Evidence of Pathogenic Subgroups among Atypical Enteropathogenic Escherichia coli Strains

JOURNAL OFCLINICALMICROBIOLOGY, Nov. 2009, p. 3756–3759 Vol. 47, No. 11

0095-1137/09/$12.00 doi:10.1128/JCM.01599-09

Copyright © 2009, American Society for Microbiology. All Rights Reserved.

Evidence of Pathogenic Subgroups among Atypical Enteropathogenic

Escherichia coli

Strains

䌤

Isabel C. A. Scaletsky,

* Katia R. S. Aranda,

Tamara B. Souza,

Neusa P. Silva,

and Mauro B. Morais

Departamento de Microbiologia, Imunologia e Parasitologia,1_{Departamento de Pediatria,}2_{and Disciplina de}

Reumatologia,3_{Universidade Federal de Sa˜o Paulo, Sa˜o Paulo, Brazil}

Received 18 August 2009/Accepted 3 September 2009

We describe the characterization of 126 atypical enteropathogenicEscherichia coli(aEPEC) isolates from 1,749 Brazilian children. Classic aEPEC strains were more frequently found in children with diarrhea than in controls (P< 0.001), showing their importance as acute diarrhea agents in our country. Only aEPEC strains carrying either theehxAorpaagene were significantly associated with diarrhea.

EnteropathogenicEscherichia coli(EPEC), one of the sixE. coli diarrheagenic pathotypes, produces an adherence factor chromosomally encoded by theeae(EPEC attaching and ef-facing) gene located within the locus for enterocyte effacement (LEE) pathogenicity island (15, 16, 18).

“Typical” EPEC strains contain, in addition to eae, the EPEC adherence factor (EAF) plasmid (4), which encodes the bundle-forming pili that mediate localized adherence to epi-thelial cells (9, 26). EPEC strains lacking the EAF plasmid have been designated “atypical” EPEC (aEPEC) (12). Whereas typical EPEC strains express only the virulence fac-tors encoded by the LEE region and the EAF plasmid, aEPEC strains have additional virulence properties (11, 32).

Recently Afset et al. (2) described several virulence genes associated with diarrhea in aEPEC isolates from Norwegian children. In their study, genes belonging to the pathogenicity island OI-122 (efa1/lifA, nleB, nleE, and sen), present in the enterohemorrhagicE. coli(EHEC) reference strain EDL933 (17), and the gene for long polar fimbriae (lpfA) (10), found in EHEC O113 strains, were particularly frequent. Other genes, such as the porcine A/E-associated gene (paa) (5) and the EHEC hemolysin gene (ehxA) (27), were also found to be associated with diarrheal disease.

OtherE. coliadhesion factors recently described include the protein ToxB, required for full adherence expression in EHEC O157:H7 (30); Iha, an adherence-conferring protein similar to Vibrio choleraeIrgA (29); Saa, an autoagglutinating adhesin identified in LEE-negative strains (22); and Spf, a sorbitol-fermenting EHEC O157 fimbria (8). In addition, we recently identified a diffuse adherence (lda) locus in an aEPEC strain of the O26 serogroup that codes for adherence to HEp-2 cells (25).

In this report, we describe the prevalence and virulence profile of aEPEC strains isolated from diarrhea patients and control subjects in several cities of Brazil from 1999 through 2004.

Stool specimens from 1,102 children under 2 years of age with diarrhea, presenting to the emergency room of public hospitals in seven cities representing different regions of Brazil, and 647 randomly selected children without any gastrointesti-nal symptoms from the same hospitals were studied. All spec-imens were investigated for the presence of enteric pathogens, such as diarrheagenicE. coli,Shigellaspecies,Salmonella spe-cies,Yersinia enterocolitica,Campylobacterspecies, and rotavi-rus (24).

