• Nenhum resultado encontrado

Two Hydroxyproline Galactosyltransferases, GALT5 and GALT2, Function in Arabinogalactan-Protein Glycosylation, Growth and Development in Arabidopsis.

N/A
N/A
Protected

Academic year: 2016

Share "Two Hydroxyproline Galactosyltransferases, GALT5 and GALT2, Function in Arabinogalactan-Protein Glycosylation, Growth and Development in Arabidopsis."

Copied!
36
0
0

Texto

(1)

Two Hydroxyproline Galactosyltransferases,

GALT5 and GALT2, Function in

Arabinogalactan-Protein Glycosylation,

Growth and Development in Arabidopsis

Debarati Basu, Wuda Wang☯, Siyi Ma, Taylor DeBrosse, Emily Poirier, Kirk Emch,

Eric Soukup☯, Lu Tian, Allan M. Showalter

*

Molecular and Cellular Biology Program, Department of Environmental and Plant Biology, Ohio University, Athens, Ohio, United States of America

☯These authors contributed equally to this work.

*[email protected]

Abstract

Hydroxyproline-O-galactosyltransferase (GALT) initiates O-glycosylation of arabinogalactan-proteins (AGPs). We previously characterized GALT2 (At4g21060), and now report on func-tional characterization of GALT5 (At1g74800). GALT5 was identified using heterologous expression inPichiaand anin vitroGALT assay. Product characterization showed GALT5 specifically adds galactose to hydroxyproline in AGP protein backbones. Functions of GALT2 and GALT5 were elucidated by phenotypic analysis of single and double mutant plants. Allelicgalt5andgalt2mutants, and particularlygalt2 galt5double mutants, demon-strated lower GALT activities and reductions inβ-Yariv-precipitated AGPs compared to wild type. Mutant plants showed pleiotropic growth and development phenotypes (defects in root hair growth, root elongation, pollen tube growth, flowering time, leaf development, silique length, and inflorescence growth), which were most severe in the double mutants. Condition-al mutant phenotypes were Condition-also observed, including sCondition-alt-hypersensitive root growth and root tip swelling as well as reduced inhibition of pollen tube growth and root growth in response to

β-Yariv reagent. These mutants also phenocopy mutants for an AGP, SOS5, and two cell wall receptor-like kinases, FEI1 and FEI2, which exist in a genetic signaling pathway. In sum-mary, GALT5 and GALT2 function as redundant GALTs that control AGPO-glycosylation, which is essential for normal growth and development.

Introduction

The fundamental processes that underpin plant growth and development depend crucially on the action and assembly of gene products designed to form the cell wall [1]. Cell walls are com-posed of cellulose, hemicellulose, and pectin, along with protein and lignin [2]. Wall proteins have emerged as essential components because of their contribution to wall architecture and

OPEN ACCESS

Citation:Basu D, Wang W, Ma S, DeBrosse T, Poirier E, Emch K, et al. (2015) Two Hydroxyproline Galactosyltransferases, GALT5 and GALT2, Function in Arabinogalactan-Protein Glycosylation, Growth and Development in Arabidopsis. PLoS ONE 10(5): e0125624. doi:10.1371/journal.pone.0125624

Academic Editor:Diane Bassham, Iowa State University, UNITED STATES

Received:December 22, 2014

Accepted:March 24, 2015

Published:May 14, 2015

Copyright:© 2015 Basu et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Data Availability Statement:All relevant data are within the paper and its Supporting Information files.

Funding:This work was supported by a National Science Foundation Grant (grant no. 0918661)http:// www.nsf.gov/and an Ohio University Baker Grant FN1006071,http://www.ohio.edu/research/funding. cfm.

(2)

function [3]. Among the cell wall proteins, the hydroxyproline-rich glycoprotein (HRGP) su-perfamily constitutes the most abundant and diverse group of cell wall glycoproteins [4]. The HRGP superfamily is composed of a spectrum of molecules, ranging from lightly glycosylated proline-rich proteins to highly glycosylated arabinogalactan-proteins (AGPs) with the moder-ately glycosylated extensins in between these two extremes [5].

AGPs are ubiquitous in the plant kingdom and are expressed in virtually all cells, either at the cell surface as part of the plasma membrane, the cell wall, or as extracellular secretions [6– 9]. AGPs are distinguished by their abundance of hydroxyproline (Hyp), alanine, serine and threonine residues in the protein backbone, the occurrence of Ala-Hyp, Ser-Hyp, and/or Thr-Hyp dipeptide repeats, the presence of type II arabinogalactan (AG) polysaccharide side chains covalently attached to the Hyp residues, and their ability to interact with a reddish-brown chemical dye calledβ-Yariv reagent. The polysaccharide side chains attached to peptidyl Hyp are composed ofβ-1,3-galactan backbones decorated withβ-1,6-galactose side chains that are further decorated withα-arabinose as well as other sugars, such asβ-(methyl)glucuronic acid,

α-rhamnose, andα-fucose, which are present in lesser amounts [10], [11]. An alternate model of AGP polysaccharide structure supported by nmr data indicates the galactan backbone consists of repeating trigalactosyl blocks, containing twoβ-1,3-galactoses attached toβ -1,6-galactose, with these blocks being decorated with side chains containingβ-galactose andα -arabinose along with other sugars [12–13]. One or more glycosyltransferases are thought to be responsible for adding each sugar in the AG polysaccharide.

Considerable progress in recent years has led to the identification of several, but by no means all, of the enzymes and their corresponding genes responsible for AGP glycosylation [14], [15]. In particular, the following enzymes were identified and cloned: twoα -1,2-fucosyl-transferases (FUT4 and FUT6), one hydroxyproline-O-galactosyltransferase (GALT2), oneβ -1,3-galactosyltransferase (At1g77810), oneβ-1,6-galactosyltransferase with elongation activity (GALT31A), oneβ-1,6-galactosyltransferase with branch initiation and branch elongating activities (GALT29A), and threeβ-1,6-gluronosyltransferases (GlcAT14A, GlcAT14B, GlcAT14C) [16–22]. FUT4 and FUT6 are members of the CAZy GT-37 family; GALT2, At1g77810, and GALT31A are members of the GT-31 family; GALT29A is a member of the GT-29 family; and GlcAT14A, GlcAT14B, GlcAT14C are members of the GT-14 family. In ad-dition, Gille et al. [23] identified a putative AGPβ-arabinosyltransferase (RAY1) that is a mem-ber of the GT-77 family. This finding, however, is puzzling given that arabinose reportedly only exists asα-linked sugars in AGPs.

AGPs are proposed to play essential roles in a variety of plant growth and development pro-cesses, including cell expansion, cell division, reproductive development, somatic embryogene-sis, xylem differentiation, abiotic stress responses, and hormone signaling pathways [9], [10], [24–26]. Most of these functions were deduced from analyzing mutants of various AGP genes or by using antibodies orβ-Yariv reagent to bind to AGPs and disrupt their function. One complication frequently encountered with AGP gene mutants is that no abnormal phenotype is observed, presumably because of gene redundancy/compensation within the AGP gene fami-ly (e.g., there are 85 predicted AGP genes inArabibopsis) [14], [27]. Given that polysaccharides account for approximately 90% of an AGP and largely dictate the molecular surface of an AGP, it is likely that this carbohydrate moiety plays a critical role in AGP function. Thus, mutants in the genes encoding the enzymes for AGP glycosylation may provide a more informative ap-proach to elucidating AGP function.

(3)

a Hyp-GALT [17]. Here, another member of GT-31,GALT5(At1g74800) is shown to encode this same activity. In addition, extensive phenotypic characterization of allelicgalt2andgalt5

single mutants andgalt2 galt5double mutants at the biochemical and physiological levels are presented which corroborate the roles of these two enzymes in AG biosynthesis and elucidate the contributions of the AG polysaccharides to AGP function.

Materials and Methods

In silico

analysis of GALT5 and GALT2

Arabidopsis GALT2 and GALT5 predicted protein structure was depicted using Prosite Mydo-main Image creator (http://prosite.expasy.org/mydomains/). Transmembrane domain, GALECTIN and GALT domains were predicted using TMHMM server (http://www.cbs.dtu. dk/services/TMHMM/), and Pfam (http://www.sanger.ac.uk/Software/Pfam/) respectively.

