University of São Paulo
“Luiz de Queiroz” College of Agriculture
Improvement of Saccharomyces cerevisiae by hybridization for increased
tolerance towards inhibitors from second-generation ethanol substrate
Thalita Peixoto Basso
Thesis presented to obtain the degree of Doctor in Science. Area: Agricultural Microbiology
Thalita Peixoto Basso Agronomist
Improvement of Saccharomyces cerevisiae by hybridization for increased tolerance
towards inhibitors from second-generation ethanol substrate
versão revisada de acordo com a resolução CoPGr 6018 de 2011
Advisor:
Prof. Dr. GONÇALO AMARANTE GUIMARÃES PEREIRA
Thesis presented to obtain the degree of Doctor in Science. Area: Agricultural Microbiology
Dados Internacionais de Catalogação na Publicação DIVISÃO DE BIBLIOTECA - DIBD/ESALQ/USP
Basso, Thalita Peixoto
Improvement of Saccharomyces cerevisiae by hybridization for increased tolerance towards inhibitors from second-generation ethanol substrate / Thalita Peixoto Basso. - - versão revisada de acordo com a resolução CoPGr 6018 de 2011. - - Piracicaba, 2015.
106 p. : il.
Tese (Doutorado) - - Escola Superior de Agricultura “Luiz de Queiroz”.
1. Saccharomyces cerevisiae 2. Etanol de segunda-geração 3. Cruzamentos 4. Evolução adaptativa 5. Hidrolisado lignocelulósico 6. Tolerância 7. Inibidores I. Título
CDD 660.62 B322i
ACKNOWLEDGEMENTS
Gonçalo A. G. Pereira for the valuable advising and for help in funding this work.
Luiz Carlos Basso for immense advice and access to his laboratory facilities.
Adam Paul Arkin for his advice and for a welcoming acceptance into his research group.
Luiz Humberto Gomes and Ana Maria B. Giacomelli for help with tetrad dissection.
Jeffrey Skerker for immense guidance in genomic experiments and bioinformatics analysis.
Matthew Maurer for considerable help with QTL experiments and bioinformatics analysis.
Luis “Cometa” Lucatti for helping with the fermentation experiments, HPLC and PFGE analysis.
Elisa Lucatti for help with microbiology and HPLC analysis.
Stefan Bauer and Ana Ibanez from the Energy Biosciences Institute for HPLC analysis.
Lawrence Sutardja for help with bioengineering experiments.
Jeremy Roop for help with some microplate screenings.
Jason Baumohl and Morgan Price for help with uploading data to the Microbes Online database.
Gwyneth Terry and Sara Ricks for helping with paperwork.
Dacia Leon and Dominic Pinel for a warm welcome.
The whole Arkin group for their support and for great moments together.
The whole Basso group: in the person of Alexandra Pavan, Camila Varize, Elisangela Miranda and Renata Christofoleti for their company in the laboratory and during seminars.
The coordinator, Fernando Dini Andreote, of the Agriculture Microbiology Program from “Luiz de Queiroz” College of Agriculture, University of Sao Paulo for his support.
University of California Berkeley and Energy Biosciences Institute (EBI) for financial support, amazing facilities and a warm welcome.
Thomas Rasmussen and researcher Thiago Olitta Basso, from Novozymes Latin America, for providing sugarcane bagasse hydrolysate and for their suggestions.
SUMMARY
RESUMO ... 11
ABSTRACT ... 13
2 REVIEW ... 17
2.1 Second-generation ethanol in Brazil ... 17
2.2 Genotypic and phenotypic diversity of Saccharomyces cerevisiae strains ... 19
2.3 Mutagenesis ... 21
2.4 Adaptive evolution ... 22
2.5 Chromosomal rearrangements ... 24
2.6 Engineered Saccharomyces cerevisiae for xylose fermentation ... 25
2.7 CRISPR-Cas9 ... 26
2.8 Polygenic Analysis ... 27
3 OBJECTIVE ... 29
4 MATERIAL AND METHODS ... 31
4.1 Direct mating ... 31
4.1.1 Tetrad dissection ... 31
4.1.2 Stock culture preservation and growth media ... 31
4.1.3 Direct mating of haploids from the same tetrad ... 31
4.1.4 Ultraviolet irradiation and pre-screening of irradiated haploids ... 32
4.1.5 Direct mating of irradiated haploids and pre-screening of the resulting hybrids ... 32
4.2 Mass mating followed by adaptive evolution ... 33
4.2.1 Mass mating ... 33
4.2.2 Adaptive evolution ... 33
4.2.3 Karyotyping ... 34
4.2.4 Pre-screening of evolved strains ... 34
4.3 Batch fermentation screening with cell recycling (Brazilian fed-batch process) ... 35
4.3.1 Propagation medium ... 36
4.3.2 Starting strains ... 36
4.3.3 Novozymes bagasse hydrolysate ... 36
4.3.4 Molasses-hydrolysate fermentation medium ... 36
4.3.5 Fermentation ... 37
4.3.6 Yeast cell viability estimation ... 37
4.3.8 Ethanol content estimation in centrifuged wine ... 37
4.3.9 Xylitol, glycerol and residual sugars determination in the centrifuged fermented must 38 4.3.10 Glycogen extraction and quantification ... 38
4.3.11 Extraction and quantification of trehalose ... 38
4.4 Pre-screening for Miscanthus x giganteus lignocellulosic hydrolysate substrate ... 39
4.4.1 Stock culture preservation ... 39
4.4.2 Miscanthus x giganteus hydrolysate ... 39
4.4.3 Screening of selected hybrids and their haploids for growth in M. giganteus hydrolysate ... 39
4.4.4 Tetrads dissection of selected hybrids and mating type identification ... 40
4.4.4.1 Sporulation and tetrad dissection ... 40
4.4.4.2 Mating type identification by PCR ... 41
4.4.5 Screening of haploid segregants from hybrid (272) for M. giganteus hydrolysate tolerance ... 41
4.4.6 Competent cells ... 42
4.4.7 Transformation for pentose fermentation ... 42
4.4.7.1 X123 cassette insertion using Cas9 ... 42
4.4.7.2 X123 cassette insertion confirmation ... 44
4.4.7.3 Phenotype evaluation in synthetic medium ... 44
4.4.7.4 Phenotype evaluation in YPX fermentation ... 45
4.4.8 Quantitative trait loci - QTL ... 45
4.4.8.1 Mating type switching ... 45
4.4.8.2 Confirmation of hydrolysate tolerance phenotype after mating type switching ... 46
4.4.8.3 HIS3 gene deletion and verification ... 47
4.4.8.4 Hydrolysate tolerance phenotype confirmation after HIS3 deletion ... 48
4.4.8.5 Pre-QTL: evaluation of the parental strain phenotypes in a DASGIP® bioreactor ... 49
4.4.8.6 Hybrid between S288C MM MAT and 4a MATa his3::NatRMX4 ... 49
4.4.8.7 Hydrolysate tolerance evaluation of hybrids strains derived from 272-4a and S288C MM ... 50
4.4.8.8 Obtaining a large F1 pool of MATa segregants for X-QTL analysis ... 50
4.4.8.9 F1 pool selection in a DASGIP® bioreactor ... 51
4.4.8.10 Yeast Genomic DNA isolation ... 52
5 RESULTS AND DISCUSSION ... 55
5.1 Direct mating of haploids from the same tetrad and pre-screening of resulting strains ... 55
5.2 Pre-screening of UV irradiated haploids and their hybrids ... 57
5.2.1 Pre-screening of UV irradiated haploids ... 57
5.2.2 Pre-screening of hybrids from direct mating of irradiated haploids ... 59
5.3 Evaluation of reference strains and pre-screening of strains from mass mating followed by adaptive evolution ... 63
5.4 Screening fermentation ... 71
5.5 Segregants from selected hybrids ... 75
5.6 Hybrids evaluation for Miscanthus x giganteus hydrolysate tolerance ... 77
5.7 Evaluation of hydrolysate tolerance in haploids derived from hybrid 272 ... 79
5.8 Re-evaluation of 272-1a for M. giganteus hydrolysate tolerance ... 81
5.9 Construction of xylose utilizing strains by integration of a three-gene cassette using Cas9 technology ... 81
5.10 QTL analysis ... 85
5.10.1 Mating type switching ... 85
5.10.2 HIS3 gene deletion ... 86
5.10.3 Evaluation of haploid strains MATa his3::Nat-MX4 in hydrolysate ... 87
5.10.4 Pre-QTL: performance of 4a_MATa_his3::Nat-MX4 in a bioreactor ... 88
5.10.5 Selection of hybrids for QTL ... 88
5.10.6 Identification of QTL intervals ... 89
5.11 Genomic sequence analysis ... 92
5.11.1 Genome sequence of the UV irradiated hybrids ... 93
6 CONCLUSION ... 95
! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! !