Atypical EPEC strains were isolated, identified, and sero-typed as described elsewhere (11). One isolate per subject was stored at⫺70°C.

aEPEC strains were screened by colony blot hybridization with 16 different DNA probes representing a panel of toxin, adhesin, and OI-122 genes. Fourteen DNA probes were pre-pared by PCR amplification from prototype strains. The genes, primers, amplicon size, PCR conditions, and prototype strains are given in Table 1. Two DNA probes were prepared by plasmid extraction using the method of Birnboim and Doly (7) and digestion with appropriate restriction endonucleases. The cdt probe was a 1,357-bp fragment from plasmid pCVD448 (28), and the cnfprobe was a 335-bp fragment of pEOSW1 (20). The probes were then purified by gel extraction (23) and labeled with [␣-32P]dCTP, and colony hybridization assays were performed as described elsewhere (24).

A total of 126 aEPEC strains were isolated as the only pathogen in stool specimens from 92/1,102 (8.3%) children with diarrhea and 34/647 (5.2%) controls (P ⬍0.05). Forty-nine (38.9%) strains belonged to classical EPEC serotypes (O26, O55, O111, O119, O127, or O142), 35 (27.8%) were classified as non-EPEC serotypes, and 42 (33.3%) were un-typeable (ONT) (Table 2). EPEC serotype strains were iso-lated significantly more often from patients than from controls (41 [3.7%] versus 8 [1.1%];P⬍0.001), while strains of non-EPEC serotypes and ONT occurred at similar frequencies in cases and controls (51 [4.6%] versus 26 [4.0%], respectively; P⫽0.656).

Among the 126 aEPEC strains, positive hybridization was detected with 13 of the 16 virulence genes tested (Table 3). Most of the strains belonging to the O26, O55, O108, O119, O127, O142, and O153 serogroups carried the OI-122 genes * Corresponding author. Mailing address: Departamento de

Microbio-logia, Imunologia e ParasitoMicrobio-logia, Universidade Federal de Sa˜o Paulo, Rua Botucatu, 862, 3 andar, 04023-062 Sa˜o Paulo SP, Brazil. Phone: 55-11-55764537. Fax: 55-11-55724711. E-mail: [email protected].

䌤_{Published ahead of print on 16 September 2009.}

and various combinations of adhesins, and some also carried the astA gene. The ehxA gene was found in O15 and O26 strains, and thecdtgene was found in two ONT strains. Curi-ously,ihaoccurred in 21% of the isolated aEPEC strains,lda

andafawere found in very few strains, andspfandsaawere not found at all. As far as we know, this is the first report ofiha detection in aEPEC strains.

Table 4 presents the frequencies of the 16 virulence genes in strains from patients and controls. Only the ehxA and paa genes were found to be significantly associated with diarrhea (P⫽0.027 and 0.022, respectively).

In the last 10 years, aEPEC has emerged as an important pathogen (2, 11, 32); however, the virulence markers associ-ated with aEPEC diarrhea have yet to be clarified.

In a previous study encompassing 65 aEPEC isolates, the virulence marker astA was significantly associated with diar-rhea (11). However, in this study, with a larger number of isolates, the former observation was not confirmed.

Several aEPEC strains presented the OI-122 virulence gene nleB, nleE, efa1/lifA, or sen. Both the nleB and nleE genes, coding for effector proteins, were found in 26 aEPEC strains belonging to the serogroups O26, O55, O119, O127, and O142. Among these, 22 also carried theefa1/lifAlymphostatin gene and 19 had the putative enterotoxin genesen. The presence of the OI-122 virulence genes in classical aEPEC strains was previously reported by Morabito et al. (17), and in a more recent study, they were also detected in untypeable or nonclas-sic EPEC serotypes associated with diarrhea (1).

In our study, the plasmid-encoded enterohemolysin (en-coded byehxA) of EHEC O157:H7 was significantly associated with diarrhea, in agreement with the data of Afset et al. for Norwegian children (2).