Heterologous expression of

GALT5

in

Pichia pastoris

The coding region ofGALT5was obtained from the RIKEN Bioresource center. The open reading frame ofAtGALT5was amplified with primers with a 50restriction site for SacII

fol-lowed by a 6x His-tag and a 30restriction site for XbaI (forwardCGCCGCGGATGCATCATCAT CATCATCACATGAAAAAACCCAAATTGTCGand reverseGAGTGTTGTAACATGAGATGA

TCTAGA). The boldface letters denote the restriction sites, the italic type denotes the His6tag,

and the underlined region denotes the translational start site. Amplified products were se-quenced, cloned in the shuttle vector pPICZ B as described in Basu et al. (2013). Five individual

Pichiaclones expressing AtGALT5 were selected, and the presence of the gene was confirmed by PCR using genomic DNA isolated from transformants and gene-specific primers. Genomic DNA was isolated fromPichiacells as described previously [28]. After confirmation of the clones ofPichiaharboringGALT5, induction for expression of clones expressing GALT5 was performed as described in Basu et al. [17].

Preparation of

Pichia

microsomes expressing

GALT5

and immunoblot

analysis

Microsomal proteins were isolated from the clone five transformedPichiacells as described in Basu et al. [17]. For immunoblot analysis, 5μg of microsomal protein fromPichia

transfor-mants was denatured, subjected to 10% SDS-PAGE, and electroblotted onto PVDF Immobilon membranes (Millipore) using the Mini Protean3 system according to manufacturer's recom-mendations. Blots were probed with an anti-His primary antibody (Clontech) at a 1:10,000 di-lution and a secondary goat anti-mouse IgG antibody conjugated to horseradish peroxidase (HRP) (Clontech) at a 1:20,000 dilution. West Femto Maximum Sensitivity Substrate (Thermo Scientific) was used for HRP detection.Pichiacell lines transformed with the empty expression vector (pPCIZ B) were used as the negative control (NC). Protein quantification was done using the Bradford reagent (Sigma). Blots were stained with Coomassie Brilliant Blue R-250 (Sigma) following HRP detection to ensure equal loading.

Galactosyltranferase assay with microsomal preparations from

Pichia

expressing

GALT5

(4)

membranes from thePichialine (X-33) transformed with the empty expression vector (pPICZ B) as NC.

Purification of Hyp-GALT5 reaction products by reverse-phase HPLC

The GALT reaction products were purified by RP-HPLC as described by Liang et al. [29].

Analysis of the Hyp-[

14

C]galactoside profile by gel permeation

chromatography and high performance anion-exchange

chromatography (HPAEC)

Thirty standard GALT reactions were fractionated by RP-HPLC and combined to generate enough14C-radiolabeled product for base hydrolysis and separation on a Biogel P2 column [29]. The radioactive peak eluting at degree of polymerization 4 (DP4) on a Biogel P2 column was analyzed along with a chemically synthesized Hyp-Gal standard by HPAEC on a CarboPac PA-20 column using 5 mM NaOH as the elution buffer to provide additional confirmation of this DP4 peak as Hyp-Gal.Trans-4-(β-D-Galactopyranosyloxy)-L-proline (i.e. the Hyp-Gal standard) was chemically synthesized from commercially available galactopyranosyl bromide and hydroxyproline methyl ester as previously described [17].

Monosaccharide composition analysis of GALT reaction products by

high performance anion-exchange chromatography

Twenty-five standard GALT assays were pooled to generate sufficient14C-products for acid hy-drolysis and monosaccharide composition analysis as described by Liang et al. [29] and Basu et al. [17] with minor modifications. The product from total acid hydrolysis was dissolved in deionized water and analyzed on a CarboPac PA20 column (4 × 250 mm; Dionex) in a BioLC system using pulsed amperometric detection (ED50 electrochemical detector; Dionex). The column was equilibrated at a flow rate of 0.5 mL/min with 200 mM NaOH for 10 min, double distilled water for 10 min, and 1mM NaOH for 15 min. The sample was eluted with 1 mM NaOH at a flow rate of 0.5 mL/min.

Determination of substrate specificity of the GALT5 enzyme activity

A standard GALT assay was performed using 20μg of various peptide substrate acceptors,

(AO)7, (AO)14, and (containing 7, and 14 repeating dipeptide units, respectively), an extensin

peptide (ExtP) containing repetitive SO4units, and a (AP)7peptide containing seven AP units

as described by Liang et al. [29]. Rhamnogalactan I from potato and rhamnogalactan from soy-bean (100μg each) were used as potential pectin substrates. Permeabilized microsomal

mem-branes (250μg) from the NCPichialine andPichialine expressing His6-GALT5 served as the

enzyme source in the GALT reactions. For all of the peptide substrate acceptors, the standard GALT assay was performed, and the reaction products were fractionated by RP-HPLC before monitoring incorporation of radiolabeled14C in a liquid scintillation counter (Beckman Coul-ter LS 6500). For the pectin substrate acceptors, RG (soybean fiber; Megazyme) and RGI (pota-to; Megazyme), reactions were incubated at room temperature for 2 h, terminated by adding 1 ml of cold 70% ethanol, and precipitated overnight at−20°C. Reaction products were collected

by centrifugation at 10,000 ×gfor 10 min, and pellets were resuspended by vortexing followed by ten washes with 1 ml of cold 70% ethanol to remove excess UDP-[14C]Gal. The14 C-radiola-bel incorporation was estimated by resuspending the pellets in 300μl of water before counting

(5)

Biochemical characterization of

GALT5

enzyme activity

The standard GALT assay was modified for GALT5 characterization using (AO)7peptide as

the acceptor substrate. Assay products from each reaction were fractionated by RP-HPLC to measure incorporated14C-radiolabel into acceptor substrates. The optimum pH for GALT5 ac-tivity was determined using permeabilized microsomal membranes (250μg) from the C5

Pichialine expressing His6-GALT5 dissolved in test buffers at a final concentration of 100 mM.

Test buffers included MES-KOH buffer at pH 4, 5, 6, and 7; HEPES-KOH buffer at pH 6, 6.5, 7, 7.5, and 8; Tris-HCl buffer at pH 8, 9, and 10; and CAPS-KOH buffer at pH 9 and 10.

To examine the effect of divalent cations on GALT5 activity, microsomal membranes were extracted with homogenizing buffer lacking divalent ions. MnCl2, MgCl2, CaCl2, CuCl2, NiCl2,

or ZnSO4was added to the GALT assay (at a final concentration of 5 mM) when tested. Two

controls were added, one with no ions in the buffer used for resuspending the detergent per-mealized membrane fraction and the other with EDTA (5 mM) to chelate any residual divalent cations trapped in the membranes. An equal volume of deionized distilled water was added in-stead of divalent ions in the control reaction.

To analyze the enzyme specificity for nucleotide sugar donors, the standard activity assay was performed with (AO)7as the acceptor substrate and various14C-radiolabeled nucleotide

sugar donors (90,000 cpm). The nucleotide sugars tested included UDP-[14C]Glc (MP Biome-dicals), UDP-[14C]Xyl (PerkinElmer Life Sciences), and GDP-[14C]Fuc (PerkinElmer Life Sci-ences). Four separate GALT reactions with no substrate acceptors were performed as controls.

Transient expression and subcellular localization of GALT5 in

Nicotiana

tabacum

leaves

TheGALT5coding region was subcloned into pEarleyGate 101 plasmid to generate the GALT5:YFP construct by a gateway cloning strategy. The primers used in cloning are listed in

S2 Table.Agrobacterium-mediated transient expression was performed in the leaves of three to four week-old tobacco plants (Nicotiana tabacumcv. Petit Havana) grown at 22–24°C using a bacterial optical density (OD 600) of 0.05 for single infiltrations and 0.025 each for co-infiltra-tions [30]. The GALT5-YFP construct was co-expressed with either the ER marker GFP-HDEL or the Golgi marker ST-GFP [31] to ascribe subcellular localization. The ER and Golgi markers are cloned into pVKH18-EN6 plasmid vector. Transformed plants were incubated under nor-mal growth conditions and sampled daily for 2–5 days post-infiltration. Leaf epidermal sec-tions were imaged using an upright Zeiss LSM 510 META laser scanning microscope (Jena, Germany), using a 40 X oil immersion lens and an argon laser. For imaging the expression of YFP constructs, the excitation line was 514 nm, and emission data were collected at 535–590 nm, whereas for GFP constructs, the excitation line was 458 nm and the emission data were collected at 505–530 nm. Singly infiltrated controls were analyzed to optimize gain and pinhole settings for each channel and to exclude any bleed through fluorescence between channels. Post-acquisition image processing was done using the ZEN lite 2012 image analysis software (Blue Edition; Carl Zeiss).

