovar Typhimurium [2]. Salmonella enterica serovar Typhimurium (S. Typhimurium) is a broad host-range pathogen able to infect humans, mice and birds. In mice, this serovar causes a systemic infection similar to human typhoid fever that results from infection with serovar Typhi (as well as Paratyphi A, B, and C) [3,4]; for this reason the murine model has been widely used to study the pathogenesis ofSalmonellainfection. In humans however,S.Typhimurium causes self-limiting gastro-enteritis characterized by abdominal pain, vomiting and inflam-matory diarrhea [5]. In contrast, this pathogen is able to colonize the chicken without clinical symptoms, and is thus a major vehicle for transmission of salmonellosis to humans.
Studies conducted using murine models of infection andin vitro
cell culture systems have identified numerous genes required to establish a successful infection byS.Typhimurium. Most genes are clustered in genomic islands known as Salmonella Pathogenicity Islands (SPIs) [6–10]. Of the five SPIs (SPI-1 to SPI-5) common to all serovars ofSalmonella enterica, the SPI-1 and SPI-2 are the two major virulence determinants of Salmonella. Each of these SPIs encodes two different type III secretion systems (T3SS) that deliver effector proteins directly into the cytoplasm of eukaryotic cells [11,12]. The T3SSSPI-1is mainly involved in invasion of intestinal epithelial cells [13,14] but it is also required for intracellular proliferation and for the biogenesis of the Salmonella containing vacuole inside infected cells [15,16]. The T3SSSPI-2is essential for survival within phagocytic cells and systemic infection [17].
Studies on the role of the SPIs in the pathogenesis of S.
study showed that neither T3SSSPI-1nor T3SSSPI-2is critical for colonization of chickens [9]. One report directly compared the intestinal and systemic colonization ofSalmonella-resistant mice and one-week-old chickens by S.Typhimurium [22]. Infected chicks had very few organisms in internal organs and no symptoms of systemic effects, while in mice, spleen and liver were colonized by bacteria and showed significant enlargement. Furthermore, colonization of the intestine had a different dynamic in the chicken versus the mice models of infection, as SPI-1 was important for association to the intestinal epithelium of the chicken rather than for invasion, as is the case in mice [22]. From these studies, it is evident that the murine model has a limited applicability toSalmonellainfection of the chicken, and that genes in addition to the highly conserved SPIs are required for chicken colonization and systemic spread.
Type VI secretion systems participate in a variety of different processes, ranging from inter-bacterial relationships to pathogen-esis [23–27]. Gram-negative bacteria carrying T6SS clusters include human, animal and plant pathogens [28–34]. The genus
Salmonellacontains five phylogenetically distinct T6SS loci; four of them are differentially distributed among serovars of S. enterica, while the fifth T6SS is present inS. bongori[35,36]. Two of these clusters, T6SSSPI-6and T6SSSPI-19, have been linked toSalmonella pathogenesis. T6SSSPI-6is required for intracellular replication in macrophages and systemic dissemination in mice byS. Typhimur-ium [37–41] andS.Typhi [29], while T6SSSPI-19contributes to colonization of the gastrointestinal tract and internal organs of chickens byS.Gallinarum strain 287/1 [42].
In this study we have investigated the contribution of T6SSSPI-6 toS.Typhimurium ability to colonize the gastrointestinal tract and internal organs of White Leghorn chicks. We have also addressed whether T6SSSPI-19ofS.Gallinarum can rescue the colonization defect of aS. Typhimurium mutant lacking T6SSSPI-6. Through competitive index experiments we demonstrate that T6SSSPI-6is crucial to gastrointestinal colonization and systemic spread ofS.
Typhimurium in chicks. In addition, we show that transfer of T6SSSPI-19 restores the colonization defect of a mutant lacking T6SSSPI-6, indicating that both T6SS perform similar functions
in vivodespite belonging to different phylogenetic families.
Materials and Methods
Bacteria and Growth Conditions
The bacterial strains used in this work are listed inTable 1. Bacteria were routinely cultivated in LB broth (10 g/l tryptone, 5 g/l yeast extract, 5 g/l NaCl) at 37uC with aeration or on LB plates (15 g/l agar) supplemented with the appropriate antibiotic at the following concentrations: Ampicillin (Amp), 100mg/ml; Kanamycin (Kan), 50mg/ml; Chloramphenicol (Cam), 20mg/ml; Trimethoprim (Tm), 100mg/ml; Spectinomycin (Sp), 250mg/ml.
DNA Methods
DNA manipulations were performed using standard protocols. Plasmid DNA was isolated from overnight cultures using the QIAprep Spin Miniprep Kit (QIAGEN), according to the manufacturers instructions. Genomic DNA was isolated from overnight cultures utilizing the GenElute Bacterial Genomic DNA kit (Sigma) according to the manufacturers instructions. PCR products were purified using the QIAquick PCR Purification Kit (QIAGEN). XbaI restriction enzyme (Fermentas) and T4 DNA ligase (New England Biolabs) were used as per manufacturer instructions. DNA samples were routinely analyzed by electro-phoresis in 1% agarose gels (1X Tris-acetate-EDTA buffer) and visualized under UV light after ethidium bromide staining.