RESUMO
Obtenção de linhagens de Saccharomyces cerevisiae mediante hibridação para tolerância
aos inibidores presentes no hidrolisado de bagaço para produção do etanol de segunda geração
Mudança climática global e a volatilidade do preço do petróleo tem impulsionado a necessidade de redução e substituição de combustíveis fósseis por energias renováveis. A produção de bioetanol nos Estados Unidos e no Brasil a partir de milho e cana-de-açúcar, respectivamente, está estabelecida. Todavia, a produção de bioetanol mostra-se insustentável, pelo fato da utilização de produtos alimentares para tal produção. Em contrapartida, biocombustíveis produzidos a partir de resíduos lignocelulósicos têm sido vistos como uma solução plausível para o problema “alimento versus combustível”. No Brasil, o bagaço de cana é uma fonte disponível de biomassa lignocelulósica. No entanto, inibidores como furfural, 5-hidroximetil-furfural (HMF) e ácidos carboxílicos formados durante o pré-tratamento ácido da biomassa lignocelulósica, têm efeito negativo sobre os microorganismos fermentadores - Saccharomyces cerevisiae. No Brasil, o etanol de segunda-geração (2G) tem possibilidade de utilizar um novo substrato, preparado a partir da mistura de melaço e hidrolisado de bagaço. O melaço será um adjuvante para suprir a deficiência nutricional do hidrolisado, contribuindo com minerais, aminoácidos e vitaminas. Por outro lado, o melaço apresenta alguns inibidores, como HMF, sulfito, e concentração tóxica de alguns minerais, como potássio (K) e cálcio (Ca), que afetam o crescimento e desempenho fermentativo de S. cerevisiae. O objetivo deste trabalho foi gerar descendentes tolerantes de linhagens industriais de S. cerevisiae, capazes de lidar com inibidores presentes no melaço e no hidrolisado de bagaço, por meio de hibridação e evolução adaptativa, para produção do etanol 2G. As linhagens industriais PE-2, CAT-1 e SA-1 foram esporuladas, seus haplóides foram irradiados por luz ultravioleta (UV), objetivando o aumento da diversidade genética e fenotípica das linhagens. Após cruzamento direcionado, 234 híbridos foram selecionados pelo crescimento (DO570nm) em meios de melaço e hidrolisado. Em paralelo, cruzamentos massais (intra e inter-linhagens) de haplóides não-irradiados de PE-2, CAT-1 e SA-1 foram realizados e submetidos a evolução adaptativa por cerca de 100 gerações. As 120 estirpes de cruzamentos massais seguidos de evolução adaptativa foram selecionadas pelo crescimento em meios de melaço e hidrolisado. Seis isolados apresentaram boas características fermentativas em comparação às cepas referências, mostrando que hibridação e evolução adaptativa de linhagens de leveduras industriais brasileiras são boas estratégias para desenvolver novas linhagens para produção do etanol-2G. Para uma melhor utilização dos açúcares do hidrolisado, a cassete contendo os três genes responsáveis pela fermentação de xilose (xilose redutase, xilitol desidrogenase e xiluloquinase) foi integrada no genoma do haplóide segregante (272-1a) de uma das seis estirpes selecionadas (272), que apresentou a maior tolerância em hidrolisado de Miscanthus x giganteus. Estudos de fermentação mostraram que a estirpe foi capaz de metabolizar a xilose em etanol. Por fim, o haploide 272-1a foi analisado por quantitative trait loci (QTL) afim de identificar a base genética da tolerância ao hidrolisado. Apesar, do(s) gene(s) causativos não terem sido identificados nesse trabalho, os picos do mapa de QTL identificados servirão como ponto de partida para futuro mapeamento.
Palavras-chave: Saccharomyces cerevisiae; Etanol de segunda-geração; Cruzamentos; Evolução adaptativa; Hidrolisado lignocelulósico; Tolerância; Inibidores
ABSTRACT
Improvement of Saccharomyces cerevisiae by hybridization for increased tolerance
towards inhibitors from second-generation ethanol substrate
Global climate change and volatility of petroleum price have driven the necessity to reduce fossil fuel utilization and replace it by renewable energy. Bioethanol production in the United States and Brazil from cornstarch and sugarcane, respectively, is already established. However, the bioethanol industry appears unsustainable in view of the potential stress that its production places on food commodities. In contrast, second-generation biofuels produced from cheap and abundant lignocellulosic biomass, has been viewed as one plausible solution to this "food versus fuel" problem. Sugarcane bagasse is an abundant source of lignocellulosic biomass in Brazil and is generally recognized as a very promising feedstock for lignocellulosic ethanol production. Nevertheless, inhibitors such as furfural, 5-hydroxymethyl furfural (HMF) and carboxylic acids are formed during an acid thermochemical pretreatment of lignocellulosic biomass, which has a negative effect on the fermentative microorganisms – Saccharomyces cerevisiae. Second-generation (2G) ethanol in Brazil has the possibility to use a novel substrate, prepared as a blend of sugarcane bagasse hydrolysate and cane molasses. Molasses supplements the nutritional deficiencies of bagasse hydrolysate, contributing with minerals, amino acids and vitamins. However, molasses also contains additional inhibitors, such as HMF, sulfite, and toxic concentration of some minerals (K, Ca), which affect S. cerevisiae fermentation performance. The goal of this work was to generate tolerant derivatives of S. cerevisiae industrial strains that are able to cope with inhibitors present in bagasse hydrolysate and molasses, by means of sexual hybridization and adaptive evolution, which can be used for 2G-ethanol production. The industrial strains PE-2, CAT-1 and SA-1 were sporulated, and haploids were irradiated by ultraviolet (UV) light in order to increase genetic and phenotypic diversity. After direct mating and screening in molasses and hydrolysate media, 234 hybrid strains were selected for further study. In parallel, mass matings (intra and interlines) of PE-2, CAT-1 and SA-1 from non-irradiated haploids were performed and the generated strains were subjected to adaptive evolution for about 100 generations. The 120 strains derived from mass mating and adaptive evolution were then screened for growth in molasses-hydrolysate media. Six isolates showed good fermentation properties compared to the reference strains, showing that hybridization and adaptive evolution of Brazilian industrial yeast strains was a good strategy to develop new tolerant strains for 2G-ethanol production. To better utilize all the sugars present in bagasse hydrolysate, a cassette containing the three genes responsible for xylose fermentation (xylose reductase, xylitol dehydrogenase and xylulose kinase) was integrated into the genome of a haploid derivative (272-1a) of one of the six selected hybrids (272), which had the highest tolerance to Miscanthus x giganteus hydrolysate. Fermentation studies demonstrated that this engineered strain was able to metabolize xylose into ethanol. Finally, the haploid 272-1a was analyzed by quantitative trait loci (QTL) mapping to identify the genetic basis of hydrolysate tolerance. Although the causative gene(s) were not identified in this work, a number of QTL peaks were identified that will serve as the starting point for future fine-mapping studies.
1 INTRODUCTION!
Global climate change and volatility of petroleum prices have driven the necessity to reduce the fossil fuel consumption and replace it with renewable energy source. Bioethanol production in the United States and Brazil, from corn and sugarcane respectively, is already established; however these renewable energy sources have some ethical limitations, because food-products are being used to produce biofuel (BELLISSIMI et al., 2009; WRIGHT et al., 2011; KIM et al., 2013a). Additionally in Brazil, deforestation of new areas to expand the agricultural area is unsustainable. Non-food renewable feedstocks, such as lignocellulosic biomass (i.e. sugarcane bagasse) are an effective alternative to boost bioethanol production in Brazil by up to 30%, while preserving native areas (G20, 2014; GLOBO RURAL, 2014).