Plant material and genetic analysis

The Columbia (Col-0) ecotype of Arabidopsis thaliana was used in this study. Two T-DNA in-sertional lines forAt1g74800-GALT5(galt5-1SALK_105404 andgalt5-2SALK_115741) and

(6)

fei2-1, andsos5-2(SALK_125874) were provided by Dr. Joseph Keiber. Arabidopsis plants used in this study were germinated after 4 days of stratification in the dark at 4°C, and grown on soil at 22°C with 60% relative humidity. Plants were grown under long-day conditions (16 h photoperiod and 8 h dark, 120μmol m-2s-1of fluorescent light).

Genomic DNA was isolated fromgalt5-1,galt5-2,galt2-1,galt2-2andgalt2 galt5mutant leaves and subsequent PCR analysis was carried out using Extract-N-Amp Plant Kits (Sigma-Aldrich). The primer sequences used in PCR analysis were obtained from the T-DNA Primer Design Tool provided by the Salk Institute Genomics Analysis Laboratory (http://signal.salk. edu/tdnaprimers.2.html) in conjunction with the gene specific left and right primers (S2 Table). PCR products were purified by gel extraction with QIAquick Gel Extraction Kit and se-quenced by the Ohio University Genomics Facility. To confirm homozygous plants at the tran-script level, RNA was extracted, reverse transcribed, and analyzed by PCR using RT primers. RNA was isolated using a Qiagen RNeasy plant mini kit followed by DNase I digestion using Qiagen RNase free DNase set to remove traces of DNA. Qiagen One-Step RT-PCR kit was used for first-strand synthesis and subsequent PCR steps (primers are listed inS2 Table).

For quantitative real-time PCR (qPCR), the cDNAs were amplified using Brilliant II SYBR Green QRT-PCR Master Mix with ROX (Agilent Technologies, La Jolla, CA, USA) in an MX3000P real-time PCR instrument (Agilent Technologies). PCR was optimized and reactions were performed in triplicate. The transcript level was standardized based on cDNA amplifica-tion ofUbiquitin 10(At4g05320) RNA as a reference.

Isolation of Golgi-enriched plant microsomal membranes

Plant microsomal membranes were extracted according to Liang et al. [29] with minor modifi-cations. Eight grams of leaf tissue from 14-d-old wild type,galt2-1,galt2-2,galt5-1,galt5-2and

galt2 galt5mutant plants were ground in liquid nitrogen followed by resuspension in 8 ml ex-traction buffer (0.1 M HEPES-KOH, pH 7, 0.4 M Sucrose, 1 mM dithiothreitol, 5 mM MgCl2,

5 mM MnCl2, 1 mM phenylmethylsulfonyl fluoride, and one tablet of Roche EDTA-free

com-plete protease inhibitor cocktail and 100μL RPI plant protease inhibitor VI). The homogenate

was filtered through two layers of miracloth, and the filtrate was centrifuged at 3,000 x g for 20 min. The resulting supernatant was layered over a 1.8 M Sucrose cushion buffer and centri-fuged at 100,000 x g for 60 min. The uppermost layer was discarded without disturbing the membrane containing interphase layer. A discontinuous sucrose gradient was implemented by sequentially layering 1.1 and 0.25 M sucrose solutions onto the interphase layer and centrifug-ing at 10,000 x g for 60 min. The microsomal membranes enriched at the 0.25/1.1 M sucrose interphase were collected and pelleted by another centrifugation at 100,000 x g for 30 min. The pellet was resuspended in 50μL extraction buffer and stored at−80°C until use. A 1% Triton-X

100 permealized membrane fraction was used to perform GALT reactions using [AO]7as the

peptide substrate acceptor and UDP-[14C]Gal as the sugar donor.

Extraction of AGPs and AGP profiling by HPLC

AGPs were extracted from 14-d-old WT,galt2-1,galt2-2,galt5-1,galt5-2, andgalt2 galt5 mu-tant plants as described in Schultz et al. [32]. Five grams of plant material was used for each of the lines. Quantification of AGPs was done following the method of Gao et al. [33], andβ-Gal Yariv reagent was prepared as described in Yariv et al. [34].

AGP profiling was conducted as described by Youl et al. [35] with modifications. AGPs were obtained from eight grams of 14-d-old WT and mutant plants, precipitated byβ-Gal Yariv reagent and dissolved in 1 mL of deionized water before applying 100μl onto a polymeric

(7)

(0.1% trifluoroacetic acid). Fifty microgram of [AO]7was used as a control to monitor the

re-tention time of a pure AGP peptide. Samples were eluted from the column following a linear gradient with solvent B (0.1% trifluoroacetic acid in 80% acetonitrile): 0 to 30% solvent B in 30 min, then 30 to 100% in 30 min at a flow rate of 0.5 mL/min. Chromatography was monitored by absorption at 215 and 280 nm.

In vitro

pollen germination assay

Flowers collected from WT,galt2-1,galt2-2,galt5-1,galt5-2plants 1 to 2 weeks after bolting were used for the examination of pollen tube phenotypes. Individual open flowers were germi-natedin vitroas described by Boavida and McCormick [36] on solid germination medium (0.01% H3BO3, 1 mM MgSO4, 5 mM KCl, 5 mM CaCl2, 10% sucrose, and 1.5% low-melting

agarose, pH 7.5 and 30μMβ-Gal Yariv reagent or 30μMα-Gal Yariv reagent) at 22°C and

100% humidity in the dark. Pollen tube germination rates were computed by dividing the total number of germinated tubes by the number of grains. Images and measurements of pollen tubes were done at either at 40X or 20X magnification in a Nikon microscope coupled with a SPOT RT color CCD camera and SPOT analysis software.

Germination assays

Seeds of wild type,galt2-1,galt2-2,galt5-1andgalt5-2were surface-sterilized by washing in a 95% ethanol solution for 5 min followed by a 5 min wash in a 30% bleach with 0.1% Tween 20 solution and then rinsed seven times with sterile water. The seeds were sown on 1X MS nutrient medium containing 1% sucrose and 0.6% agar. For stratification treatment, seeds were stratified at 4°C in the dark for 3 d. The germination rate was scored by counting the number of germinated seeds after 5 d. Experiments were done in triplicate with 50 seeds for each experiment and genotype. Only seed batches that had been harvested and stored at the same time and under the same con-ditions were used. For each experiment, samples from four genotypes (WT, two allelic single mu-tants and the double mutant) were placed side by side on the same plate. Various concentrations of NaCl, KCl, LiCl, CsCl, mannitol or 50μMα-Gal Yariv reagent or 50μMβ-Gal Yariv reagent

were added to the MS media. Germination (i.e., emergence of radicles) was measured under a compound microscope at intervals of 12 h for 5 d. Radicle length was measured by Motic Image version 3.2. Three replicate plates were used for each treatment to ensure reproducibility of data.

Root growth measurements

For monitoring root growth in response to Yariv reagent, wild type,galt2-1,galt2-2,galt5-1,

galt5-2andgalt2 galt5were grown on MS plates for 7 d before they were transferred to MS plates supplemented with 50μMα-Gal Yariv reagent or 50μMβ-Gal Yariv reagent. For

seed-ling growth in salt, 7-d-old seedseed-lings of wild-type,galt2-1,galt2-2,galt5-1,galt5-2andgalt2 galt5plants were transferred to MS medium containing 1% agar and 100 mM or 150 mM NaCl. Root length was determined on low-magnification (×10) digital images captured using a CCD camera and image analysis freeware (ImageJ;http://rsb.info.nih.gov/ij/). For analysis of salt hypersensitivity of the mutant plants, root growth was monitored using a root bending assay [37] and images were taken under Nikon SMZ1500 stereomicroscope coupled with a CCD Infinity 2 camera and analysis software.