The identification of genes usually linked to the EHEC pathotype in a considerable proportion of our classic aEPEC strains is consistent with previous evidence from epidemiolog-ical and experimental studies showing that aEPEC may convert to, or be a conversion from, the EHEC pathotype by either TABLE 1. PCR primers and conditions used in this study and sizes of PCR amplicons

Target Forward primer sequence Reverse primer sequence PCR conditions Amplicon size (bp)

Control

strain Reference

ehxA GGTGCAGCAGAAAAAGTTGTAG TCTCGCCTGATAGTGTTTGGTA 95°C, 1 min; 55°C, 1 min; 72°C, 4 min

1,551 EDL933 31

astA CCATCAACACAGTATATCCGA GGTCGCGAGTGACGGCTTTGT 94°C, 1 min; 55°C, 1 min; 72°C, 1 min

111 17-2 34

sen GGATGGAACCATACCTGG CGCAATCAATTGCTAATGC 94°C, 30 s, 56°C, 1 min; 72°C, 2.5 min

551 EDL933 13

nleB ATGTTATCTTCATTAAATGTCCT TCAATCCC

TTACCATGAACTGCAGGTATA ATACTGG

95°C, 45 s, 60°C, 1 min; 72°C, 1 min

990 EDL933 17

nleE ATGATTAATCCTGTTACTAATAC TCGAG

CTACTCAATTTTAGAAAGTTTA TTATTTAT

95°C, 45 s, 52°C, 1 min; 72°C, 1 min

675 EDL933 17

efa1 AAGGTGTTACAGAGATTA TGAGGCGGCAGGATAGTT 94°C, 30 s, 55°C, 30 s, 72°C, 30 s

268 EDL933 19

lpfDO113 GAACTGTAGATGGGTAC AGCAGGCATAACGCAAG 94°C, 1 min; 48°C,

50 s, 72°C, 1 min

798 EH41 10

paa GGATCCATGAGGAACATAA CTCGAGAGTGCCTTTCCTGG 94°C, 30 s, 60°C, 45 s, 72°C, 30 s

605 EDL933 5

toxB ATACCTACCTGCTCTGGATTGA TTCTTACCTGATCTGATGCAGC 94°C, 1 min; 52°C, 1 min; 72°C, 1.5 min

602 EDL933 31

iha CAGTTCAGTTTCGCATTCACC GTATGGCTCTGATGCGATG 94°C, 30 s, 56°C, 1 min; 72°C, 1.5 min

1,305 EDL933 31

saa CGTGATGAACAGGCTATTGC ATGGACATGCCTGTGGCAAC 94°C, 30 s, 60°C, 30 s, 72°C, 30 s

119 EDL933 21

spfA TTAGCAACAGCAGTGAAGTCTC AGCCAAGGCAAGGGATTATTA 94°C, 30 s, 59°C, 1 min; 72°C, 1 min

440 EDL933 8

ldaH ATGGACAGAGTGGAGACAG GCCACCTTTATTCTCACCA 94°C, 30 s, 52°C, 1 min; 72°C, 1 min

560 22 25

afaC CGGCTTTTCTGCTGAACTGGC AGGC

CCGTCAGCCCCCACGGCA GACC

94°C, 1 min; 65°C, 1 min; 72°C, 2 min

672 C1845 14

TABLE 2. Serotypes of aEPEC strains isolated from patients with diarrhea or from controls

Serotype No. (%) of strains isolated

b

From patients From controls Total

EPEC serotypes

O26:H11; HND 9 1 10

O55:HND 4 1 5

O111:NM 2 2 4

O114:NM 0 1 1

O119:H2; HND 9 1 10

O125:HND 0 1 1

O126:NM 1 0 1

O127:NM; H40 4 1 5

O128:NM 2 0 2

O142:NM; H2 10 0 10

Total 41 (3.7)c _{8 (1.2)}c _{49 (2.8)}

Non-EPEC serotypesa _{23 (2.1) 12 (1.8) 35 (2.0)}

ONT:H18/NM/HND 28 (2.5) 14 (2.2) 42 (2.4)