Lignocellulosic biomass is mainly composed of cellulose, hemicellulose and lignin in an organized structure; however, a pretreatment is required to hydrolyze the hemicellulose and make the cellulose accessible to enzymatic hydrolysis. Although the commonly used method of acid thermochemical pretreatment of lignocellulosic biomass releases pentose and hexose sugars (HA et al., 2011), the harsh reaction conditions also results in the formation of inhibitors (e.g. furfural, 5-hydroxymethyl furfural (HMF) and carboxylic acids) that have a negative effect on the growth and fermentation of ethanol producing microorganisms, such as Saccharomyces cerevisiae (JONSSON et al., 2013; SATO et al., 2014).
Second-generation ethanol in Brazil has the possibility to use a blend of sugarcane bagasse hydrolysate and cane molasses (co-product from the sugar industry). Molasses provides nutrients and minerals that are missing or deficient from hydrolysate, such as amino acids, B group vitamins (HARRISON, 1971), organic acids (trans-aconitc, citric, malic, which contribute a desirable buffer effect), fatty acids (linoleic, palmitic, oleic and linolenic) (GUTIERREZ; SILVA, 1993) and minerals (K, Mg, S, Ca, P, Zn, Cu, Mn, Al) (MORRISON, 1959). These organic and mineral nutrients are crucial for maintaining S. cerevisiae cell viability during cell recycling that is practiced in Brazilian distilleries. Molasses also contributes to an increased sugar concentration that results in higher ethanol titers, and consequently lower energy consumption in the distillation step. However, molasses also has inhibitors, such as HMF, sulfite, and toxic concentration of some minerals (K, Ca) that affect S. cerevisiae fermentation performance (BASSO et al., 2008).
viability in order to sustain a large biomass inside the fermenter (BASSO et al., 2008). It is expected that second-generation lignocellulosic ethanol production will apply the same fed-batch process using hydrolysate, and similarly, yeasts with high viability will be required to withstand the rigors of cell recycling. In addition, yeast strains for second-generation ethanol production in Brazil need to be tolerant to the cocktail of inhibitors present both in hydrolysate and molasses, and robust to the stresses encountered during the industrial process (i.e. high temperature, high ethanol content, acid treatment, osmotic pressure, cell recycling).
However industrial yeast strains, used for first-generation (1G) ethanol, have been showing decreased implantation capacity due to the higher proportion of molasses in the current industrial substrate (BASSO et al., 2008); a new generation of more tolerant yeast strains are required for both first and specially second-generation (2G) ethanol production. One viable approach to developing these new yeast strains is sexual hybridization and mass mating of current 1G strains. This is possible because current (1G) industrial strains are commercially available, they sporulate easily and generate viable spores, and they have already been selected for tolerance to industrial fermentation conditions (ALEXANDRINO, 2012). In addition, to mating and sporulation, genotypic and phenotypic diversity can be further increased by induced mutation by ultraviolet (UV) irradiation and adaptive laboratory evolution.
In addition, it is essential for economic conversion of renewable feedstock into biofuels and chemicals, an efficient and rapid fermentation of mixed sugars, ~70% of hexoses and ~30% of pentoses present in lignocellulosic biomass (HA et al., 2011). However wild type S. cerevisiae used for first-generation (1G) ethanol cannot ferment pentose (xylose).
2 REVIEW
2.1 Second-generation ethanol in Brazil
Global concerns about climate change and international oil prices have increased the adoption of renewable energy policies. Biofuels (i.e. bioethanol and biodiesel) can contribute to minimizing fossil fuel consumption. Bioethanol production is obtained from sugarcane substrates (cane juice and molasses) and cornstarch fermentation by Saccharomyces cerevisiae, in Brazil and the United States, respectively. Currently, Brazil is the world’s second biggest ethanol producer (RENEWABLE FUELS ASSOCIATION - RFA, 2014) and production is expected to reach 27 billion liters of ethanol in the 2014/2015 season (COMPANHIA NACIONAL DE ABASTECIMENTO - CONAB, 2014). However, the first-generation (1G) ethanol industry in Brazil and the United States appears unsustainable in view of the potential stress its production places on food commodities. In contrast, second-generation (2G) biofuels produced from cheap and abundant non-food plant feedstocks, has been viewed as one plausible solution to this “food versus fuel” problem (GOMEZ et al., 2008; BASSO et al., 2013).
In Brazil, sugarcane bagasse and sugarcane straw are available sources of lignocellulosic biomass and are considered a very promising feedstock for 2G-ethanol production. Although burning bagasse/straw at ethanol distilleries for generation of electricity is current profitable, the development of 2G-bioethanol will be more advantageous (DIAS et al., 2011). Additionally, the high cost of 2G-bioethanol production, irrespective of the lignocellulosic feedstock used, can be partially solved by integrating the 1G and 2G technologies into a plant thus sharing energy and material streams in unit operations in order to exploit synergies (MACRELLI et al., 2012).
the end of this fermentation, the yeast is separated from the fermented must by centrifugation and diluted to 30-40% (w/v) with water, and then submitted to an acid treatment (sulfuric acid, pH 1.8 to 2.5 for 1-2 hours) to reduce the bacterial contamination. After the acid wash the yeast is ready for the next fermentative cycle. The yeast cells can be submitted to two daily cycles during the annual sugarcane harvest season (200-250 days). Yeast cells must be tolerant to the stresses encountered during fermentation, such as high ethanol content, high temperature, osmotic pressure and cell recycling (BASSO et al., 2008). It is expected that 2G-bioethanol production will utilize a similar industrial process and yeast cells will encounter stress condition present for 1G ethanol and 2G ethanol, such as organic acids and HMF. In addition, the yeast will need to be propagated during fermentations cycles to replace biomass that is lost during the centrifugation and acid-wash step.
In Brazil, a selection program was performed for 12 years hoping to select optimal yeast strains that are ideally suited for industrial ethanol production. Some of the desired traits are high ethanol yield, reduced glycerol and foam formation, maintenance of high viability during recycling, and long-term prevalence and persistence in the bioreactor. As a result of this selection program, a number of S. cerevisiae strains, such as BG-1, CAT-1, PE-2 and SA-1 were identified, and became widely used in distilleries for many decades. Therefore, such strains were not suitable for 2G-ethanol production, but could be of great importance as biological material for a breeding program, generating better strains (BASSO et al., 2008).
2.2 Genotypic and phenotypic diversity of Saccharomyces cerevisiae strains
Currently, industrial strains represent only the tip of the “iceberg” of the genetic and phenotypic diversity present in natural S. cerevisiae isolates. Although it is possible to isolate additional strains as a source of genetic diversity, which could be used for breeding and selection, an alternative approach is to generate diversity artificially. A number of methods, such as mutagenesis, genome shuffling, adaptive evolution, and direct genetic modification could be used to develop 2G-ethanol production strains. These techniques can be used to select for specific traits and might lead to the generation of optimal strains more rapidly than traditional breeding and selection (STEENSELS et al., 2014). Many industrial strains often show aneuploidy, polyploidy, poor sporulation efficiency, and unstable mating type (homothallic); together, this makes it difficult to apply artificial diversity techniques (GIUDICI et al., 2005). In contrast, Brazilian industrial strains isolates from 1G-ethanol process are heterothallic (have stable mating types), diploid, and sporulate easily giving viable spores; together, these traits facilitate their genetic manipulation (ARGUESO et al., 2009; ALEXANDRINO, 2012).
Several different processes can generate genetic variation. Such processes include sexual reproduction, where the genomes of two parents are combined and shuffled by recombination. S. cerevisiae can undergo sexual reproduction and this can lead to the generation of new strains. In addition, S. cerevisiae can grow asexually, and spontaneous mutations can accumulate during mitotic growth (STEENSELS et al., 2014).