Aberrant root hair morphology

(8)

http://rsb.info.nih.gov/ij/). To ensure comparable results, the area 3 to 5 mm behind the root tip was analyzed. Plants grown on agar plates were carefully removed in*100μL of

half-strength MS medium on microscope slides for analysis. Quantification data are the means of 50 to 75 values representing 15 root hairs each of 20 to 35 individual plants measured.

Seed staining and visualization

Seeds of all the indicated genotypes were prehydrated in water and stained either with 0.01% ruthenium red or calcofluor white (25μg/ml of fluorescent brightener). In both cases, staining

was performed as described by Willats et al. [38] and Harpaz-Saad et al. [39]. Imaging was done using a Zeiss LSM 510 confocal microscope.

AGP specific monoclonal antibodies

Four AGP specific monoclonal antibodies, JIM4, JIM8, JIM13 and MAC207, were obtained from CarboSource Services;http://www.ccrc.uga.edu/~carbosource/CSS_home.html) and used as primary antibodies for detection of AGP epitopes. Goat anti-rat secondary antibody conju-gated to fluorescein isothiocyanate (FITC) was used as secondary antibody. Root hairs, pollen tubes and seeds treated with secondary antibody only were used as negative controls. Images were examined with a Zeiss LSM 510 laser scanning confocal microscope equipped with an argon-ion laser, using single wavelength excitation at 488 nm and detection of FITC signals be-tween 505 and 530 nm. Confocal parameters for each antibody treatment were preserved across genotypes. Z-stack sections of the images were taken, and three-dimensional projections from these stacks were used for the final images using LSM Software ZEN 2011.

Immunofluorescence detection of AGPs epitopes in root hairs, pollen

tubes and seeds

Ten-day-old WT andgalt2galt5seedlings grown on MS plates were used for immuno-staining of AGP epitopes according to the method described by Sauer et al. [40]. Briefly, seedlings were harvested in 1X MS liquid media followed by fixation in stabilizing buffer (SB) prepared in 1X MS media containing 50 mM PIPES buffer, 5 mM MgSO4, 5 mM EGTA pH 7.0 with 4%

para-formaldehyde at 4°C overnight. After extensively washing seedlings with SB without 4% paraformaldehyde, they were incubated for 60 min at room temperature in 1X MS media con-taining 3% IGEPAL followed by incubation for 1h with 3% BSA with 0.02% sodium azide in 1X MS. Seedlings were incubated with the primary antibody (1:25 dilution) overnight at 4°C in the dark, followed by extensive rinsing and incubation with secondary antibody at a 1:50 dilu-tion in 1X MS media for 5 h at room temperature. Finally, seedlings were washed in 1X MS media and mounted in 25% glycerol in 1X MS media.

Immunolocalization of AGPs in WT andgalt2galt5pollen tubes were performed according to the method described by Dardelle et al. [41]. Briefly, pollen tubes were germinated in germi-nation media (GM) containing 5 mM CaCl22H2O, 0.01% (w/v) H3BO3, 5 mM KCl, 1 mM

MgSO47H2O, and 10% (w/v) Suc, pH 7.5 for 16 h at room temperature. Upon germination,

they were mixed (v/v) with a fixation medium containing 100 mM PIPES buffer, pH 6.9, 4 mM MgSO47H2O, 4mM EGTA, 10% (w/v) Suc, and 5% (w/v) formaldehyde and incubated for 90

min at room temperature. Pollen tubes were rinsed three times by centrifugation at 3,200 g for 6 min with 50 mM PIPES buffer, pH 6.9, 2 mM MgSO47H2O, and 2 mM EGTA and three

(9)

Whole-seed immunolabeling was conducted according to the method described by Harpaz-Saad et al.[39], using seeds shaken in water before immunolabeling.

Results

At1g74800 (GALT5) encodes a putative galactosyltransferase

GALT5 and GALT2 proteins are members of the diverse GT-31 family in the CAZy database [41]. In plants, GT-31 includes three clades; one with proteins having only a catalytic GALT domain, another with proteins containing both a galactosyltransferase (GALT) domain and a GALECTIN domain, and the third with proteins having a domain of unknown function [42]. In Arabidopsis, 14 proteins have only the GALT domain, 6 proteins contain both domains, and 13 proteins have a domain of unknown function [18]. Four of these Arabidopsis GT-31 family members have been characterized. At1g26810 (GALT1) was identified as aβ -(1,3)-GALT involved in biosynthesis of a Lewis a epitope on N-linked glycans [43]. At1g77810 was reported to be aβ-(1,3)-GALT that catalyzes transfer of galactose (Gal) to anO-methylated Gal-β-(1,3)-Gal disaccharide, which mimics a partial structure of AGP side chains [18]. At4g21060 (GALT2) was identified as a Hyp-GALT specific for AGPs [17]. Finally, At1g32390 (GALT31A) was shown to elongateβ–1,6-galactan side chains on AGPs [19]. Given that glyco-syltransferases containing a lectin domain are involved in catalyzing the first step ofO -glyco-sylation of animal glycoprotein mucins, it was hypothesized that plant GALTs containing analogous lectin domains may also function in initiatingO-glycosylation of AGPs. Thus, we fo-cused on functional characterization of such GALT genes containing a GALECTIN domain and here present our findings on GALT5. The GALT5 open reading frame is 2019 bp and cor-responds to a protein of 672 amino acids, with a calculated molecular mass of 77.3 kD. The pre-dicted protein structures and alignment of GALT2 and GALT5 are depicted inS1 FigBoth proteins are predicted to be type II membrane proteins with N-terminal transmembrane do-mains. Thus, we hypothesized that GALT5 protein functions as an AGP-specific Hyp-GALT.

Heterologous expression of GALT5 in

Pichia

cells

Microsomal proteins from five independent recombinantPichialines expressing His tagged GALT5 were examined by immunoblotting with antibodies directed against the 6x His tag. All five GALT5 recombinant lines had the expected 77 kD protein band that reacted with the 6x His antibody (S2A Fig). A non-specific, smaller protein band (50 kD) was also detected in these recombinant lines. TransformedPichiacells with the empty expression vector served as a negative control (NC) and lacked the recombinant 77 kD protein band, but contained the 50 kD protein band.

Heterologously expressed GALT5 demonstrates Hyp-GALT activity

Anin vitroGALT assay developed by Liang et al. [29] was used to test for activity of the recom-binant GALT5 expressed inPichiacells. GALT assay components included detergent-permea-blized microsomal membranes from the transformedPichiacell lines expressing GALT5 protein as the enzyme source, UDP-[14C]Gal as the sugar donor and one of two AGP peptide analogs (d[AO]51and [AO]7) as the substrate acceptor. The amount of GALT activity varied in

the five recombinant cloned cell lines (C1 to C5) ofPichiabased on the rate of [14C]Gal incor-poration using the [AO]7substrate acceptor, but all were significantly higher thanPichiacells

(10)

Characterization of the GALT5 assay products by reverse-phase HPLC

analysis

Pichiatransformants expressing GALT5 were further analyzed for Hyp-GALT activity using two substrate acceptors: [AO]7, a synthetic AGP peptide and d[AO]51, a transgenically

express-ed and chemically deglycosylatexpress-ed AGP analog. Incorporation of [14C]Gal from UDP-[14C]Gal onto the two substrate acceptors was observed by HPLC fractionation (Fig1Cand1F) and by comparison to the non-radioactive [AO]7and d[AO]51substrate acceptor peaks (Fig1Aand 1D). Two [14C]-radioactive peaks were detected, of which peak II has the same retention time as their respective substrate acceptors ([AO]7and d[AO]51) (Fig1Cand1F). The identity of

peak I is not known; it may represent free [14C]Gal released by an endogenous galactosidase [29] or be composed of oligosaccharides with [14C]Gal incorporated into endogenous sugar ac-ceptors as suggested previously [44]. Peak I was also present in previous studies with plant (Arabidopsis and tobacco BY2) microsomes [29]. Microsomal preparations from aPichiacell line transformed with the empty expression vector were used as negative controls (NC) (Fig1B

and1E). In summary, HPLC fractionation provided evidence for incorporation of the [14 C]ra-diolabel from UDP-[14C]Gal onto the [AO]7and d[AO]51acceptors, and the [AO]7:GALT5

re-action product was subjected to further biochemical characterization.