PCR Amplifications
Primers were designed using the Vector NTI Advance 10.0 software (Invitrogen) and are listed inTable 2. PCR amplifica-tions were performed in a MultiGene TC9600-G thermal cycler (LabNet), using GoTaq Flexi DNA Polymerase (Promega). Conditions for tiling-PCR amplification were as follows: 3 min at 94uC followed by 30 cycles of incubations at 94uC for 30 s, 58uC for 30 s, and 72uC for 4 min, followed by a final extension step at 72uC for 7 min. Conditions for standard PCR amplifica-tion were as follows: 3 min at 94uC followed by 30 cycles of incubations at 94uC for 30 s, 55uC for 30 s, and 72uC for 2 min, followed by a final extension step at 72uC for 5 min. When required, PCR products were purified by using the QIAquick PCR purification kit (Qiagen).
Construction ofS. Typhimurium Mutant Strains
Mutants ofS. Typhimurium carrying deletions of the T6SSSPI-6 gene cluster and the clpV (STM0272) or phoN genes were constructed using the Lambda-Red System [43]. The oligonucle-otides used for the mutagenesis are shown inTable 2and the sequences of plasmids pCLF2 and pCLF4 used as templates are available in GenBank (accession numbers HM047089 and EU629214.1, respectively). The correct insertion of the resistance cassettes was checked by PCR, and confirmed mutations were moved to a clean genetic background by generalized transduction using the high-frequency transducing phage P22 HT105/1int -201. To be able to identify wild type versus mutant colonies in the mixed competition experiments, the S. Typhimurium DphoN mutant was used as the wild type strain.phoN+ andphoN-strains can be distinguished by blue-white selection on 5-bromo-4-chloro-3-indolyl phosphate (XP) containing media, phoN- strains form white colonies whilephoN+strains appear blue. Mutations inphoN
do not affect the ability ofS. Typhimurium to colonize and persist in the chick [22].
Cloning ofS. Typhimurium SPI-6 by VEX-Capture Cloning of a,39 Kb fragment containing the T6SSSPI-6gene cluster from S. Typhimurium 14028s onto plasmid R995 was performed by the VEX-Capture technique for the targeted excision and cloning of large DNA fragments [44]. First, loxP
sites were inserted at each side of the targeted genomic region by homologous recombination of PCR products by the Lambda-Red system, using as templates the plasmids pVEX1212 and pVEX2212 that encode Sp and Cam resistance cassettes, respectively. Correct insertion of loxP sites was confirmed by PCR using primers SPI-6_OUT5 and STM0266_VEX_H2_U2 for loxP insertion located in the upstream region of the T6SS cluster, and primers SPI-6_OUT_DOWN and STM0298_VEX_H2_D2 for the downstreamloxPinsertion. This cluster was excised from the chromosome as a non-replicating circular DNA molecule by specific recombination of loxP sites mediated by the action of Cre recombinase encoded in plasmid pEKA30. This intermediate was captured into the R995-VC6 vector by a homologous recombination event, producing the R995+SPI-6 plasmid. The R995-VC6 plasmid contains a 1,209 bp internal region of homology to the T6SSSPI-6 cluster, cloned by PCR amplification with primers STM_VC_OUT5 and STM_VC_OUT3 (Table 2).
Plasmid R995+SPI-6 was transferred toE. colistrain EC100D
was assessed in each organ at each time point studied. No differences were observed on colony forming units (CFU) indicating that R995 and its derivatives are highly stablein vivo. Experimental Infections of Chickens
S.Typhimurium strains were grown aerobically at 42uC for 16 hours in LB broth. This temperature of incubation was used because it corresponds to the body temperature of chicks. For single and competitive infections, fifteen 4-day old unsexed White Leghorn chicks were orally inoculated with 109CFU of a single strain or with an equal mixture of the strains to be tested in a volume of 100ml of sterile PBS. The inoculum was serially diluted and plated to determine the titer and input ratio. Five birds from the infected group were sacrificed by asphyxiation with CO2on days 1, 3 and 9 post-infection. Ileum, cecum (including contents), liver and spleen were collected. These organs were homogenized in sterile PBS and serial ten-fold dilutions spread on LB agar plates containing the appropriate antibiotics for determination of CFU. For histopathological analysis, the cecum and liver of experimental animals were fixed in 10% formalin for 24 h followed by incubation in 70% ethanol and then embedded in paraffin. The
samples were stained with hematoxylin and eosin and 10 fields per sample were examined and scored by a trained veterinary pathologist to determine histopathological changes.
Statistical Analysis
Data obtained from competitive infection experiments were calculated as a mean ratio of logarithmically converted CFU of mutant to wild type normalized to the input ratio. Error bars indicate standard error. Statistical significance was determined using a two-tailed Students t-test. P values of ,0.05 were considered statistically significant (SPSS software, SPSS, Inc., Chicago, IL).
Ethics Statement
All animal experiments in this study were approved by the Texas A&M University Institutional Animal Care and Use Committee (TAMU AUP# 2010-38) and were carried out in accordance with the Guide to the Care and Use of Laboratory Animals, the Public Health Service Policy on the Human Care and Use of Laboratory Animals.
Table 1.Strains and plasmids used in this study.