Combining desirable characteristics by breeding and selection is a standard approach to improve the properties of sexual reproduction organisms (DARWIN, 1859 apud GIUDICI et al., 2005). Hybrids derived from different yeast strains may have better fitness and performance than either parental strain (i.e. heterosis). Hybridization of heterothallic yeast strains directly by micromanipulation or mixing of sporulated cultures was the first publish method of yeast strain improvement (WINGE & LAUSTEN, 1938; GIUDICI et al., 2005). Sexual hybridization (or reproduction) increases the evolutionary potential of a species (BUCKLING et al., 2009). Direct mating, mass mating or genome shuffling can be used to achieve hybridization in S. cerevisiae.
haploid segregant can be selected for hybridization (LINDEGREN; LINDEGREN, 1943). This technique is called “cell-to-cell” and consists of simply mixing cell cultures of the two selected haploids. In homothallic strain, no stable haploid segregants can be obtained, and the additional prescreening is not feasible (SIPICZKI, 2008).
Although time-consuming, direct mating has proven to be an effective way to obtain hybrids that display desired phenotypes (SIPICZKI, 2008). For example, a hybrid of a haploid segregant of the Ethanol Red strain and an engineered inhibitor tolerant strain was used to develop an improved for fermentation of a mixture of glucose and xylose. This strain had a number of desirable traits, including faster growth rate in glucose medium, faster glucose consumption rate and higher ethanol accumulation capacity in very high gravity fermentation; also, it was able to metabolize a mixture of glucose and xylose (DEMEKE et al., 2013). Hybrids obtained by direct mating of flocculent strains of S. cerevisiae and cold-fermentation strains of S. uvarum, showed interesting characteristics for sparkling wines, such as less formation of fermentation products (i.e. glycerol, succinic acid, acetic acid, and malic acid) than the parental strains; fermentation at low temperatures and production of a wine that is highly aromatic (COLORETTI et al., 2006). Sipiczki (2008) had reported several works from different authors of interspecies hybrids obtained by direct mating of S. cerevisiae and S. uvarum wine strains, S. kudriavzevii and S. paradoxus.
Mass mating is a technique in which a large number of haploid yeast cells, often from different parental strains are mixed and allowed to cross randomly. Mass mating has been used to generate industrial strains with improved characteristics (STEENSELS et al., 2014). Mass mating was used to create interspecific hybrids between different wine strains by crossing a top-fermenting S. cerevisiae strain with a cryophilic S. bayanus strain. The desired hybrid strain was then selected based on the combination of traits inherited from each parent, such as the ability to assimilate melibiose and growth at low temperature (20oC). The result of this interspecies hybridization was a new strain that exhibited both good low temperature fermentation and produce wine with new flavor characteristics (SATO et al., 2002).
by replacing them with the wild type sequences, avoiding the hampering of general fitness (GIUDICI et al., 2005). Genome shuffling has been successfully applied as an effective whole-cell engineering approach for the rapid improvement of industrially important microbial phenotypes (GONG et al., 2009). Compared to other improvement techniques, genome shuffling has the advantage of exploiting the full genetic diversity in a population and makes it possible to combine useful mutations from many different individuals, while other hybridization methods, such as direct mating, typically involve only a limited number of haploid cells. Additionally, while traditional methods of strain improvement often select only the best-performing mutant for each subsequent round, genome shuffling exploits a much larger proportion of the diversity present in the population (STEENSELS et al., 2014). In this way, both laboratory and industrial S. cerevisiae strains have been selected for desired phenotypes such as ethanol tolerance, thermotolerance, acetic acid tolerance, and fermentation performance using genome shuffling. Some recent studies, reported by Steensels et al. (2014), combine metabolic engineering with genome shuffling (TAO et al., 2012; DEMEKE et al., 2013). These approaches are promising to optimize strains for second-generation bioethanol production (STEENSELS et al., 2014).
2.3 Mutagenesis
Mutagenesis is often the first step in generating genetic variation in a cell or population, followed by sexual hybridization (direct mating, mass mating or genome shuffling) of the best-performing mutants (STEENSELS et al., 2014). Mutagenesis is commonly used to obtain interspecies hybrids for wine fermentation (GONZÁLES et al., 2006; SIPICZKI, 2008), flocculent Saccharomyces strains for sparkling wines (COLORETTI; TINI, 2006), and for brewer’s yeast with desired characteristics (SATO et al., 2002).
While mutations are induced with the same frequency in haploid, diploid or polyploid cells, they are not as easily detected in diploid or polyploid as in haploid cells because of the presence of non-mutated alleles. Only if the mutation is dominant will it affect the phenotype. Therefore, haploid derivatives are preferred for the mutagenesis program (PRETORIUS, 2000). Because the rate of spontaneous mutation is low, approximately 10-6 per generation (PRETORIUS, 2000), the use of induced mutagenesis techniques, such as chemical of UV light is commonly used (GIUDICI et al., 2005).
of pyrimidine dimers, hydroxylated bases, and cross-linking of DNA strands (ROWLANDS, 1984). A combination of UV irradiation and genome shuffling is a powerful strategy for strain improvement and had been used to improve thermotolerance, ethanol tolerance, and ethanol productivity of S. cerevisiae (SHI et al., 2008). For example, pools of S. cerevisiae haploid mutants were created by UV mutagenesis, then mated and subjected to five rounds of genome shuffling in order to generate strains that are tolerant to inhibitors present in hardwood spent sulfite liquor (PINEL et al., 2011). In another example, subjecting a pool of UV-induced variants to consecutive rounds of fermentation in very high gravity wort was used to obtain improved industrial yeast strains for lager brewing (BLIECK et al., 2007).
2.4 Adaptive evolution
Charles Darwin’s theory for the evolution of new species by natural selection is a long timescale process that can be observed in the fossil record. In the laboratory, microorganisms with a short generation time can be evolved for hundreds or even thousands of generations; therefore it is possible to generate new strains in a relatively short timespan. Adaptive evolution in the laboratory relies on genetic diversity and artificial selection, which is analogous to processes that occur in nature during the evolution of new species (BUCKLING et al., 2009)
Strain improvement by evolutionary engineering, a term first described by Butler et al. (1996) and later referred to as adaptive, directed or experimental evolution, applies to the basic principles of natural, induced or both genetic variation (random mutation) and subsequent selection on this variation, allowing the organism to evolve the desired set of phenotypes. In sum, adaptive evolution, naturally selects a population adapted to a specific environment over time (NOVO et al., 2014).
Adaptive evolution has proven to be a valuable tool to create yeast strains with specific improved characteristics (SAUER, 2001). Normally directed evolution is used to fine-tune a specific phenotype that is already present in the original population, but is not optimal yet (STEENSELS et al., 2014). Usually, adaptive evolution is performed for 100 to 2000 generations and normally it takes a few weeks up to a few months of phenotypes competition for a dominance of suitable strain in the total population (DRAGOSITS; MATTANOVICH, 2013). Batch culture in shake flasks with serial transfers of cells to a new flask with fresh medium for an additional round of growth, or a continuous culture system such as a chemostat are different ways to setup an adaptive evolution experiment (Figure 1) (DRAGOSITS; MATTANOVICH, 2013; NOVO et al., 2014; STEENSELS et al., 2014).
a)
b)
Figure 1 - Adaptive evolution experiment for microbial biotechnology: a) in batch culture shake flasks and b) continuous culture system - chemostat (DRAGOSITS; MATTANOVICH, 2013)
Adaptive evolution was recently demonstrated by an elegant method called visualizing evolution in real-time (VERT) (REYES et al., 2012). During adaptive evolution, mutants with increased performance (adaptive mutants) expand in the population. These adaptive events are identified by VERT, which uses differentially labeled fluorescent subpopulations and flow cytometry to monitor adaptive evolution in real-time (ALMARIO et al., 2013).
2.5 Chromosomal rearrangements
Chromosome rearrangements (CRs) may also represent a mechanism for evolution and adaptation of S. cerevisiae to environmental changes (LOPES, 2000). Variations that result in a difference in the size of the chromosomal DNA molecules can be caused by translocations, deletions or other genomic rearrangements. In addition, CRs are a known mechanism of generating strain variability in several fungal species (ZOLAN, 1995 apud LOPES, 2000).