Product characterization by acid and base hydrolysis indicates GALT5

transfers Gal to Hyp residues

To confirm that the [14C]radiolabel remained associated with Gal, RP-HPLC fractions contain-ing the [14C]radiolabeled [AO]7:GALT5 reaction products were pooled and subjected to total

Fig 1. RP-HPLC fractionation of the [AO]7:GALT5 reaction products on a PRP-1 reverse-phase

column.Acceptor substrate alone (A and D), GALT reaction with microsomal membranes from the NCPichia

line transformed with the empty expression vector (B and E) and the GALT reaction with microsomal membranes from the transgenicPichiaC5 line (C and F) were fractionated by RP-HPLC using identical elution conditions. Radioactive Peak II coeluted with the [AO]7and d[AO]51acceptor substrates in the GALT5

reaction and was used for subsequent product analysis.

(11)

acid hydrolysis. The resulting acid hydrolyzed [14C]radiolabeled monosaccharide was fraction-ated by HPAEC and showed that the [14C]label co-eluted with Gal, thereby confirming incor-poration of [14C]Gal onto the [AO]7peptide (S3 Fig).

In another set of experiments, base hydrolysis was used to confirm that the [14C]Gal resi-dues were added to Hyp resiresi-dues and to examine the extent of galactosylation of the [AO]7

peptide acceptor. Base hydrolysis degrades peptide bonds, but keeps Hyp-glycosidic bonds in-tact [45]. The intact [14C]radiolabeled [AO]7peptide product eluted in the void volume (V0)

on the P2 column, whereas the base hydrolysate of this product eluted at DP4 (Fig 2A). Given that Hyp residues alone elute as a DP3 sugar on a P2 column, it was concluded that GALT5 cat-alyzes the addition of one Gal onto the [AO]7peptide, consistent with our previous work [17].

Further confirmation of this conclusion was provided by fractionation of the base hydrolysate on a CarboPac PA-20 column and observing that the [14C]radiolabel co-eluted with an authen-tic Hyp-Gal standard (Fig2Band2C).

GALT5 is specific for AGPs

Various substrates that might act as potential substrate acceptors for a GALT were tested to in-vestigate GALT5 enzyme specificity. Namely, [AO]7, [AO]14, and d[AO]51, consisting of

non-contiguous peptidyl Hyp residues, were used to examine AGP peptide sequences of various lengths. [AP]7, consisting of alternating Ala and Pro residues, was used to test the requirement

of peptidyl Hyp for galactosylation. ExtP, a chemically synthesized extensin peptide consisting of contiguous peptidyl Hyp residues, was used to test whether contiguous peptidyl Hyp resi-dues act as potential acceptors. Two pectic polysaccharides, RGI from potato and RG from soybean fiber, were also used as potential substrates acceptors. All the non—AGP substrate ac-ceptors, including [AP]7, failed to incorporate [14C]Gal, indicating the GALT5 activity was

spe-cific for AGP sequences containing non-contiguous peptidyl Hyp. It was also observed that the incorporation of the [14C]radiolabel decreased with increasing lengths of the [AO] acceptor substrates (Fig 3).

Biochemical characteristics of the GALT5 enzyme

To determine the preference of nucleotide sugar donors, the standard GALT assay was per-formed with other potential sugar nucleotides including UDP-[14C]Glc, UDP-[14C]Xyl, and GDP-[14C]Fuc in the presence and absence of the [AO]7peptide acceptor. Hyp-GALT activity

was only detected with UDP-[14C]Gal as the sugar donor (S4A Fig). The effects of pH and di-valent cations on the GALT assay catalyzed by GALT5 were also determined. The [AO]7:

GALT5 activity had a pH optimum of 6.5 with a HEPES-KOH buffer, which is consistent with the lumen of Golgi vesicles where the enzyme is predicted to be localized (S4B Fig). Mg2+ fol-lowed by Mn2+significantly enhanced GALT5 activity, whereas the presence of Ca2+, Cu2+, Zn2+, and Ni2+had inhibitory effects to different extents (S4C Fig).

GALT5 is localized to the Golgi

(12)

Fig 2. Bio-gel P2 fractionation of the RP-HPLC purified [AO]7:GALT5 reaction product and High-Performance Anion-Exchange Chromatography

(HPAEC) of the resulting base hydrolysis product.(A) Bio-gel P2 fractionation of the RP-HPLC purified [AO]7:GALT5 reaction product before and after

base hydroylysis. Permeablized microsomal membranes from thePichiaC5 line expressing 6x His-GALT5 served as the enzyme source in the [AO]7:GALT5

reaction. Elution profiles of the reaction product before and after base hydrolysis are shown. The column was calibrated with high-Mrdextran (V0), galactose

(Vt), xylo-oligosaccharides with degree of polymerization (DP) 2 to 5 and xyloglucan-oligosaccharides (DP6-9); their elution positions are indicated with

arrows at the top of the figure. The elution position of free Hyp amino acid (corresponding to DP3) is shown with an arrow in the panel. Base hydrolysis produces a radioactive peak eluting at DP4, which corresponds to Hyp-Gal. (B) HPAEC profile of a chemically synthesized Hyp-Gal standard detected as a PAD response. (C) The radioactive peak eluting at DP4 coelutes with the chemically synthesized Hyp-Gal standard following HPAEC. Both the Hyp-Gal standard and the radioactive peak eluting at DP4 were fractionated in 5 mM NaOH elution buffer on a CarboPac PA-20 column.

(13)

programs (TargetP,http://www.cbs.dtu.dk/services/TargetP/) and Golgi Predictorhttp://ccb. imb.uq.edu.au/golgi/) and the TMHMM server (http://www.cbs.dtu.dk/services/TMHMM/) [46] for the prediction of transmembrane domains (TMD). Based on these analyses and consis-tent with the live cell imaging data, GALT5 is targeted to the secretory pathway and has a single N-terminal TMD (S1 Fig).

Isolation of T-DNA insertion alleles for the

GALT2 and GALT5

genes

To elucidate thein vivofunctions ofGALT2andGALT5inArabidopsis, a reverse genetic ap-proach was adopted. Two independent mutant alleles were isolated for each of the genes,galt2

-1andgalt2-2forGALT2andgalt5-1andgalt5-2forGALT5. Homozygous lines were identified by PCR analysis and T-DNA insertion sites were confirmed by sequencing (Fig 5A). Testing for genetic redundancy was addressed by crossinggalt2andgalt5single mutants and using PCR to screen forgalt2 galt5double mutants in the resulting F2 generation. RT-PCR analysis showed that theGALT2transcript was absent in bothgalt2allelic mutants as well as in the dou-ble mutant and that theGALT5transcript was absent in bothgalt5allelic mutants as well as in the double mutant (Fig5Band5C). The qPCR analysis corroborated these findings and

Fig 3. Effect of various peptide and polysaccharide acceptor substrates on incorporation of [14C]radiolabeled galactose.Permeablized microsomal

membranes from the NCPichialine transformed with the empty expression vector and the C5Pichialine expressing 6x His-GALT5 served as the enzyme source in the GALT reactions. [AO]7, [AO]14, and d[AO]51contain 7, 14, and 51 [AO] units, respectively. A chemically synthesized extensin peptide (ExtP)

contains repetitive SO4units. [AP]7contains 7 [AP] units. Rhamnogalactan I (RGI) from potato and RG from soybean represent pectin polymer substrates.

Enzyme reactions using UDP-[14C]Gal as the sugar donor were done in triplicate and mean values±SE are presented.

(14)

confirmed the identification of allelic knock-outgalt2,galt5single mutants as well asgalt2 galt5double mutants (Fig5Dand5E).

GALT2 and GALT5

have overlapping but distinct expression patterns

To analyze the spatial and developmental expression ofGALT2andGALT5, RNA was isolated from different organs and tissues and analyzed by qPCR (Fig 6A). BothGALTgenes were ubiq-uitously expressed inArabidopsisin an overlapping, but distinct pattern.GALT2was highly ex-pressed in root and stem, whereasGALT5was highly expressed in stem, root and leaf. These findings are consistent with data from publicly available expression databases (S5 Fig). Tran-scriptomics analysis using GeneCAT (http://genecat.mpg.de) [47], Genevestigator (http:// www.genevestigator.com/gv/) [48] and the Arabidopsis eFP browser (http://bar.utoronto.ca/ efp/cgi-bin/efpWeb.cgi) [49] indicate both genes are widely expressed withGALT5having a higher overall expression compared toGALT2. It is also noteworthy that these databases indi-cate thatGALT5is highly expressed in mature pollen (S5AandS5CFig).