Strains Features Source of reference
Escherichia coli
DH5a F-W80lacZDM15D(lacZYA-argF)U169deoR recA1 endA1 hsdR17(rk-, mk+
)phoA supE44 thi-1 gyrA96 relA1l
-Laboratory collection
EC100Dpir-116 F
-mcrAD(mrr-hsdRMS-mcrBC)W80dlacZDM15DlacX74 recA1 endA1 araD139
D(ara, leu)7697 galU galKl- rpsL (StrR
) nupG pir-116(DHFR)
Laboratory collection
EC100Dpir-116/R995+SPI-6 Strain with T6SSSPI-6fromS. Typhimurium cloned in plasmid R995 This study EC100Dpir-116/R995+SPI-19 Strain with T6SSSPI-19fromS. Gallinarum cloned in plasmid R995 [42]
DH5a/R995 Strain harboring an empty R995 vector This study
DH5a/R995-VC6 Strain containing a derivative of plasmid R995 with a 1,209 bp DNA fragment of T6SSSPI-6cloned fromS. Typhimurium
This study
SalmonellaTyphimurium
14028 s Wild-type strain Laboratory collection
MTM753 14028 sDphoN This study
MTM35 14028 sDSPI-6 T6SS This study
MTM2640 14028 sDclpV This study
WT/R995 14028 s containing an empty R995 vector This study
MTM35R MTM35 harboring R995 plasmid This study
MTM35R6 MTM35 complemented with plasmid R995+SPI-6 This study MTM35R19 MTM35 complemented with plasmid R995+SPI-19 This study
Plasmids
pKD46 blaPBADbet exopSC101 oriTs, AmpR [43]
pEKA30 IncQ plasmid that constitutively express Cre recombinase, AmpR [44]
pCLF2 Red-swap redesigned vector, CamR [50]
pCLF4 Red-swap redesigned vector, KanR [50]
pVEX1212 Suicide vector harboring aloxPsite followed by a SpRcassette [44] pVEX2212 Suicide vector harboring aloxPsite followed by a CamRcassette [44]
R995 Self-transmissible broad-host range IncP vector [44]
R995-VC6 A derivative of plasmid R995 with a 1,209 bp DNA fragment of T6SSSPI-6 cloned fromS. Typhimurium
This study
R995+SPI-6 T6SSSPI-6cluster fromS. Typhimurium 14028 s cloned in vector R995 This study
R995+SPI-19 T6SSSPI-19cluster fromS. Gallinarum 287/91 cloned in vector R995 [42]
Table 2.Primers used in this study.
Primer Sequencea
Mutagenesis
SPI-6_T6SS_(H1+P1) AGGGTGTTTTTATACATCCTGTGAAGTAAAAAAAACCGTAGTGTAGGCTGGAGCTGCTTC
SPI-6_T6SS_(H2+P2) GTGAACATGGCACATTAATTTGAAGCAGCTCTCATCCGGTCATATGAATATCCTCCTTAG
SPI-6_OUT5 CCGAAGTGTATCTGGCGATGA
STM0272_(H1+P1) GGCATAACACATGGAAACTCCTGTTTCACGCAGTGCGTTGGTGTAGGCTGGAGC TGCTTC
STM0272_(H2+P2) ACGGCCGGTTTCAGCAAACGATCTCAAAAACAATCTGCTCCATATGAATATCCTCCTTAG
STM0272_OUT5 GGCGGCAGTAAATACGATGT
STM_DphoN_(H1+P1) GTGAGTCTTTATGAAAAGTCGTTATTTAGTATTTTTTCTAGTGTAGGCTGGAGCTGCTTC
STM_DphoN_(H2+P2) ACTTTCACCTTCAGTAATTAAGTTCGGGGTGATCTTCTTTCATATGAATATCCTCCTTAG
STM_DphoN_OUT5 TTGCCTGATCCGGAGTGA
K1 CAGTCATAGCCGAATAGCCT
C3 CAGCTGAACGGTCTGGTTATAGG
VEX Capture
STM0266_VEX_H1_U1 GGCCACGTGGGCCGTGCACCTTAAGCTT
STM0266_VEX_H2_U2 GAGGTTATTCATGTCAACAGGATTACGTTTCACACTGGAGGTGCAGGCTGGAGCTGCTTC
STM0298_VEX_H1_D1 GGGGAGGTTGTGCGACGTTTGCATAATCCAGCAAGAACTGGGTTTAACGGTTGTGGACAACAAGCCAGGG
STM0298_VEX_H2_D2 ACACAGGCCAGACTGATTATACAGGCATGAAAAAGCTCTCCAGGTCGACGTCCCATGGCCATTCGAATTC
STM_VC_OUT5 GCTCTAGACCGGAGGGGTTATCTTTTCC STM_VC_OUT3 GCTCTAGATTGAAGCAGCTCTCATCCGG
5trfA ACGTCCTTGTTGACGTGGAAAATGACCTTG
3trfA CCGGAAGGCATACAGGCAAGAACTGATCG
SPI-6_OUT_DOWN AAACGGGTCTATTTACAGGGGCAC
Tiling-PCR
1_T6SS_SPI-6_FOR TTCAAGAAGTTCCACCGTCTATCG
1_T6SS_SPI-6_REV ACCTGTTTGAGCTGCTACATACCAG 2_T6SS_SPI-6_FOR CATTCAGTTCGCCGTCAAAGTG
2_T6SS_SPI-6_REV CCGCTGCGAATTTTGTTATCG
3_T6SS_SPI-6_FOR CCACGTTCTTCGGCATTACCAG 3_T6SS_SPI-6_REV CGGTGTTGTAAACCAGATGCTCC
4_T6SS_SPI-6_FOR AGACGCTGGCGAACACGATC
4_T6SS_SPI-6_REV TAAGCACTGGCCGTAGCTCTGG 5_T6SS_SPI-6_FOR GCAGCCATCCTTTGCACAAG
5_T6SS_SPI-6_REV GGTTGTGTTATTGGCGGCTTC
6_T6SS_SPI-6_FOR TATGCGATCAGGCGAACCTG 6_T6SS_SPI-6_REV TCTTCCTGTAACCGGGTATCCAG
7_T6SS_SPI-6_FOR GGTTGGATCAGGGACTGGATACC
7_T6SS_SPI-6_REV CGTAACCCTCAACATCCTGCG 8_T6SS_SPI-6_FOR AAAGCACCGGTGAATGTGGCTG
8_T6SS_SPI-6_REV TCGGTGTGGTCATCCTTACGGG
9_T6SS_SPI-6_FOR TGTCAGCACCAACAGTCGCC 9_T6SS_SPI-6_REV CGCCCTTCGATAGAATCTGGC
10_T6SS_SPI-6_FOR TAGTAGGGCCAGATTCTATCGAAGG
10_T6SS_SPI-6_REV CCCTCCGGCTTTTACACATTATTC
aItalics indicate the region that anneals to the 59or 39end of the antibiotic resistance cassette used for the mutagenesis. Underline indicatesXbaIrestriction sites used for cloning an internal region of homology to T6SS of SPI-6 into R995 plasmid.