Chromosomal rearrangements have been observed in S. cerevisiae strains grown in an industrial fermenter. After an eight-month period of cell recycling, CRs were observed in the strain PE-2 (BASSO et al., 2008). During a given season (200-250 days) in a Brazilian distillery it is expected that an introduced starter strain will undergo anywhere from 60 to 70 generations of growth (considering a 10% (w/v) yeast growth for each fermentation cycle, and two fermentation cycles per day) if the strain is able to persist in the bioreactor. In laboratory, CRs of a diploid wine strain were observed after 55 generations of mitotic growth. After 275 generations, about half of the population was represented by 11 different CRs (LONGO; VÉZINHET, 1993). Sporulation followed by germination and growth in rich medium allowed PE-2 strain to exhibit the same CRs as found in the industrial setting, suggesting that both mitotic growth and sporulation might have contributed to the different chromosomal karyotypes observed in various distilleries that used PE-2 as the starting strain (LOPES, 2000). The environmental conditions outside the fermentation tank could allow sporulation to occur and then new recombinant spores might settle again into the fermentation mixture and germinate, resulting in the production of new hybrids strains.
2002; COLSON et al., 2004), starvation (COYLE; KROLL, 2008), and Cu tolerance (CHANG et al., 2013). Most of the studies on yeast adaptation were performed with wine strains or wine conditions and “due to its unique plasticity, the wine yeast genome can change easily both during vegetative propagation (mitotic divisions) and in the sexual cycle (meiosis-sporulation-conjugation). During fermentation, the genomes of certain vegetatively propagating yeast cells undergo multiple, successive mutations and gross genomic rearrangements, resulting in a variety of clones with different genomes, some of them with beneficial changes that have become fixed in the evolution of certain populations” (SIPICZKI, 2011).
Similar to wine strains, adaptive evolution mediated by CRs has been observed in fuel ethanol strains (BASSO et al., 2008). In both cases, the specific advantage(s) conferred by these CRs is not understood.
2.6 Engineered Saccharomyces cerevisiae for xylose fermentation
et al., 2013b). In addition to optimization of the XR/XDH pathway, additional genome modifications have been made to reconfigure yeast metabolism in order to improve xylose fermentation (HA et al., 2011). Even with optimization of xylose fermentation, efficient co-fermentation of glucose and xylose is still problematic, exhibiting a long lag time to metabolize xylose. Co-fermentation of xylose and cellobiose has been developed as a possible solution (KIM et al., 2013b).
Figure 2 - Xylose-assimilation pathways for S. cerevisiae: xylose isomerase (XI) and xylose reductase/xylitol dehydrogenase (XR/XDH). Both pathways require overexpression of xylulose kinase (XK), which connects xylulose to the endogenous pentose phosphate pathway of S. cerevisiae (KIM et al., 2013b)
2.7 CRISPR-Cas9
The CRISPR/Cas9 system can be used to generate markerless loss-of-function alleles, insertion of heterologous alleles, allele swaps and engineered proteins in yeast by in vivo selection (DICARLO et al., 2013; RYAN et al., 2014). Cas9 is a relatively new and powerful tool for engineering yeast genomes.
Figure 3 – Illustration of CRISPR-Cas9 system genome editing
2.8 Polygenic Analysis
QTL depends on a large number of genotypes segregants; however, genotyping each segregant individually is laborious and expensive. An elegant strategy is genotyping the whole pool (MICHELMORE et al., 1991). This technique called bulk-segregant analysis (BSA) genotypes two pools (or bulks) – the selected pool and the control pool. The selected pool contains a large number of segregants that expresses the trait of interest, while the control pool contains similar number of segregants that were not selected for the trait (EDWARDS; GIFFORD, 2012; SWINNEN et al., 2012).
The extreme (X-QTL) method is similar to BSA, and relies on selection of a large pool of haploid segregants from a cross, using mating-type specific auxotrophy (EHRENREICH et al., 2010). The segregant pool is then subjected either to growth under a strong selective condition (which selects for the extreme of the phenotypic distribution) or a control condition (without selective pressure). Changes in allele frequency are calculated and used to calculate QTL intervals (PARTS et al, 2011). Therefore, QTL mapping is based on three steps: i) generation of a segregating population; ii) phenotype selection of these populations; iii) quantitative measurement of the pool allele frequency (Figure 4). While traditional QTL mapping uses a population size of 102 segregants, high-resolution extreme QTL (X-QTL) uses a much larger population size (107) (EHRENREICH et al., 2010). Using this large population size, it is possible to effectively sample many more recombination breakpoints; therefore, it is possible to map QTL intervals down to single gene resolution (PARTS et al, 2011). One QTL intervals are calculated, either reciprocal hemizygosity analysis (STEINMETZ et al., 2002) or allele swapping (LITI; LOUIS, 2012) can be used to narrow down each QTL intervals and indentify the QTG(s) or QTN(s) that underlie the complex trait.
Figure 4 - QTL overall strategy - showing three-step QTL mapping strategy by crossing two phenotypically different strains to create a segregating pool of individuals of various fitness, and growing the pool in a restrictive condition that enriches for beneficial alleles that can be detected via sequencing total DNA from the pool (PARTS et al., 2011)
3 OBJECTIVE
4 MATERIAL AND METHODS
4.1 Direct mating
4.1.1 Tetrad dissection
S. cerevisiae strains (PE-2, CAT-1 and SA-1) were streaked on YPD-A (1% yeast extract, 1% peptone, 2% dextrose, 2% agar) and kept at 30oC for 48 hours. Cells were streaked on raffinose-acetate sporulation medium (0.02% of raffinose, 0.3% of potassium acetate, 2% of agar) and incubated at 30°C for 7 days until sporulation occurred. Using a sterile stick a portion of the sporulated cells were added to 1 µL of zymolyase enzyme (ZymoReasearch® 10 units/uL), 3 µL of mercaptoethanol and 296 µL buffer, in a 1.5 mL Eppendorf® tube and incubated for 10 minutes at room temperature. Treated cells were streaked using a new sterile stick on a new YPD-A plate. Tetrads were dissected using a micromanipulator (Carl Zeiss Scope A1 AXIO) and the mating type of isolated spores determined (MORTIMER et al., 1969) using testers strains.
4.1.2 Stock culture preservation and growth media
Yeast stock cultures were maintained at -80oC in YPD (1% yeast extract, 1% peptone, 2% dextrose) supplemented with 15% glycerol. The following media were used for selection experiments in microplate reader: i) molasses-selective medium (15% total reduced sugar from molasses (TRS), 8% (v/v) of absolute ethanol, 0.6 g/L acetic acid, pH 4); ii) molasses-hydrolysate medium I (16.6% TRS (31% of the sugar came from Novozymes molasses-hydrolysate), 5.1 g/L acetic acid, 0.79 g/L furfural, 0.23 g/L HMF, pH 4.5-5); and iii) molasses-hydrolysate medium II (13% TRS, 3.6% (v/v) of absolute ethanol, pH 5, and the same content of acetic acid, furfural, and HMF). The ethanol added in medium iii had proposed to simulate a cell recycling fermentation process when fermentation starts with pre-formed ethanol. In media ii and iii molasses was blended with Novozymes hydrolysate and diluted for the desirable sugar concentrations. Cellobiose and pentose sugars were not taken into account.
4.1.3 Direct mating of haploids from the same tetrad
LINDEGREN, 1943) and 73 strains were obtained from among haploids of the same tetrad. The strains were evaluated by optical density measurements at 570 nm (OD570nm) and maximum specific growth rate (µmax) was calculated according to Tahara et al. (2013), in two different media: i) molasses-selective medium; and ii) molasses-hydrolysate medium I, in a 96-well microplate. The plate was set up in technical replicates with 90 µL of medium and 10 µL of fresh cell culture (pre-grown in 3 mL of a YPD overnight culture) using PE-2, CAT-1 and SA-CAT-1 as reference strains. Growth experiments were performed in a TECAN Infinite® 200 Pro Series plate reader at 30°C, and OD570nm was measured every 2 hours for 24 hours. Before each time point the plate was shaken for 10 minutes.
After screening 73 strains in the molasses-selective and molasses-hydrolysate (I) media, 26 strains were selected for additional screening in molasses-hydrolysate medium II, using the 96-well microplate assay described above. After this second-round of screening, four strains were selected for batch fermentation analysis (see Section 4.3).