Compensatory mechanism of

GALT2

and

GALT5

To investigate whether transcriptional compensation occurs betweenGALT2andGALT5or with the other four members of the Arabidopsis GT-31 family encoding both GALT and GALECTIN domains, qPCR analysis was conducted using thegalt2,galt5andgalt2 galt5 mu-tants (Fig6Band6C). WhileGALT2andGALT5transcripts were absent in their respective mutant lines, significant increases in the abundance ofGALT4,GALT5, andGALT6transcripts in thegalt2mutants andGALT2,GALT3,GALT4, andGALT6transcripts in thegalt5mutants were observed. The compensation mechanism was also observed in thegalt2 galt5double mu-tants, with increases in the abundance ofGALT6,GALT4, andGALT3transcripts over that seen in the single mutants. These results indicate transcriptional compensation within this GT-31 clade with the notable exception ofGALT1, whose expression is unchanged in the mutant backgrounds. Interestingly,GALT2andGALT5demonstrated the most pronounced increases in transcriptional compensation.

Fig 4. Subcellular localization of GALT5 in tobacco leaf epidermal cells observed 5 days after infiltration.Transiently expressed GALT5-YFP co-localized with sialyltransferase (ST)-GFP fusion protein (a Golgi marker) as well as with HDEL-GFP fusion protein (an ER marker). These constructs were examined by laser-scanning confocal microscopy under fluorescent and white light, and the fluorescent images were merged to observe co-localization. Bar = 10μm.

(15)

Fig 5. Molecular characterization ofgaltsingle and double mutants.(A)GALT2andGALT5gene structure and T-DNA insertion sites ingalt2-1,galt2-2,

galt5-1 andgalt5-2mutants. The intron-exon structures ofGALT2andAGALT5are indicated (introns are drawn as lines and exons as rectangles, with white rectangles representing coding sequences and black rectangles representing UTRs). Sites of T-DNA insertions ingalt2andgalt5are marked (triangles) as are the locations of primer sequences (arrows) used for PCR screening. (B) RT-PCR analysis of transcripts from rosette leaves of 14-d-old wild type (Col-0), the allelic homozygousgalt2andgalt5mutant lines. Arrows indicate the position of primers used for RT-PCR analysis of transcript levels.UBQ10primers were used as internal controls. (C) RT-PCR analysis of transcripts from rosette leaves of 14-d-old wild type (Col-0), the homozygousgalt2andgalt5mutant lines used for producing the double mutant, and thegalt2 galt5double mutant. (D) and (E) Quantitative RT-PCR analysis to detectGALT2andGALT5

transcript abundance in thegaltmutants. Total RNA was isolated from rosette leaves of 14-d-old wild type,galt2-1,galt2-2,galt5-1,galt5-2, andgalt2 galt5

plants.UBQ10primers were used as controls. Data were normalized to the level of wild typeGALT2expression in panel D and wild typeGALT5expression in panel E, which was set to 1 arbitrary unit (a.u.) in each case. Means±SE of three biological replicates (n = 3) are shown.

(16)

Fig 6. Organ-specific expression ofGALT2and GALT5 and gene compensation ingalt2,galt5and

galt2 galt5mutants observed by quantitative RT-PCR analysis.(A) Organ-specific relative expression of

GALT2andGALT5genes. qPCR was performed with total RNA samples from roots, stem, inflorescence, silique, seedling, cell culture, cauline leaves, and juvenile rosette leaves. The averages of three biological replicates are shown. The y axis shows x-fold expression with respect to the lowest encountered value of

GALT2expression in seedling equal to one arbitrary unit (a.u.). (B) Functional compensation ofgalt2and

(17)

Biochemical phenotypes of the mutants: GALT activity,

β

-Yariv-precipitable AGPs and immunolabeling with AGP specific monoclonal

antibodies

To providein vivoevidence thatGALT5encodes an AGP GALT and examine potential func-tional redundancy with GALT2, the two allelicgalt5mutants were analyzed along with the

galt2mutants and thegalt2 galt5double mutant with respect to GALT activity and content of

β-Yariv-precipitable AGPs (Table 1). GALT activity was reduced by 22% and 28% in the two

galt5mutants compared to wild type plants. This was similar to the 21% and 14% reductions for thegalt2mutants. Double mutants, however, demonstrated a 34% reduction in activity. In addition, thegalt5mutants had 40% and 43% lessβ-Yariv precipitable AGPs compared to wild type, while thegalt2mutants had reductions of 32% and 35%. The double mutants, however, contained 56% lessβ-Yariv precipitable AGPs. The profiles of theseβ-Yariv precipitable AGPs were also examined by HPLC by extracting AGPs from equal amounts of plant material, and revealed that virtually all these AGPs, as opposed to a single or subset of these AGPs, were af-fected in the single and double mutants, with the double mutant being more severely afaf-fected (S6 Fig). It was observed that the AGP peaks in the mutants eluted later and had less protein than the wild type AGP peaks, corresponding to reduced glycosylation.

In addition, immunofluorescence staining of AGP epitopes was performed to confirm that reduced levels of glycosylated AGPs were present in thegalt2galt5mutants compared to wild type. Thegalt2galt5double mutant displayed reduced labeling intensity using four AGP specif-ic monoclonal antibodies, JIM4, JIM8, JIM13 and MAC207, in root hairs, pollen tubes and seeds compared to the stronger signals displayed by the corresponding wild type samples (S7 Fig). It should be noted that Arabidopsis pollen tubes do not react with JIM13, as previously re-ported by Dardelle et al. [41].

Functional compensation ofgalt5andgalt2 galt5as revealed by qPCR analysis. The expression values were normalized to the level ofGALT5expression in seedlings of wild type, which was set to 1 arbitrary unit (a.u.).

UBQ10was used as an internal control for all the qPCR experiments. The asterisks indicate significant differences in expression of transcripts of the sixGALTstested compared with wild type according to a Student's t test (*, P<0.05;**, P<0.01,***, P<0.001).

doi:10.1371/journal.pone.0125624.g006

Table 1. GALT activity and amount ofβ-Yariv precipitated AGPs in WT,galt2,galt5, andgalt2 galt5

mutants.

Genotype GALT activity (pmol/hr/mg) β-Gal Yariv precipitated AGP (μg/g)

WT 6.70±0.79 13.92±3.75

galt2-1 5.30±1.20a 9.91±2.80a

galt2-2 5.80±1.01a 9.78±3.50a

galt5-1 5.25±2.20a 7.90±6.10b

galt5-2 4.80±3.50b 8.10±3.20b

galt2 galt5 4.44±0.44b 5.83±0.59b

Detergent-solubilized microsomal fractions were used for performing a standard GALT assay using [AO]7

as the peptide substrate acceptor and UDP-[14C]Gal as the sugar donor, and AGPs were extracted,

precipitated byβ-Yariv reagent, and quantified from 14-d-old plants. The values are averages of at least two independent experiments from two biological replicates. Student’sttests were performed to determine statistical significance (aP<0.05,bP<0.01).

(18)

Pleiotropic growth and development phenotypes of the mutants

While thegalt2andgalt5single mutants were largely indistinguishable from wild type, the dou-ble mutants displayed several altered phenotypes related to growth and development under normal growth conditions (Table 2, Figs7–9,S8andS9Fig). Such alterations were reflected in the larger number of rosette leaves, increased flowering time, reduced silique length, and re-duced plant height (Table 2,S8Fig). Root hair length and density were reduced in some single mutants and in the double mutant (Fig 7). Specifically,galt2-1andgalt5-1showed a reduction in root hair length, as did the double mutant, while root hair density was reduced ingalt2-1,

galt2-2, andgalt5-1along with the double mutant. Root growth was also inhibited in some sin-gle mutants (galt5-1andgalt5-2) and in the double mutant (Fig 9). In addition, pollen tube growth was slightly inhibited in the double mutant (Fig 8) and frequently associated with dis-ruption of pollen tube tip growth (S9 Fig). Several conditional phenotypes were also examined and revealed marked differences in the mutants as described in the next section.