Results
The T6SS Encoded in SPI-6 Contributes to Efficient Colonization of the Avian Host bySalmonella
Typhimurium
Single infections and competitive index experiments were performed to determine the contribution of the SPI-6 T6SS to intestinal and systemic colonization of chicks byS. Typhimurium. For single infections, White Leghorn chicks were orally-infected with either the wild-type strain, aDT6SSSPI-6mutant (MTM35) or a DclpV deletion mutant (MTM2640) and colonization of the cecum, ileum, liver and spleen was evaluated over 9 days of infection. ClpV, a conserved structural component of the T6SS that belongs to Clp/Hsp100 AAA+ of ATPase superfamily, is required for the activity of the secretion system [45,46]. As shown
inFigure 1, the cecum and ileum of chicks infected with the
wild-type strain were heavily colonized at all time points, while the liver and spleen were only lightly colonized, as reported previously [22]. Interestingly, both the DT6SSSPI-6 and DclpV mutant strains showed an overall lower degree of colonization of the cecum and ileum from day 3 post-infection and of the liver and spleen from
day one post-infection, suggesting a role for the SPI-6 T6SS in chick colonization.
In order to determine the competitive fitness within the host, of each mutant strain, competitive index experiments were per-formed. White leghorn chicks were orally infected with a mixture of each mutant with the wild-type strain at a 1:1 ratio and colonization of each organ was evaluated over 9 days of infection. As shown inFigure 2, a strong colonization defect was observed for both theDT6SSSPI-6andDclpVmutants during intestinal and systemic colonization from day 1 post-infection. This markedly attenuated phenotype was more pronounced at the third day post-infection and it was maintained throughout day 9 in each organ analyzed. These results indicate thatS. Typhimurium requires a functional T6SS to efficiently colonize the avian host.
Histopathological analysis of the cecum and liver from infected birds was performed to determine whether or not this attenuated phenotype was accompanied by tissue damage and/or signs of an inflammatory response. Single infections were performed as described above, and 3 days post infection the chicks were sacrificed and each organ tested was excised, fixed, stained with hematoxylin and eosin, and analyzed for histopathological lesions. Figure 1. Distribution ofS.Typhimurium 14028 s and SPI-6 T6SS mutants in the gastrointestinal tract and internal organs of orally infected chickens.Four-day-old White Leghorn chicks were infected by gavage with 109CFU of either the wild-typeS. Typhimurium 14028 s, the DT6SSSPI-6mutant or theDclpVmutant strains. After 1, 3 and 9 days post-infection, the chicks were humanely euthanized and the ileum, cecum, liver and spleen were aseptically removed. Tissues were homogenized and viable bacterial counts were determined. Data are mean values of log10CFU/g of tissue, from five animals at each time point.
Significant pathological changes were observed in the cecum of chicks infected with the wild-type strain. Among these changes, focal necrosis of the mucosal epithelial cells and heterophil infiltration were evident, indicating a strong inflammatory response induced by S. Typhimurium 14028 s (Figure 3, left panel). In contrast, chicks infected with either theDT6SSSPI-6or DclpV mutant strains showed a considerable lower level of heterophil infiltration in the cecum, with no signs of necrosis of the epithelial cells (Figure 3, central and right panels, respective-ly). No significant histopathological differences were found in livers infected with either the wild-type or the T6SS mutants (data not shown). Absence of lesions in the liver are most probably due to
the low levels of bacterial colonization of internal organs by both the wild-type and T6SS mutant strains (Figure 1).
The Colonization Defect of theDT6SSSPI-6Mutant is Complemented by Transfer of the T6SSSPI-6Gene Cluster
To directly link the absence of the T6SSSPI-6gene cluster to the phenotype of theDT6SSSPI-6 mutant, the complete 35,921 base pair T6SS gene cluster was returned to the mutant on the self-transmissible broad-host range R995 vector. The capture of the entire T6SSSPI-6 gene cluster was performed using the VEX-Capture method [44] and confirmed by tiling PCR analysis (Figure S1).