Total 92 (8.3)d _{34 (5.2)}d _{126 (7.2)}

a_{Serotypes (no. of isolates) are as follows: O4:HND (2), O15:HND (2),}

O33:H6 (2), O35:H19 (2), O37:HND (1), O49:HND (1), O61:HND (1), O63: HND (1), O79:HND (1), O85:H40 (1), O96:HND (1), O98:HND (1), O101:NM (1), O103:NM (2), O105:H7 (1), O108:H31 (2), O109:H54 (1), O117:HND (1), O132:HND (1), O141:HND (1), O153:H2 (2), O156:H16 (1), O157:HND (3), O167:H6 (1); O169:H6 (1), and O175:HND (1).

b_{For patients,n}

⫽1,102; for controls,n⫽647; total⫽1,749 strains.

c_P

⬍0.001, two-tailed␹2test (comparison between patients and controls).

d_P

⬍0.05, two-tailed␹2test (comparison between patients and controls).

acquisition or loss ofstxgenes (3, 6, 33). Several studies have revealed the genetic relatedness of O26 EHEC to O26 aEPEC by comparison of their core genomes (6) and housekeeping genes (33) and the presence of OI-122 genes and the high-pathogenicity island (3). It seems possible that other classic aEPEC strains genetically related to EHEC may have subse-quently acquired additional virulence factors by horizontal transfer.

In agreement with data from Norwegian children,paawas much more frequent in aEPEC strains isolated from Brazilian children with diarrhea than in those from controls (P⬍0.05). On the other hand, the positive association betweenlpfAO113

and diarrhea recently found in Norwegian children (2) was not observed in our study.

Based on our results, we show that in Brazil aEPEC strains could be classified into two subgroups: those belonging to classic aEPEC serotypes, which were associated with diarrhea, and those that are either untypeable or belong to nonclassic serotypes. This view is supported by our observation that OI-122 genes were most frequently found among the classic sero-types.

TABLE 4. Distribution of virulence genes among atypical enteropathogenicEscherichia colistrains isolated from

patients with acute diarrhea or from controls

Gene No. (%) of atypical strains

a

From patients From controls Total

ehxA 15 (16.3)b _{0 15 (11.9)}

astA 34 (36.9) 8 (23.5) 42 (33.3)

cdt 2 0 2 (1.6)

cnf 0 0 0

sen 24 (26.1) 4 (11.8) 28 (22.2)

nleB 34 (36.9) 12 (35.3) 46 (36.5)

nleE 34 (36.9) 12 (35.3) 46 (36.5)

efa1/lifA 28 (30.4) 10 (29.4) 38 (30.1)

toxB 15 (16.3) 2 (5.9) 17 (13.5)

lpfAO113 25 (27.2) 9 (26.5) 34 (27.0)

iha 20 (21.7) 7 (20.6) 27 (21.4)

paa 22 (23.9)b _{2 (5.9)}b _{24 (19.0)}

spf 0 0 0

saa 0 0 0

lda 5 (5.4) 1 (2.9) 6 (4.8)

afa 7 (7.6) 2 (5.9) 9 (7.1)

a_{For patients,n}

⫽92; for controls,n⫽34; total⫽126.

b_{Significant at aPvalue of⬍0.05, Fisher’s exact test.}

TABLE 3. Putative virulence genes of aEPEC strains isolated from patients or controls