Mutants demonstrate reduced inhibition of pollen tube growth and root

growth in the presence of

β

-Yariv reagent

β-Yariv reagent is known to inhibit pollen tube growth by disrupting AGPs [50–52]. Here, pol-len fromgalt2andgalt5single mutants as well as the double mutant were germinated and grown inβ-Yariv reagent (Fig 8). Wild type pollen was used as a control and showed reduced pollen tube growth in the presence ofβ-Yariv reagent as expected. In contrast, pollen tube growth was less inhibited in the single mutants, and was even less inhibited in the double mu-tant. In other words, the mutants showed less sensitivity toβ-Yariv-induced pollen tube growth inhibition.α-Yariv reagent, which does not bind to AGPs but is similar in structure toβ-Yariv reagent, was used as another control treatment in these experiments and produced results iden-tical to the unsupplemented control treatment. It should be noted that this experiment also re-vealed other non-conditional mutant phenotypes in the control treatment, namely pollen tube growth was slightly inhibited in the double mutant (Fig 8) and frequently associated with dis-ruption of pollen tube tip growth (S8 Fig), as mentioned in the previous section.

β-Yariv reagent is equally well known to inhibit root growth by disrupting AGPs [53–55]. Here,galt2andgalt5single mutant seedlings as well as double mutant seedlings were grown in the presence ofβ-Yariv reagent (Fig 9). Wild type seedlings were used as a control and showed reduced root growth in the presence ofβ-Yariv reagent as expected. In contrast, the single mu-tants showed aβ-Yariv insensitive root growth phenotype, and the double mutant displayed even greaterβ-Yariv insensitivity with respect to root growth.α-Yariv reagent was used as

Table 2. Comparisons of various developmental phenotypes displayed by WT,galt2,galt5, andgalt2 galt5mutant plants.

Genotype Rosette leaves (#) Cauline leaves (#) Flowering time (days) Silique length (mm) Plant height (cm)

WT 9.6±0.36 3.6±0.09 22.4±0.49 13.3±0.25 40.20±0.82

galt2-1 10.8±0.41 3.4±0.36 23.4±0.45 12.7±0.15 40.42±0.63

galt2-2 11.1±0.59 3.8±0.36 23.4±0.32 12.9±0.55 40.35±0.51

galt5-1 10.7±0.59 3.4±0.34 22.8±1.44 12.4±0.30 40.25±0.46

galt5-2 11.0±0.15 3.9±0.60 23.3±0.25 12.9±0.30 40.16±0.32

galt2 galt5 18.9±0.83a 4.0±0.05 26.9±0.52a 10.5±0.18a 36.42±0.68a

All measurements are means±SE of 15 to 20 plants per genotype. Statistically significant differences were determined by performing Student’s t tests (P<0.05) using Graphpad Quickcalcs (http://www.graphpad.com/quickcalcs/). Plants were grown under long day conditions. Plant height and silique length were measured from 40-d-old plants.

(19)

another control treatment in these experiments and produced results identical to the unsupple-mented control treatment. This experiment also revealed another non-conditional mutant phe-notype in the control treatments at 21 d, namely root growth was inhibited in some single mutants (galt5-1andgalt5-2) and in the double mutant (Fig 9), as mentioned in the previous section.

Mutant seed germination and root growth are hypersensitive to NaCl

Seed germination and root growth are known to be impaired in response to salt [37]. Here, the double mutants showed a significant reduction in seed germination compared to wild type, while the single mutants showed some reduction in seed germination, which was not statistically

Fig 7. Root hair length and density reduced in thegalt2 galt5double mutant.(A) Wild type,galt2-1,

galt5-1, andgalt2 galt5plants were grown on MS agar plates for 10 d with 1% sucrose or (B) with 4.5% sucrose. Bars = 1mm. (C) Quantification of root hair length and (D) density of thegaltmutants. The asterisks indicate significantly reduced root hair length and density compared with wild type controls according to a Student's t test (*, P<0.05;**, P<0.01; n>300).

(20)

Fig 8. Thegaltsingle and double mutants demonstrate reduced inhibition of pollen tube growth in response toβ-Gal Yariv reagent.(A) Representative images of pollen tubes from wild type,galt2,galt5, and

galt2 galt5mutants after 16 h in pollen germination medium, and (B) in pollen germination medium

supplemented with 30μMβ-Gal Yariv and (C) in pollen germination medium supplemented with 30μMα-Gal Yariv reagent. Bar = 30μm. (D) Pollen tube lengths (from wild type,galt2,galt5, andgalt2 galt5plants) were measured over time in the pollen germination medium (E) in pollen germination medium supplemented with 30μMα-Gal Yariv reagent and (F) in pollen germination medium supplemented with 30μMβ-Gal Yariv reagent. Twenty flowers from each genotype and 25 pollen tubes from each flower were measured using Image J. The experiment was done in triplicate and the values were subjected to statistical analysis by ANOVA, followed by the Tukey's honestly significant difference test. In response toβ-Gal Yariv reagent, WT pollen tubes were significantly shorter than pollen tubes from single mutants (P<0.05) andgalt2 galt5double mutants (P<0.01).

(21)

significant (S10 Fig). Radicle growth, however, was delayed in the single mutants and even more delayed in the double mutant in response to 100 and 150 mM NaCl (S11 Fig). Root growth was also inhibited in the single mutants, and even more inhibited in the double mutant over a 21 d time course, in response to 100 and 150 mM NaCl (Fig 10andS12 Fig). This hypersensitive root growth was observed in the presence of varying concentrations of NaCl, KCl, and LiCl, but not in the presence of CsCl and mannitol (S13 Fig).

Single and double mutants were also subjected to a root-bending assay, which is routinely used to screen salt-hypersensitive mutants or transgenic plants [37]. WT plants readily reori-ented root growth, whereas the single mutants showed delayed root bending with the double mutants showing a greater delay (Fig 11). Other known salt-hypersensitive mutants, including

sos5, which encodes a fasciclin-like AGP called FLA4, andfei1andfei2, which encode cell wall receptor like kinases which interact withsos5, were also tested in this root bending assay as they may be related togalt2andgalt5and showed various degrees of delayed root bending

Fig 9. Reduced inhibition of primary root growth ofgalt2,galt5andgalt2 galt5mutants in the

presence ofβ-Gal Yariv reagent.(A) Root lengths of WT,galt2,galt5, andgalt2 galt5plants were measured 7, 14 and 21 d after germination and seedling establishment for 5 d on MS plates, on MS plates

supplemented with 50μMα-Gal Yariv reagent, and on MS plates supplemented with 50μMβ-Gal Yariv reagent. Statistical differences were determined by one way ANOVA, followed by the Tukey's honestly significant difference test. Asterisks represent the statistical significance between genotypes (*, P<0.05;

**, P<0.01;***, P<0.001) within a treatment group. Vertical bars represent mean±SE of the experimental means from at least three independent experiments (n = 5), where experimental means were obtained from 10 to 15 seedlings per experiment. (B) Representative images of WT,galt2,galt5, andgalt2 galt5plants after 14 d of growth on MS plates supplemented with 50μMβ-Gal Yariv reagent. (C) Representative images of WT,galt2,galt5, andgalt2 galt5plants after 14 d of growth on MS plates supplemented with 50μMα-Gal Yariv reagent. Size bar = 1 cm.

(22)

Fig 10. Salt induced inhibition of primary root elongation ingalt2,galt5andgalt2 galt5mutants. Five-day-old wild-type,galt2,galt5andgalt2 galt5seedlings germinated on MS medium were transferred onto media containing (A) 100 mM NaCl or (B) 150 mM NaCl and grown vertically. Root elongation (i.e., increase in length after transfer) was measured after 7, 14 and 21 d of growth. Data are the means±SE of

measurements from five independent experiments (total n = 100). Statistical differences were determined by one way ANOVA, followed by the Tukey's honestly significant difference test (*, P<0.05 and**, P<0.01).

(23)

[24], [56] (Fig 11D). The angle of root curvature in the single mutants and to a larger extent in the double mutants were observed to be greater than that of the WT due to their delayed re-sponse towards salt stress (Fig 11E).