Figure 2.In vivocompetition betweenDT6SSSPI-6andDclpVdeletion mutants and the wild typeS. Typhimurium strain 14028 s. Fifteen four-day-old White Leghorn chicks were infected intragastrically by gavage with 109CFU of a mixture at a 1:1 ratio of the respective mutant strain and the wild typeS. Typhimurium 14028 s. At 1, 3 and 9 days post-infection groups of 5 chicks were sacrificed and organs were excised, homogenized, and serially diluted to determine bacterial loads. Bars represent the geometric mean of the log ratio of the mutant CFU/wild type CFU, normalized to the inoculum ratio. Error bars denote standard error. Statistical significance was determined using a two-tailed Student’sttest, and asterisks indicate that normalized output ratios were significantly statistically different from the equivalent ratio in the inoculum (*P,0.05; **P,0.001).
doi:10.1371/journal.pone.0063917.g002
Figure 3. Histopathological changes in the cecum of infected chicks at day 3 post-infection.Groups of 3 White Leghorn chicks were inoculated intragastrically by gavage with 109CFU of the wild typeS. Typhimurium 14028 s strain, theDT6SS
SPI-6mutant strain or theDclpVmutant strain. At day 3 post-infection the chicks were sacrificed and the ceca were excised, fixed, stained with hematoxylin and eosin, and analyzed for histopathological lesions. Representative images of stained sections (400X) and scores for histopathological lesions in the cecum of infected chicks are shown (-, no changes;+, mild;++, strong;+++, severe). White arrows indicate heterophil infiltration.
The complemented strain (MTM35R6) was tested in a competition experiment against the DT6SSSPI-6mutant and the wild type, each bearing the empty vector (MTM35/R995 and WT/R995, respectively) and colonization was determined at days 1, 3, and 9 post infection. As shown inFigure 4, transfer of the T6SSSPI-6 gene cluster to the DT6SSSPI-6 mutant restored its ability to colonize the cecum and the ileum at all time points. On the other hand, in the spleen and liver, the results were not conclusive due to a very low and heterogeneous colonization of these deeper tissues by S. Typhimurium harbouring the R995 plasmid (data not shown). Nevertheless, complementation of the defective phenotype of theDT6SSSPI-6mutant in the gastrointes-tinal tract supports the contribution of T6SSSPI-6 in chicken colonization.
The SPI-19 T6SS fromS. Gallinarum Restores the Colonization Defect of the SPI-6 T6SS Mutant Strain
In a previous study, we reported that T6SSSPI-19contributes to efficient colonization of infected chicks byS.Gallinarum 287/91 [42]. T6SSSPI-6 and T6SSSPI-19 have different evolutionary histories, and were probably acquired at different times during
Salmonellaevolution [35,36]. Because both T6SS are relevant for
Salmonella colonization of infected chicks, we examined the possibility that both T6SS could contribute to chicken colonization in a similar extent. To test whether T6SSSPI-19 can restore the ability of the S.Typhimurium DT6SSSPI-6 mutant to efficiently colonize the avian host, the complete T6SSSPI-19 gene cluster captured fromS. Gallinarum 287/91 in the R995 plasmid was Figure 4.In vivocompetition between theDT6SSSPI-6mutants complementedin transwith T6SSSPI-6or T6SSSPI-19and the wild type
S. Typhimurium 14028 s.Fifteen four-day-old White Leghorn chicks were orally infected with 109CFU of a mixture at a 1:1 ratio of strains WT/ R995,DT6SSSPI-6/R995+SPI-6 andDT6SSSPI-6/R995+SPI-19. At 1, 3 and 9 days post-infection groups of five chicks were sacrificed and the organs were excised, homogenized, and serially diluted for determination of bacterial loads. Bars represent the geometric mean of the log converted ratio of the mutant CFU to the wild type CFU normalized to the equivalent ratio in the inoculum. Error bars denote standard error. Statistical significance was determined using a two-tailed Student’sttest, and asterisks indicate statistically significant differences between normalized output ratios (*P,0.05).
`
Indicate statistically significant differences between normalized output ratios and the equivalent ratio in the inoculum (`P
transferred toS. TyphimuriumDT6SSSPI-6by conjugation. The resulting strain (MTM35R19) was tested in a competition experiment with the wild-type S. Typhimurium strain bearing the empty R995 vector (WT/R995). The results showed that introduction of the T6SSSPI-19 complemented the colonization defect of the DT6SSSPI-6 mutant in both the cecum and ileum (Figure 4). Interestingly, at days 1 and 3 post-infection, the cross-complemented strain colonized the cecum to higher levels than the wild-type strain. Analysis of the competitive fitness of the complemented strains in the spleen and liver did not show statistically significant differences; this was due to the heteroge-neous and low colonization levels of systemic organs reached by Salmonellae in the chicken, as previously reported [22].
Discussion
We previously reported that Salmonella encodes five distinct T6SS differentially distributed among different serotypes [35,36]. Two of these systems, encoded in the SPI-6 and SPI-19, have been linked to the ability of serotypes Typhimurium and Gallinarum to efficiently infect mice and chickens, respectively [37,42,47]. Even though most of our knowledge regarding S. Typhimurium pathogenesis comes from murine models of infection, recent reports have highlighted the limited applicability of this model when it comes to extrapolating conclusions regarding other hosts, including the chicken.