Serotype No. of_strains

No. of strains carrying gene

Toxin Adhesin OI-122

ehxA astA cdt afa toxB lpfA iha paa lda efa1 sen nleB nleE

O4:HNT 2 2 2 2

O15:HND 2 2 2 2

O26:NM 10 7 4 2 7 4 4 4 3 4 6 4 4

O33:H6 2 2 2 2

O35:H19 2 2

O37:NM 1 1 1 1

O49:HND 1 1

O55:NM 5 3 2 2 5 4 5 5

O61:HND 1 1

O63:HNM 1 1

O79:HND 1

O85:H40 1 1 1

O96:NM 1 1

O98:HND 1 1 1 1

O101:NM 1

O103:NM 2 2 2 2

O105:H7 1 1 1 1 1

O108:H31 2 2 2 2 2 2 2

O109:H54 1 1

O111:NM 4 2 3 1 1

O114:NM 1

O117:HND 1

O119:H2/HND 10 8 2 2 10 3 10 10

O125:HND 1

O126:NM 1

O127:H40/NM 5 1 2 4 4 4

O128:HNT 2 2

O132:HND 1

O141:NM 1 1

O142:HNT 10 3 4 3 3 3

O153:HND 2 2 1 1 2 2 2 2

O156:H16 1 1

O157:NM 3 2 1

O167:h6 1 1

O169:H6 1

O175:HND 1

ONT:H18/HND 42 6 16 2 3 6 6 8 11 2 9 6 11 11

Recently, Afset et al. (2) suggested that aEPEC could be classified into two main virulence groups based only on the presence of OI-122 genes, regardless of serotype. In contrast to our results, in Norway most diarrhea-associated aEPEC strains carrying OI-122 genes either were untypeable or belonged to nonclassic serotypes (1).

In conclusion, we have shown that classic aEPEC strains are important agents of acute diarrhea among Brazilian children. Furthermore, we have identified two virulence markers, the ehxAandpaagenes, that could be useful in the detection of truly enteropathogenic aEPEC.

This work was supported by Fundac¸a˜o de Amparo a Pesquisa do Estado de Sa˜o Paulo (FAPESP) and Conselho Nacional de Desen-volvimento Científico e Tecnolo´gico (CNPq).

REFERENCES

1.Afset, J. E., E. Anderssen, G. Bruant, J. Harel, L. Wieler, and K. Bergh. 2008. Phylogenetic background and virulence profiles of atypical entero-pathogenicEscherichia colistrains from a case-control study using multilocus sequence typing and DNA microarray analysis. J. Clin. Microbiol.46:2280– 2290.

2.Afset, J. E., G. Bruant, R. Brousseau, J. Harel, E. Anderssen, L. Bevanger, and K. Bergh.2006. Identification of virulence genes linked with diarrhea due to atypical enteropathogenicEscherichia coliby DNA microarray anal-ysis and PCR. J. Clin. Microbiol.44:3703–3711.

3.Anjum, M. F., S. Lucchini, A. Thompson, J. C. Hunton, and M. J. Wood-ward.2003. Comparative genomic indexing reveals the phylogenomics of

Escherichia colipathogens. Infect. Immun.71:4674–4683.

4.Baldini, M. M., J. B. Kaper, M. M. Levine, D. C. Candy, and H. W. Moon. 1983. Plasmid-mediated adhesion in enteropathogenicEscherichia coli. J. Pe-diatr. Gastroenterol. Nutr.2:534–538.

5.Batisson, I., M. P. Guimond, F. Girard, H. An, C. Zhu, E. Oswald, J. M. Fairbrother, M. Jacques, and J. Harel.2003. Characterization of the novel factor Paa involved in the early steps of the adhesion mechanisms of attach-ing and effacattach-ingEscherichia coli. Infect. Immun.71:4516–4525.

6.Bielaszewska, M., W. Zhang, P. I. Tarr, A. Sonntag, and H. Karch.2005. Molecular profiling and phenotype analysis ofEscherichia coliO26:H11 and O26:NM: secular and geographic consistency of enterohemorrhagic and enteropathogenic isolates. J. Clin. Microbiol.43:4225–4228.