4.1.4 Ultraviolet irradiation and pre-screening of irradiated haploids
Eleven haploids (derived from CAT-1, PE-2 and SA-1 after sporulation and tetrad dissection (see Section 4.1.1 above) of large colony size were selected by plating on YPD-A and each isolate was then grown overnight in 10 mL of YPD broth. Each overnight culture was then diluted to a starting OD 0.3 using 10 mL of fresh YPD broth and grown until log phase (~3-4 hours). Five mL of each log phase culture were irradiated using ultraviolet (UV) light at 254 nm for 15 minutes at a distance of 30 cm (RESNICK, 1969). After UV irradiation each culture was plated on YPM-A (2% of total sugar from molasses, 600 mg/L acetic acid, 5% added ethanol and pH 5), and kept in the dark to avoid photo-reactivation repair, at 30oC for 48 hours. Around 15 colonies from each irradiated haploid culture were selected based on fast growth (i.e. larger colony size). The selected 151 irradiated colonies were then evaluated in molasses-selective medium using a 96-well microplate assay (see Section 4.1.3 above) and 21 irradiated haploids were selected based on growth (OD570nm and µmax) after 24 hours.
4.1.5 Direct mating of irradiated haploids and pre-screening of the resulting hybrids
isolate zygotes (LINDEGREN; LINDEGREN, 1943). A total of 234 zygotes (UV-hybrids) were isolated using a micromanipulator (Carl Zeiss Scope A1 AXIO) and evaluated for growth (OD570nm and µmax) in a 96-well microplates using two different media: i) molasses-selective medium, and ii) molasses-hydrolysate medium I. After screening in these two media types, 125 UV-hybrids were selected for a second-round screening in molasses-hydrolysate medium II. After this second-round screening, six UV-hybrids were selected for a third round of screening by batch fermentation (see Section 4.3 below).
4.2 Mass mating followed by adaptive evolution
4.2.1 Mass mating
A series of intra-strain and inter-strain matings were performed by mixing 100 µL of each haploid (first grown overnight in 3 mL of YPD at 30oC) in 250 mL erlenmeyer flasks containing 100 mL of YPD. Using haploids derived from PE-2, CAT-1, and SA-1, the following mass matings were performed: 91 haploids from PE-2 (P pool), 89 haploids from CAT-1 (C pool), 50 haploids from SA-1 (S pool), 180 haploids from PE-2 and CAT-1 (PC pool), 141 haploids from PE-2 and SA-1 (PS pool), 139 haploids from CAT-1 and SA-1 (CS pool), and 230 haploids from PE-2, CAT-1 and SA-1 (PCS pool). These seven different mass mating pools were maintained at 30oC for 48 hours (ALEXANDRINO, 2012).
4.2.2 Adaptive evolution
Seven different pools (P, C, S, PC, PS, CS and PCS) were subjected to about 100 generations of laboratory evolution with an increasing concentration of sugar (from 10% to 14%), ethanol (from 3% to 5.5%), and acetic acid (300 to 400 mg/L, pH 4 to 3.7). Fifteen successive transfers (Figure 5) were performed over the course of 80 days by inoculating 1 mL of cell culture from a saturated culture into 127 mL of fresh growth media according to the Table 1.
Figure 5 – Adaptive evolution for 105 generations (15 transfers x 7 generations)
1G# 2G# 3G# 4G# 5G# 6G# 7G#
!
Table 1 - Adaptive evolution media composition
Day! Transfer! Media! Composition!
Total!reduced!sugar!(%)! !Ethanol!(%)! Acetic!acid!(mg/L)! pH!
0! 1a! !
I!
! 10!
! 3!
! 300!
! 4! 3! 2a!
10! 3a!
14! 4a! !
II!
! 12!
! 4!
! 350!
! 3.8! 19! 5a!
23! 6a!
30! 7a! III! 13! 5! 400! 3.7!
32! 8a! !
! IV!
! ! 13!
! ! 5!
! ! 300!
! ! 4! 37! 9a!
41! 10a!
47! 11a!
56! 12a!
61! 13a! !
V!
! 14!
! 5.5!
! 300!
! 4! 66! 14a!
71! 15a!
80! 16a! Recovery! 10! O! O! O!
4.2.3 Karyotyping
After the last transfer, the evolved pools were recovered by plating on YPD-A and incubating at 30oC for 48 hours. Fifteen colonies from each recovered pool were karyotyped by pulsed field gel electrophoresis (PFGE) (BLONDIN; VÈZINHET, 1988; modified according to BASSO et al., 2008) (BioRad/CHEF-DR®III System), and grouped according to their electrophoretic profile (VÈZINHET et al., 1990; BASSO et al., 2008). Thirty colonies from the PCS pool were selected because this population can show higher variance (phenotypic and genotypic). However, only 15 colonies were karyotyped. Fifteen colonies from the original parent strains PE-2, CAT-1 and SA-1 were also karyotyped for comparison.
4.2.4 Pre-screening of evolved strains
Figure 6 - Inform flow chart of screening
4.3 Batch fermentation screening with cell recycling (Brazilian fed-batch process)
A total of 427 strains were generated by either direct mating or mass mating (see Figure 6 above). After two rounds of screening, 24 strains were identified, which had the best growth (OD570nm) for screening by batch fermentation with cell recycling. The parent strains PE-2, CAT-1, SA-1 and Mauri (baker's yeast) were also screened for comparison. The final set of 24 strains included: four strains derived from direct mating of haploids from the same tetrad, six strains from direct mating of UV-irradiated haploids and fourteen strains derived from mass mating followed by adaptive laboratory evolution. The batch fermentation experiments were performed to simulate, to some extent, the conditions encountered in a Brazilian industrial distillery. Five fermentation cycles were performed, and the whole biomass was reused in each subsequent fermentation. The following parameters were estimated (ethanol titer, biomass gain, glycerol content, residual sugar, cell viability, cellular
Direct'ma*ng'of'haploids' from'the'same'tetrad'
(73'strains)'
Mass'ma*ng'followed'by' adap*ve'evolu*on'
(120'isolates)'
Total'427'strains'
MolassesCselec*ve'medium'
C'15%'TRS'(from'molasses)' C'8%'ethanol'
C'0.6'g/L'ace*c'acid' C'pH'4.8'
MolassesChydrolysate'medium'I' C'16.6%'TRS'(31%'sugar'came'from'hydrolysate)' C'5.1'g/L'ace*c'acid'
C'0.79'g/L'furfural' C'0.23'g/L'HMF' C'pH'4.5C5' 221'strains'
(26'tetrad+125'UV+70'evolved)'
MolassesChydrolysate'medium'II''
(13%'TRS,'3.6%'ethanol,'5.1'g/L'ace*c'acid,'0.79'g/L'furfural,'0.23'g/L'HMF,'pH'5)'
24'strains'
(4'tetrad+6'UV+14'evolved)'
Screening'fermenta*on'with'cell'recycling' MolassesChydrolysate'fermenta*on'medium'
Direct'ma*ng'of'UV' irradiated'haploids'
trehalose, and cellular glycogen contents) and used to select strains for detailed genetic and genomic studies (see Sections 4.4.7 and 4.4.8 below).
4.3.1 Propagation medium
Propagation medium was prepared by diluting cane molasses to 15% TRS, centrifuged (10,000 rpm for 20 minutes at room temperature) to remove the insoluble material, and the supernatant sterilized (121oC for 25 minutes). Once cooled, it was stored at -20°C until ready to use.
4.3.2 Starting strains
Twenty-four selected strains (see Section 4.3) and four reference strains (PE-2, CAT-1, SA-1 and Mauri) were first grown to saturation in 5 mL YPD broth and then the whole volume was added to 100 mL of propagation medium and growth for 24 hours at 30oC. The necessary yeast biomass (1g wet weigh) was collected by centrifuging at 800 x g at room temperature for 15 minutes and then used for the first fermentation cycle.
4.3.3 Novozymes bagasse hydrolysate
Sugarcane bagasse was pre-treated by steam explosion (STEX) with dilute phosphoric acid (9.5 mg H3PO4/g dry solids) at 180oC for 5 minutes. The pretreated material (both liquor and solid cellulose-lignin) was then digested with the Cellic® CTec3 enzyme mixture at 50oC for 72 hours (Novozymes Latin America Ltd). The resulting bagasse hydrolysate (called Novozymes hydrolysate) has 18% total solids, 69.3 g/L of glucose, 38 g/L of xylose, 4.3 g/L of cellobiose, 2.9 g/L of arabinose; 6.8 g/L of acetic acid, 1.05 g/L of furfural and 0.3 g/L of HMF.