In this work, we evaluated the contribution of T6SSSPI-6to the ability ofS. Typhimurium 14028 s to colonize the gastrointestinal tract and internal organs of White Leghorn chicks. Competitive index experiments demonstrated that the T6SSSPI-6gene cluster was necessary for efficient colonization of the cecum, ileum, spleen and liver from day 1 post-infection. A similar colonization defect was observed for a mutant lacking the T6SS-essential component ClpV. Interestingly, the colonization defects were more pro-nounced at days 3 and 9 post-infection suggesting that mutants in theDT6SSSPI-6do not persist well.
Histopathological analyses revealed that the attenuated pheno-types of the mutants were accompanied by changes in the inflammatory response in the cecum. Chicks infected with SPI-6 T6SS mutant strains showed considerable less inflammation and necrosis in the cecum in comparison with those infected with the wild-type strain. This could be due to the lower level of colonization of the cecum by the SPI-6 T6SS mutant compared to the wild type, or that this secretion system effectively contributes to the inflammatory response generated by S. Typhimurium infection. Further experiments will be needed to clarify these issues.
To confirm that T6SSSPI-6 was responsible for these pheno-types, the entire gene cluster was cloned and introduced in the DT6SSSPI-6mutant. Although complementation was not observed
in the spleen and liver, transfer of the T6SS gene cluster complemented the colonization defect of the mutant in the cecum and ileum throughout infection, suggesting a critical role for T6SSSPI-6in the gastrointestinal phase of infection. In this context, Sivula et al. have shown that S. Typhimurium preferentially colonize the cecum in order to maintain a long-term persistence in chicks [22]. Therefore, T6SSSPI-6 may be contributing to this critical phase of the infectious process.
A role for T6SS in colonization of the gastrointestinal tract is not unexpected. Several T6SS have been linked to antibacterial killing through delivery of toxins to susceptible Gram-negative bacteria, and several authors have proposed that T6SS could contribute to bacterial adaptation and competition for new niches, including animal hosts [23–26,48]. Therefore, it is possible that
the defect observed in colonization of the ileum and cecum of the T6SS mutant is due to an inability of this mutant to compete with normal flora of the chicken gut. Further experiments will be needed to test this hypothesis.
On the other hand, a recent report has pointed out a role for T6SSSPI-6 in the intracellular survival of S. Typhimurium in murine macrophages [37]. Our data indicate that this secretion system is also needed for colonization of the internal organs of the chicken, suggesting a role for T6SSSPI-6 in intracellular survival within avian macrophages. Hence, the T6SSSPI-6might contribute to both competition with the normal intestinal flora and survival within phagocytic cells.
We have previously reported that a phylogenetically distinct T6SS encoded in SPI-19, is necessary for the efficient colonization of the intestinal tract and systemic organs of chicks, and for survival of serotype Gallinarum in cultured avian macrophages [42,49]. Because the phenotypes observed for the DT6SSSPI-6 mutant were similar to those exhibited by aDT6SSSPI-19mutant of Gallinarum, we hypothesized that both systems could perform similar functions in chicken infection. Transfer of the T6SSSPI-19 gene cluster to the DT6SSSPI-6 mutant complemented the colonization defect of this strain in the ileum and cecum. Moreover, it caused an advantage for colonization of cecum at days 1 and 3 post-infection. These results indicate that both T6SS, despite their different evolutionary histories, contribute to a similar extent to chicken colonization by Salmonella. This statement is supported by the fact that both SPI-6 and SPI-19 T6SS have been shown to be required for Salmonella intracellular survival within macrophages [37,49].
Altogether, we have determined that T6SSSPI-6contributes to chicken colonization by S. Typhimurium. Also, we show that T6SSSPI-19from the avian-adapted serotype Gallinarum is able to replace T6SSSPI-6, suggesting a broad role for these secretion systems in Salmonella host colonization. Most interestingly, our results indicate that T6SSSPI-19 confers an advantage to S.
Typhimurium to colonize the gastrointestinal tract of the chicks early in infection.
Supporting Information
Figure S1 In vivo cloning of T6SSSPI-6 from S.
Typhi-murium 14028 s. (A)Scheme of the VEX-Capture procedure:
loxPsites were inserted in the chromosome of S. Typhimurium 14028 s at each side of the T6SSSPI-6 gene cluster through homologous recombination of PCR products using the Lambda-Red system. In presence of pEKA30, a plasmid that constitutively expresses the Cre recombinase, the T6SS cluster was excised from the chromosome as a non-replicative, circular DNA intermediate that was captured through homologous recombination in R995-VC6, a derivative of R995 plasmid harboring an internal region of homology to T6SSSPI-6.(B)Tiling-PCR analysis of the T6SSSPI-6 gene cluster cloned onto the R995 plasmid. Specific primers were designed to amplify ten fragments that cover the entire T6SSSPI-6 region and whose lengths vary between 3,298 and 4,274 bp. (TIF)
Acknowledgments
Author Contributions
Conceived and designed the experiments: DP CJB CAS HAP IC. Performed the experiments: DP HJY. Analyzed the data: DP CJB CAS
HAP IC. Contributed reagents/materials/analysis tools: CAS HAP IC. Wrote the paper: DP CJB CAS HAP IC.
References
1. Majowicz SE, Musto J, Scallan E, Angulo FJ, Kirk M, et al. (2010) The global burden of nontyphoidalSalmonellagastroenteritis. Clin Infect Dis 50: 882–889. 2. WHO Global Foodborne Infections Network Country Databank www.who.int/
salmsurv.
3. House D, Bishop A, Parry C, Dougan G, Wain J (2001) Typhoid fever: pathogenesis and disease. Curr Opin Infect Dis 14: 573–578.