7.Birnboim, H. C., and J. Doly.1979. A rapid extraction procedure for screen-ing recombinant plasmid DNA. Nucleic Acids Res.7:1513–1523. 8.Brunder, W., A. S. Khan, J. Hacker, and H. Karch.2001. Novel type of

fimbriae encoded by the large plasmid of sorbitol-fermenting enterohemor-rhagicEscherichia coliO157:H⫺_{. Infect. Immun.69:4447–4457.}

9.Donnenberg, M. S., J. A. Giro´n, J. P. Nataro, and J. B. Kaper.1992. A plasmid-encoded type IV fimbrial gene of enteropathogenicEscherichia coli

associated with localized adherence. Mol. Microbiol.6:3427–3437. 10.Doughty, S., J. Sloan, V. Bennett-Wood, M. Robertson, R. M.

Robins-Browne, and E. L. Hartland.2002. Identification of a novel fimbrial gene cluster related to long polar fimbriae in locus of enterocyte effacement-negative strains of enterohemorrhagicEscherichia coli. Infect. Immun.70: 6761–6769.

11.Dulguer, M. V., S. H. Fabbricotti, S. Y. Bando, C. A. Moreira-Filho, U. Fagundes-Neto, and I. C. A. Scaletsky.2003. Atypical enteropathogenic

Escherichia colistrains: phenotypic and genetic profiling reveals a strong association between enteroaggregativeE. coliheat-stable enterotoxin and diarrhea. J. Infect. Dis.188:1685–1694.

12.Kaper, J. B.1996. Defining EPEC. Rev. Microbiol. Sa˜o Paulo27:130–133. 13.Karmali, M. A., M. Mascarenhas, S. Shen, K. Ziebell, S. Johnson, R.

Reid-Smith, J. Isaac-Renton, C. Clark, K. Rahn, and J. Kaper.2003. Association of genomic O island 122 ofEscherichia coliEDL 933 with verocytotoxin-producingEscherichia coliseropathotypes that are linked to epidemic and/or serious disease. J. Clin. Microbiol.41:4930–4940.

14.Le Bougue´nec, C., M. Archambaud, and A. Labigne.1992. Rapid and specific detection of thepap,afa, andsfaadhesion-encoding operons in uropatho-genicEscherichia colistrains by polymerase chain reaction. J. Clin. Micro-biol.30:1189–1193.

15.McDaniel, T. K., and J. B. Kaper.1997. A cloned pathogenicity island from enteropathogenicEscherichia coliconfers the attaching and effacing pheno-type onE. coliK12. Mol. Microbiol.23:399–407.

16.Moon, H. W., S. C. Whipp, R. A. Argenzio, M. M. Levine, and R. A. Gianella. 1983. Attaching and effacing activities of rabbit and human enteropathogenic

Escherichia coliin pig and rabbit intestines. Infect. Immun.41:1340–1351. 17.Morabito, S., R. Tozzoli, E. Oswald, and A. Caprioli.2003. A mosaic

genicity island made up of the locus of enterocyte effacement and a patho-genicity island ofEscherichia coliO157:H7 is frequently present in attaching and effacingE. coli. Infect. Immun.71:3343–3348.

18.Nataro, J. P., and J. B. Kaper.1998. DiarrheagenicEscherichia coli. Clin. Microbiol. Rev.11:142–201.

19.Nicholls, L., T. H. Grant, and R. M. Robins-Browne.2000. Identification of a novel genetic locus that is requires for in vitro adhesion of a clinical isolate of enterohaemorrhagicEscherichia colito epithelial cells. Mol. Microbiol. 35:275–288.

20.Oswald, E., P. Pohl, E. Jacquemin, P. Lintermans, K. van Muylen, A. D. OⴕBrien, and J. Mainil.1994. Specific DNA probes to detectEscherichia coli

strains producing cytotoxic necrotizing factor type 1 or 2. J. Med. Microbiol. 40:428–434.

21.Paton, A. W., and J. C. Paton.2002. Direct detection and characterization of Shiga toxigenicEscherichia coliby multiplex PCR forstx1,stx2,eae,ehxA, andsaa. J. Clin. Microbiol.40:271–274.