4.3.4 Molasses-hydrolysate fermentation medium
added (3.6% - v/v), the pH was adjusted to 4.8 using 5N H2SO4, and 3 mg/L antibiotic Kamoran® was added.
4.3.5 Fermentation
Fermentations were conducted in 15 mL conical tubes initially containing ~1 g of wet biomass (i.e. pelleted yeast with 25% dry matter) using 10 mL molasses-hydrolysate fermentation medium. The first and second cycles were started with 6.5% TRS. The third and fourth cycles were started with 9.8% TRS (total reduced sugar), and the fifth cycle with 7.7% TRS.
Fermentation experiments were conducted at 30°C at the end of each fermentation cycle the biomass was separated from the fermented medium by centrifugation (800 x g for 20 minutes), weighed and used for a subsequent fermentation cycle (for a total of five cycles). The supernatant was stored at -20oC for further analysis (ethanol, residual sugars, xylitol and glycerol). Yeast cell viability was estimated at the end of the second to fifth fermentation cycles, while cell trehalose and glycogen contents were determined only at the end of the fifth fermentation cycle.
4.3.6 Yeast cell viability estimation
Yeast cell viability was estimated by optical microscopy using differential erythrosine staining of cells (OLIVEIRA et al., 1996). Viable cells (not stained) and non-viable cells (stained pink) were counted in a Neubauer chamber, and viability expressed as a percentage of total cells counted (OLIVEIRA et al., 1996).
4.3.7 Biomass estimation
The (wet) biomass was estimated by weighing the pelleted cells, after the centrifugation step.
4.3.8 Ethanol content estimation in centrifuged wine
distillate was measured using a digital densiometer (ANTON PAAR - DMA48) and ethanol content was calculated according (ZAGO et al., 1996).
4.3.9 Xylitol, glycerol and residual sugars determination in the centrifuged fermented must
Xylitol, glycerol and residual sugars (glucose, fructose, sucrose) were measured by high performance anion exchange chromatography (HPAEC) using an ion exchange chromatograph (DIONEX - DX-300) equipped with a CarboPac PA-1 column 4 x 250 mm and a pulsed amperometric detector. The mobile phase used was 100 mM NaOH at a flow rate of 0.9 mL/min (BASSO et al., 2008).
4.3.10 Glycogen extraction and quantification
The glycogen content was estimated by the method of Becker (1978) and modified according to Rocha-Leão et al. (1984). Wet biomass (200 mg) was transferred to a test tube with a screw cap and washed with 5 mL of ice-cold distilled water. The tubes were then centrifuged at 3,500 rpm at room temperature for 6 minutes. The supernatant was discarded. The washed biomass pellet was then resuspended in 2 mL of freshly prepared 0.25 M Na2CO3. Tubes were sealed with a screw cap and boiled in a water bath for 90 minutes. Quantification of glycogen was performed using an enzyme-coupled (glucose oxidase and peroxidase) colorimetric assay (BECKER, 1978) (absorbance at 500 nm) based on glucose release after enzymatic hydrolysis of the glycogen with amyloglucosidase.
4.3.11 Extraction and quantification of trehalose
4.4 Pre-screening for Miscanthus x giganteus lignocellulosic hydrolysate substrate
Three hybrid yeast strains (133, 272, 409) showing good tolerance and fermentation characteristics in molasses-hydrolysate medium (both feedstocks derived from sugar cane) together with their respective parent haploids were used for further screening in Miscanthus x giganteus hydrolysate and genetic studies at the University of California Berkeley.
4.4.1 Stock culture preservation
Stock cultures were maintained in YPD and 15% glycerol at -80oC using 2 mL Corning® cryogenic vials.
4.4.2 Miscanthus x giganteus hydrolysate
Hydrolysate was obtained from the National Renewable Energy Lab (NREL) with the following conditions: Miscanthus x giganteus plant material (around 1 inch size) was pretreated with 1.5% (w/w) sulfuric acid at a 25% (w/w) biomass loading at 190°C for approximately 1 minute, and then the pressure was rapidly released. The liquid phase after filtration is referred to as hydrolysate. The hydrolysate thus obtained was stored at -20°C.
Aliquots of hydrolysate were then adjusted to pH 5.5 with 3M KOH, centrifuged at 4,000 rpm at room temperature for 10 minutes in an Eppendorf® 5810R centrifuge to remove insoluble material, then filter sterilized using a 0.2 micron filter system (Corning® Filter System). After pH adjustment and filtering, the hydrolysate (now considered 100% by volume) was aliquoted again and stored at -80oC until use.
The composition of the hydrolysate was determined by Greer et al. (2014). The M. giganteus hydrolysate from NREL has the following sugar composition: 21.39 g/L of glucose, 50.44 g/L of xylose, 4.65 g/L arabinose. The following inhibitors were quantified: 1.08 g/L succinic acid, 0.09 g/L of lactic acid, 0.98 g/L formic acid, 9.71 g/L acetic acid, 1.05 g/L of levulinic acid, 0.83 g/L HMF, 1.88 g/L furfural, and 0.22 g/L glycerol.
! !
4.4.3 Screening of selected hybrids and their haploids for growth in M. giganteus
hydrolysate
containing 80 g/L of glucose (SC-80) supplemented with 20, 25, 30 or 50% (v/v) of M. giganteus hydrolyzate. SC-80 media contains: 80 g/L of glucose (Sigma-Aldrich), 2 g/L of complete dropout mix without YNB (US Biological), 6.7 g/L of yeast nitrogen base without amino acids (BD), 19.5 g/L of MES buffer (Sigma-Aldrich), pH adjusted to 5.5 with 3 M NaOH. Strains were streaked on YPD-A from the -80oC stock culture and grown at 30oC for 48 hours. To test biological replicates, three colonies from each strain were grown overnight (30oC, 150 rpm) in separate test tubes containing 10 mL of SC-80 broth. The 96-well microplate growth assay was set up using 130µL of medium and 20 µL of fresh cell culture diluted in sterile deionized water to have initial OD600nm of 0.3 in final volume of 150 µL and final concentration of 1xSC-80. Growth was evaluated by measuring the OD at 600 nm every 15 minutes for 72 hours using a Tecan Sunrise, in aerobic (under oxygen-limited condition), anaerobic or both conditions, at 30°C with continuous shaking (orbital shaker, frequency of 9.2 Hz; with an amplitude of 4.4 mm). Anaerobic experiments were set up into an anaerobic chamber (Coy Laboratory/Airlock).
4.4.4 Tetrads dissection of selected hybrids and mating type identification
To identify whether the strains were heterothallic or homothallic, three selected hybrids (133, 272 and 409) and the reference strain SA-1, were sporulated, tetrads dissected, and the mating type of the spore clones identified by PCR as Huxley et al. (1990).
4.4.4.1 Sporulation and tetrad dissection
The reference strain SA-1 and hybrids 133, 272 and 409 were streaked on YPD-A and grown at 30°C for 48 hours. After growth of isolated colonies, one colony of each strain was grown in 10 mL of YPD broth overnight on a roller wheel at 30°C. The overnight culture was then diluted back to OD600nm 0.225 in 10 mL of fresh YPD and grown until log phase (OD600nm 0.6 to 0.8). The culture was then centrifuged at 4,000 rpm for 10 minutes in Eppendorf® 5810R centrifuge, the cell pellet washed twice in 10 mL of sterile deionized water, and then resuspended in 10 mL of 1% potassium acetate medium to induce sporulation. Cultures were sporulated at room temperature for ten days on a roller wheel.
enzyme (ZymoReasearch® 10 units/µL) and incubated at 37°C for 15 minutes. After zymolyase treatment the samples were kept in an ice batch. An aliquot of 10 µL was spread on YPD-A plate, and tetrads were dissected using a micromanipulator (Singer MSM System 400).