4. Jones BD, Falkow S (1996) Salmonellosis: host immune responses and bacterial virulence determinants. Annu Rev Immunol 14: 533–561.
5. Santos RL, Raffatellu M, Bevins CL, Adams LG, Tukel C, et al. (2009) Life in the inflamed intestine,Salmonellastyle. Trends Microbiol 17: 498–506. 6. Hansen-Wester I, Hensel M (2001)Salmonella pathogenicity islands encoding
type III secretion systems. Microbes Infect 3: 549–559.
7. Smith RL, Kaczmarek MT, Kucharski LM, Maguire ME (1998) Magnesium transport in Salmonella typhimurium: regulation of mgtA and mgtCB during invasion of epithelial and macrophage cells. Microbiology 144 (Pt 7): 1835–1843. 8. Dorsey CW, Laarakker MC, Humphries AD, Weening EH, Baumler AJ (2005) Salmonella entericaserotype Typhimurium MisL is an intestinal colonization factor that binds fibronectin. Mol Microbiol 57: 196–211.
9. Morgan E, Campbell JD, Rowe SC, Bispham J, Stevens MP, et al. (2004) Identification of host-specific colonization factors ofSalmonella entericaserovar Typhimurium. Mol Microbiol 54: 994–1010.
10. Knodler LA, Vallance BA, Celli J, Winfree S, Hansen B, et al. (2010) Dissemination of invasiveSalmonellavia bacterial-induced extrusion of mucosal epithelia. Proc Natl Acad Sci U S A 107: 17733–17738.
11. Galan JE (2001)Salmonellainteractions with host cells: type III secretion at work. Annu Rev Cell Dev Biol 17: 53–86.
12. Haraga A, Ohlson MB, Miller SI (2008) Salmonellae interplay with host cells. Nat Rev Microbiol 6: 53–66.
13. Coombes BK, Coburn BA, Potter AA, Gomis S, Mirakhur K, et al. (2005) Analysis of the contribution ofSalmonellapathogenicity islands 1 and 2 to enteric disease progression using a novel bovine ileal loop model and a murine model of infectious enterocolitis. Infect Immun 73: 7161–7169.
14. Hapfelmeier S, Ehrbar K, Stecher B, Barthel M, Kremer M, et al. (2004) Role of theSalmonellapathogenicity island 1 effector proteins SipA, SopB, SopE, and SopE2 in Salmonella enterica subspecies 1 serovar Typhimurium colitis in streptomycin-pretreated mice. Infect Immun 72: 795–809.
15. Brawn LC, Hayward RD, Koronakis V (2007)SalmonellaSPI1 effector SipA persists after entry and cooperates with a SPI2 effector to regulate phagosome maturation and intracellular replication. Cell Host Microbe 1: 63–75. 16. Steele-Mortimer O, Brumell JH, Knodler LA, Meresse S, Lopez A, et al. (2002)
The invasion-associated type III secretion system ofSalmonella entericaserovar Typhimurium is necessary for intracellular proliferation and vacuole biogenesis in epithelial cells. Cell Microbiol 4: 43–54.
17. Kuhle V, Hensel M (2004) Cellular microbiology of intracellularSalmonella enterica: functions of the type III secretion system encoded by Salmonella pathogenicity island 2. Cell Mol Life Sci 61: 2812–2826.
18. Jones MA, Hulme SD, Barrow PA, Wigley P (2007) TheSalmonellapathogenicity island 1 andSalmonellapathogenicity island 2 type III secretion systems play a major role in pathogenesis of systemic disease and gastrointestinal tract colonization ofSalmonella entericaserovar Typhimurium in the chicken. Avian Pathol 36: 199–203.
19. Porter SB, Curtiss R, 3rd (1997) Effect of inv mutations onSalmonellavirulence and colonization in 1-day-old White Leghorn chicks. Avian Dis 41: 45–57. 20. Dieye Y, Ameiss K, Mellata M, Curtiss R, 3rd (2009) The Salmonella
Pathogenicity Island (SPI) 1 contributes more than SPI2 to the colonization of the chicken bySalmonella entericaserovar Typhimurium. BMC Microbiol 9: 3. 21. Turner AK, Lovell MA, Hulme SD, Zhang-Barber L, Barrow PA (1998)
Identification ofSalmonella typhimuriumgenes required for colonization of the chicken alimentary tract and for virulence in newly hatched chicks. Infect Immun 66: 2099–2106.
22. Sivula CP, Bogomolnaya LM, Andrews-Polymenis HL (2008) A comparison of cecal colonization ofSalmonella entericaserotype Typhimurium in white leghorn chicks andSalmonella-resistant mice. BMC Microbiol 8: 182.
23. Murdoch SL, Trunk K, English G, Fritsch MJ, Pourkarimi E, et al. (2011) The opportunistic pathogenSerratia marcescensutilizes type VI secretion to target bacterial competitors. J Bacteriol 193: 6057–6069.
24. Hood RD, Singh P, Hsu F, Guvener T, Carl MA, et al. (2010) A type VI secretion system ofPseudomonas aeruginosatargets a toxin to bacteria. Cell Host Microbe 7: 25–37.
25. MacIntyre DL, Miyata ST, Kitaoka M, Pukatzki S (2010) TheVibrio choleraetype VI secretion system displays antimicrobial properties. Proc Natl Acad Sci U S A 107: 19520–19524.