22.Paton, A. W., P. Srimanote, M. C. Woodrow, and J. C. Paton.2001. Char-acterization of Saa, a novel agglutinating adhesion produced by locus of enterocyte effacement-negative Shiga-toxigenicEscherichia colistrains that are virulent for humans. Infect. Immun.69:6999–7009.

23.Sambrook, J., E. F. Fritsch, and T. Maniatis.1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

24.Scaletsky, I. C. A., S. H. Fabbricotti, K. R. Aranda, M. B. Morais, and U. Fagundes-Neto.2002. Comparison of DNA hybridization and PCR assays for detection of putative pathogenic enteroadherentEscherichia coli. J. Clin. Microbiol.40:1254–1258.

25.Scaletsky, I. C. A., J. Michalski, A. G. Torres, M. V. Dulguer, and J. B. Kaper.2005. Identification and characterization of the locus for diffuse adherence, which encodes a novel afimbrial adhesion found in atypical en-teropathogenicEscherichia coli. Infect. Immun.73:4753–4765.

26.Scaletsky, I. C. A., M. L. M. Silva, and L. R. Trabulsi.1984. Distinctive patterns of adherence of enteropathogenicEscherichia colito HeLa cells. Infect. Immun.45:534–536.

27.Schmidt, H., L. Beutin, and H. Karch.1995. Molecular analysis of the plasmid-encoded hemolysin ofEscherichia coli O157:H7 strain EDL933. Infect. Immun.63:1055–1061.

28.Scott, D. A., and J. B. Kaper.1994. Cloning and sequencing of the genes encodingEscherichia colicytolethal distending toxin. Infect. Immun.62:244– 251.

29.Tarr, P. I., S. S. Bilge, J. C. Vary, Jr., S. Jelacic, R. L. Habeeb, T. R. Ward, M. R. Baylor, and T. E. Besser.2000. Iha: a novelEscherichia coliO157:H7 adherence-conferring molecule encoded on a recently acquired chromo-somal island of conserved structure. Infect. Immun.68:1400–1407. 30.Tatsuno, I., M. Horie, H. Abe, T. Miki, K. Makino, H. Shinagawa, H.

Taguchi, S. Kamiya, T. Hayashi, and C. Sasakawa.2001.toxBgene on pO157 of enterohemorrhagicEscherichia coliO157:H7 is required for full epithelial cell adherence phenotype. Infect. Immun.69:6660–6669. 31.Toma, C., E. E. Martinez, T. Song, E. Miliwebsky, I. Chinen, S. Iyoda, M.

Iwanaga, and M. Rivas.2004. Distribution of putative adhesins in different seropathotypes of Shiga toxin-producingEscherichia coli. J. Clin. Microbiol. 42:4937–4946.

32.Vieira, A. M., J. R. C. Andrade, L. R. Trabulsi, A. C. Rosa, A. M. Dias, S. R. Ramos, G. Frankel, and T. A. T. Gomes.2001. Phenotypic and genotypic characteristics ofEscherichia colistrains of non-enteropathogenicE. coli

(EPEC) serogroups that carryeaeand lack the EPEC adherence factor and Shiga toxin DNA probe sequences. J. Infect. Dis.183:762–772.

33.Wirth, T., D. Falush, R. Lan, F. Colles, P. Mensa, L. H. Wieler, H. Karch, P. R. Reeves, M. C. Maiden, H. Ochman, and M. Achtman.2006. Sex and virulence inEscherichia coli: an evolutionary perspective. Mol. Microbiol. 60:1136–1151.

34.Yamamoto, T., and P. Echeverria.1996. Detection of the enteroaggregative

Escherichia coliheat-stable enterotoxin 1 gene sequences in enterotoxigenic

E. colistrains pathogenic for humans. Infect. Immun.64:1441–1445.