4.4.4.2 Mating type identification by PCR
After growth of spore clones on YPD-A plate, the mating type of 34 putative haploids was determined by PCR. Each putative haploid was purified by restreaking on YPD-A and grown at 30°C for 48 hours. Genomic DNA (gDNA) was isolated using a YeaStar® Genomic DNA Kit™. The integrity of the gDNA was confirmed by electrophoresis on an E-Gel 0.8% agarose containing ethidium bromide (Invitrogen, Life). The master mixture for one PCR reaction was prepared with 13 µL sterile deionized water, 21 µL of 3M Betaine (Sigma-Aldrich), 1 µL dimethyl-sulphoxide (DMSO, Sigma-(Sigma-Aldrich), 5 µL 10x NEB TAQ buffer, 1 µL dNTPs (10 mM of each dNTP), 5 µL gDNA (10 ng/µL), 4 µL of 10 µM primer mixture and 0.25 µL NEB TAQ. The primer mixture was prepared with primer MAT1
(5'-AGTCACATCAAGATCGTTTATGG-3’), primer MAT2
(5'-GCACGGAATATGGGACTACTTCG-3’) and primer MAT3
(5'-ACTCCACTTCAAGTAAGAGTTTG-3’). PCR was performed using an Applied Biosystems Veriti™ thermal cycler with the following program: initial denaturation at 94°C for 5 minutes; 30 cycles at 94°C for 30 seconds, 55oC for 30 seconds, 72°C for 2 minutes; and final extension at 72°C for 10 minutes (HUXLEY et al., 1990).
After PCR and electrophoresis, the mating type (MATa, MATα, or MAT a/α) was determined; all 34 spore clones were found to be haploid. The 34 haploids were then restreaked on YPD-A plates, gDNA isolated and the PCR repeated. All 34 clones showed the same mating type as previously determined, confirming that they are stable haploids. After sporulation and tetrad dissection the mating locus segregated with a 2:2 ratio for all three hybrids and SA-1; therefore, all of the tested strains were heterothallic diploids.
4.4.5 Screening of haploid segregants from hybrid (272) for M. giganteus hydrolysate
tolerance
SC-80 medium supplemented with 50% (v/v) of M. giganteus hydrolyate grown under anaerobic conditions in a 96-well microplate format as described above. For comparison, three references strains were used: S288C, SA-1 and hybrid 272. The haploid segregant 272-1a (derived from the hybrid 272) and SA-1 were the most tolerant strains identified and were selected for further studies.
4.4.6 Competent cells
Competent cells of S. cerevisiae were prepared using a lithium acetate (LiAc) protocol (GIETZ; WOODS, 2002). Stock cultures of diploid SA-1 and haploid 272-1a (segregant derived from the 272 hybrid) were first streaked on YPD-A and grown at 30oC for 48 hours. After growth of individual colonies, a single colony was propagated overnight in 10 mL of YPD broth at 30°C with shaking at 150 rpm. In a 250 mL erlenmeyer flask, the cell suspension was diluted to OD600nm of 0.3 using 100 mL of fresh YPD and grown (as above) until OD600nm reached 1 to 1.2. The yeast cells were then pelleted in 50 mL falcon tube (Corning®) at 4,000 rpm for 2 minutes in an Eppendorf® 5810R centrifuge. The supernatant was discarded; the cells were then re-suspended in 500 µL lithium acetate 0.1 M in TE buffer (10 mM Tris-HCl pH 8 Invitrogen, 1 mM EDTA) (LATE). The cell suspension was transferred to 1.5 mL Eppendorf® tubes, centrifuged at 6,000 rpm for 2 minutes in Eppendorf® 5424 centrifuge and the supernatant discarded. The washed cell pellet was resuspended in 300 µL of LATE and 300 µL of glycerol 40%. The tubes were mixed and aliquoted (90 µL per tube) in 1.5 mL Eppendorf® tubes and stored at -80oC until they were used for transformations (GIETZ; WOODS, 2002).
4.4.7 Transformation for pentose fermentation
4.4.7.1 X123 cassette insertion using Cas9
double-stranded DNA break at the targeted locus (URA3 in this case), which greatly increases the frequency of homologous recombination.
Yeast transformation was adapted from Gietz and Woods (2002). The transformation mixture was prepared in 1.5 mL tubes with 90 µL competent cells (see above), 10 µL salmon sperm DNA Life Technologies® (ssDNA) previously heated to 100°C for 5 minutes and kept on ice for 5 minutes, 1 µg pCas9, 5 µg donor DNA, 260 µL 50% polyethylene glycol (PEG 3500 w/v, Sigma-Aldrich), 36 µL 1 M LiAc. Tubes were incubated at 30oC and agitated on a tube shaker rotator for 30 minutes, then subjected to a heat shock (42oC for 20 minutes). The tubes were centrifuged at 5,000 rpm for 2 minutes in an Eppendorf® 5424 centrifuge, the supernatant discarded and the pellets resuspended in 1 mL of YPD broth. The tubes were incubated at 30oC on a tube shaker rotator for 2 hours. The tubes were centrifuged at 5,000 rpm for 1 minute, 700 µL of YDP removed and the pellet resuspended in the remaining volume and 300 µL was plated on YPD-A supplemented with 200 µg/mL of Geneticin® Life Technologies (G418). The plates were incubated at 30oC until isolated colonies were observed (2-4 days). After growth of isolated colonies, they were restreaked twice on YPD to lose the pCas9 plasmid. Loss of the pCas9 plasmid was confirmed by loss of G418 resistance.
The 8 kb donor DNA was generated by PCR using a plasmid template (pX123, gift of the Yong-Su Jin lab, University of Illinois – Urbana-Champaign) using the primers
URA_X123_foward (5’-
GACTATTTGCAAAGGGAAGGGATGCTAAGGTAGAGGGTGAACGTTACAGAGAGA
TAGGGTTGAGTGTTGT-3’) and URA_X123_reverse (5’ –
CATTTACTTATAATACAGTTTTTTAGTTTTGCTGGCCGCATCTTCTCAAAAGTTAG
CTCACTCATTAGGC-3’). The reaction mixture for one PCR reaction was prepared as
follows: 13 µL sterile deionized water, 21 µL of 3M Betaine (Sigma-Aldrich), 1 µL DMSO (Sigma-Aldrich), 10 µL 5x buffer (HF), 1 µL dNTPs (10 mM each dNTP), 1 µL DNA (1-5 ng/µL), 2.5 µL of 10 µM primer mixture (forward and reverse), 0.5 µL Phusion Hot Start Flex DNA Polymerase® (New England BioLabs). PCR was performed using an Applied Biosystems Veriti™ thermal cycler with the following cycling program: initial denaturation at 98°C for 5 minutes; 35 cycles at 98°C for 30 seconds, 55oC for 30 seconds, 72°C for 4 minutes; and final extension at 72°C for 10 minutes. The PCR product was purified using the DNA Clean & Concentrator™-5kit (ZymoResearch®).
4.4.7.2 X123 cassette insertion confirmation
Integration of the X123 cassette into the URA3 locus was confirmed by streaking strains SA-1, SA-1-X123, 272-1a and 272-1a-X123 on 5-FOA plates (1 g/L of 5-FOA, 5 g/L of ammonium sulfate, 20 g/L of glucose, 20 mg/L of uracil, 1.7 g/L of yeast nitrogen base without amino acids, Difco BD). While URA3+ strains can metabolize 5-fluoroorotic acid (5-FOA) into a toxic compound, URA- strains cannot metabolize 5-FOA and will grow normally. All of the strains that were co-transformed with the pCas9 plasmid and X123 donor DNA were 5-FOAR.
In addition, correct integration was confirmed by PCR analysis and Sanger sequencing. The gDNA of strains SA-1-X123 and 272-1a-X123 was isolated, and the URA3 regions surrounding the integration site were amplified using the following primers: X123_Up_conf_fw (5’-CCTAGTCCTGTTGCTGCCAA-3’), X123_Up_conf_rev
(5‘-CAGGCTGTTGTTGTCACACG-3’), X123_Dn_conf_fw
(5’-CTTTCCAACAGCCGAAACCG-3’) and X123_Dn_conf_rev
(5’-GTTCCGTTTGACTTGTCGCC-3’). Purified PCR products were sequenced at Quintara Biosciences (Berkeley, CA).
4.4.7.3 Phenotype evaluation in synthetic medium