26. Schwarz S, West TE, Boyer F, Chiang WC, Carl MA, et al. (2010)Burkholderia type VI secretion systems have distinct roles in eukaryotic and bacterial cell interactions. PLoS Pathog 6(8): e1001068.
27. Schwarz S, Hood RD, Mougous JD (2010) What is type VI secretion doing in all those bugs? Trends Microbiol 18: 531–537.
28. Ma AT, Mekalanos JJ (2010)In vivoactin cross-linking induced byVibrio cholerae type VI secretion system is associated with intestinal inflammation. Proc Natl Acad Sci U S A. 107(9): 4365–70.
29. Wang M, Luo Z, Du H, Xu S, Ni B, et al. (2011) Molecular Characterization of a Functional Type VI Secretion System inSalmonella entericaserovar Typhi. Curr Microbiol 63: 22–31.
30. Pukatzki S, McAuley SB, Miyata ST (2009) The type VI secretion system: translocation of effectors and effector-domains. Curr Opin Microbiol 12: 11–17. 31. Burtnick MN, Brett PJ, Harding SV, Ngugi SA, Ribot WJ, et al. (2011) The cluster 1 type VI secretion system is a major virulence determinant inBurkholderia pseudomallei. Infect Immun 79: 1512–1525.
32. Jani AJ, Cotter PA (2010) Type VI secretion: not just for pathogenesis anymore. Cell Host Microbe 8: 2–6.
33. de Pace F, Nakazato G, Pacheco A, de Paiva JB, Sperandio V, et al. (2010) The type VI secretion system plays a role in type 1 fimbria expression and pathogenesis of an avian pathogenicEscherichia colistrain. Infect Immun 78: 4990–4998.
34. Pukatzki S, Ma AT, Revel AT, Sturtevant D, Mekalanos JJ (2007) Type VI secretion system translocates a phage tail spike-like protein into target cells where it cross-links actin. Proc Natl Acad Sci U S A 104: 15508–15513.
35. Blondel CJ, Jimenez JC, Contreras I, Santiviago CA (2009) Comparative genomic analysis uncovers 3 novel loci encoding type six secretion systems differentially distributed inSalmonellaserotypes. BMC Genomics 10: 354. 36. Fookes M, Schroeder GN, Langridge GC, Blondel CJ, Mammina C, et al.
(2011)Salmonella bongoriProvides Insights into the Evolution of the Salmonellae. PLoS Pathog 7: e1002191.
37. Mulder DT, Cooper CA, Coombes BK (2012) Type VI secretion system-associated gene clusters contribute to pathogenesis ofSalmonella entericaserovar Typhimurium. Infect Immun 80: 1996–2007.
38. Chan K, Kim CC, Falkow S (2005) Microarray-based detection ofSalmonella enterica serovar Typhimurium transposon mutants that cannot survive in macrophages and mice. Infect Immun 73: 5438–5449.
39. Haneda T, Ishii Y, Danbara H, Okada N (2009) Genome-wide identification of novel genomic islands that contribute toSalmonellavirulence in mouse systemic infection. FEMS Microbiol Lett 297: 241–249.
40. Klumpp J, Fuchs TM (2007) Identification of novel genes in genomic islands that contribute toSalmonella typhimuriumreplication in macrophages. Microbiology 153: 1207–1220.
41. Lawley TD, Chan K, Thompson LJ, Kim CC, Govoni GR, et al. (2006) Genome-wide screen for Salmonella genes required for long-term systemic infection of the mouse. PLoS Pathog 2: e11.
42. Blondel CJ, Yang HJ, Castro B, Chiang S, Toro CS, et al. (2010) Contribution of the type VI secretion system encoded in SPI-19 to chicken colonization by Salmonella entericaserotypes Gallinarum and Enteritidis. PLoS One 5: e11724. 43. Datsenko KA, Wanner BL (2000) One-step inactivation of chromosomal genes
inEscherichia coliK-12 using PCR products. Proc Natl Acad Sci U S A 97: 6640– 6645.
44. Wilson JW, Figurski DH, Nickerson CA (2004) VEX-capture: a new technique that allows in vivo excision, cloning, and broad-host-range transfer of large bacterial genomic DNA segments. J Microbiol Methods 57: 297–308. 45. Basler M, Pilhofer M, Henderson GP, Jensen GJ, Mekalanos JJ (2012) Type VI
secretion requires a dynamic contractile phage tail-like structure. Nature 483: 182–186.
46. Silverman JM, Brunet YR, Cascales E, Mougous JD (2012) Structure and Regulation of the Type VI Secretion System. Annu Rev Microbiol 66: 453–472. 47. Liu J, Guo JT, Li YG, Johnston RN, Liu GR, et al. (2012) The type VI secretion system gene cluster ofSalmonella typhimurium: required for full virulence in mice. J Basic Microbiol. 52: 1–8.
48. Russell AB, Singh P, Brittnacher M, Bui NK, Hood RD, et al. (2012) A Widespread Bacterial Type VI Secretion Effector Superfamily Identified Using a Heuristic Approach. Cell Host Microbe 11: 538–549.
49. Blondel CJ, Jime´nez JC, Leiva LE, A´ lvarez SA, Pinto BI, et al. (2013) The Type VI Secretion System encoded in SPI-19 is required forSalmonellaGallinarum survival within infected macrophages. Infect Immun. 81: 1207–1220. 50. Santiviago CA, Reynolds MM, Porwolik S, Choi SH, Long F, et al (2009)