Root tip swelling in response to 100 mM NaCl was observed in thegaltsingle mutants; this swelling was even more pronounced in the double mutant (Fig 12). Other mutants, including

Fig 11. Root-Bending assay of wild type,galt,sos5, andfeimutant seedlings.Five-day-old seedlings grown on MS plates were transferred to MS plates with 100 mM NaCl and reoriented at an angle of 180° (upside down). The photographs were taken 3 d (A), 5 d (B) and 10 d (C and D) after seedling transfer. Bar = 10 mm. (E) Analysis of root curvature in WT,galt,fei1,fei2andsos5mutant plants. Statistical differences were determined by one way ANOVA and‘a’denotes a significant difference of root curvature (P<0.05) between WT and singlegaltmutants,‘b’denotes a significant difference of root curvature (P<0.01)

betweengaltsingle mutants andgalt2 galt5,fei1fei2,sos5andfei1fei2sos5mutants, and‘c’denotes a significant difference of root curvature (P<0.001) between WT andgalt2 galt5,fei1fei2,sos5andfei1fei2sos5

mutants. Vertical bars represent mean±SE of the experimental means from at least two independent experiments (n = 5), where experimental means were obtained from 15 seedlings per experiment.

(24)

sos5,fei1,fei2,fei1fei2, andfei1fei2sos5, were also examined and demonstrated root tip swelling in response to salt as reported previously [56].

Double mutant (galt2 galt5) displays less seed coat mucilage

Calcoflour white, which stains cellulose, and ruthenium red, which stains pectin, were used to staingaltsingle and double mutant seeds along withsos5andfei1fei2sos5mutant seeds to ex-amine seed coat mucilage (Fig 13). The double mutant displayed reduced cellulose ray staining and reduced pectin staining in the mucilage adhering to the seeds compared to the wild type andgalt2andgalt5single mutants. This double mutant seed phenotype was similar to that dis-played bysos5andfei1fei2sos5[26], [47 39].

Discussion

GALT5 is an AGP Hyp-GALT and other AGP glycosyltransferases

Biochemical and genetic evidence are presented here indicating that GALT5, similar to GALT2, functions as an AGP-Hyp-O-galactosyltransferase [17]. Detergent permealized micro-somal preparations fromPichiacells expressingGALT5exhibit Hyp-GALT activity, catalyzing transfer of [14C]Gal from UDP-[14C]Gal onto both a chemically synthesized peptide [AO]7

and endogenously produced HF-deglycosylated d[AO]51substrate acceptors (Fig 1). Product

characterization revealed that a single Gal residue is transferred to Hyp residues, as was the case for GALT2 (Fig 2). This observation is consistent with the hypothesis thatO-glycosylation in plants occurs by the stepwise addition of sugar residues, as opposed to en block transfer that is characteristic ofN-glycosylation.

Hyp-GALT activity observed here using heterologously expressedGALT5inPichiais con-siderably lower than observed using plant microsomes, but is consistent with our previous findings withGALT2[17], [29]. One possible explanation for this could be that multiple Hyp-GALT enzymes, multi-enzyme complexes, and/or plant-specific cofactors are involved in the biosynthesis of AGP glycans, which are absent inPichiacells.

Substrate specificity of GALT5 was investigated using various potential acceptor substrates and demonstrated that GALT5 is specific for AGP sequences (Fig 3). These findings are consis-tent with the Hyp contiguity hypothesis, which states that clustered, non-contiguous Hyp

Fig 12. Conditional root anisotropic growth defects ofgalt,sos5, andfeimutants.Light microscopic images of root tips of plant seedlings from indicated genotypes grown for 10d in MS plates with 100 mM NaCl. Seeds were germinated in MS plates and grown for 3d before transferring to the MS plates with 100 mM NaCl. Bar = 1mm.

(25)

residues are sites of arabinogalactan polysaccharide addition, whereas contiguous Hyp residues are sites for the addition of Ara oligosaccharides [57], [58]. Heterologously expressedGALT5

inPichiamicrosomes has similar biochemical properties to the GALT(s) present in Arabidop-sis microsomal membranes and GALT2 (S4 Fig) [17], [29]. GALT5 specifically requires UDP-Gal as the sugar donor, has a pH optimum of 6.5 (in contrast to 7 for plant microsomes), and has a requirement for Mg2+and Mn2+(in contrast to Mn2+for plant microsomes) for its opti-mal activity. These differences are likely a reflection of studying the properties of a single GALT enzyme inPichiamicrosomes in contrast to the more complex GALT enzyme mixture

Fig 13. Staining of seed coat mucilage for cellulose and pectin in wild type,galt,sos5, andfeimutant seeds.Seeds of the indicated genotypes were prehydrated with water and stained with Calcofluor white and ruthenium red to visualize cellulose and pectin with a Zeiss LSM 510 META laser scanning

confocal microscope.

(26)

in Arabidopsis microsomes that includes plant-specific factors and is consistent with the bio-chemical characteristics of GALT2 [17].

Genetic mutant analysis provides additionalin vivoevidence that GALT5 functions as an AGP-Hyp-GALT, which is functionally redundant to GALT2 (Table 1). Two allelicgalt5

knock-out mutants have reduced Hyp-GALT activity and contain considerably less glycosy-lated (i.e.,β-Yariv precipitiable) AGPs. Allelicgalt2knock-out mutants demonstrate similar biochemical phenotypes, whilegalt2 galt5double mutants possess even less enzyme activity and glycosylated AGPs compared to the single mutants. In addition, HPLC AGP profiling of thegalt2,galt5,and galt2 galt5mutants extends these finding and indicates that GALT2 and GALT5 activity is not limited to a particular AGP or a small subset of AGPs, but instead broad-ly act on coexpressed AGPs (S6 Fig). Furthermore, immunofluorescent labeling of AGPs in root hairs, pollen tubes and seeds was used to demonstrate that elimination of GALT2 and GALT5 led to the biosynthesis of AGPs with reduced glycosylation in different organs (S7 Fig). This finding is consistent with the reduced GALT activity and amounts ofβ-Yariv precipitiable AGPs in thegat2galt5mutants as well as the HPLC profiling of the AGPs obtained from the

galt2galt5mutants. In this context, it should be noted thatGALT2andGALT5have overlap-ping patterns of gene expression and demonstrate transcriptional compensation when either one or both genes are knocked out (Fig 6andS5 Fig).

Identification of GALT5 as an AGP Hyp-GALT adds to the growing list of the enzymes responsible for AGP glycosylation (Fig 14andS1 Table). Currently, there is biochemical

Fig 14. Sites of action of known glycosyltransferases acting on AGPs are depicted within a

representative AGP glycomodule sequence found within an AGP molecule.This glycomodule structure is based on information presented by Tryfona et al. [81]. Additional details on each of the known

glycosyltransferases are listed inS1 Table.

(27)

and/or genetic evidence for eleven AGP glycosyltransferases residing in multiple GT families, including two Hyp-O-GALTs in GT31 (GALT2 and GALT5), oneβ-1,3-GALT in GT31 (At1g77810), oneβ-1,6-GALT in GT31 (GALT31A), oneβ-1,6-GALT in GT29 (GALT29A), threeβ-1,6-GlcATs in GT14 (GlcAT14A, GlcAT14B, GlcAT14C), twoα-1,2-FUTs in GT37 (FUT4 and FUT6), and oneβ-AraT in GT77 (RAY1). Several AGP glycosyltransferases, how-ever, remain to be cloned and identified, includingα-AraTs,α-rhamonsyltransferases, and

α-xylosyltranferases, as well as additional enzymes related to those listed above. It will be par-ticularly interesting to know the number of enzymes responsible for synthesizing theβ-1,3 and

β-1,6 galactose chains and their detailed substrate specificities, particularly with respect to pro-cessivity. It is unknown whether these enzymes exist in a large biosynthetic complex, although a recent study reports that GALT31A and GALT29A interact with one another [20].

GALT5 is localized to Golgi vesicles

GALT5 was localized to Golgi vesicles, consistent with bioinformatics predictions using Signal P and Golgi predictor, biochemical pulse-chase experiments of HRGP biosynthesis [59], [60] a proteomics technique for localization of organelle proteins by isotope tagging [60], and locali-zation studies performed with other AGP GTs, including GALT2, AT1G77810, GALT31A, GALT29A, GlcAT14A, and FUT6 (Fig 4andS2 Table). Interestingly, GALT2 as well as Hyp-GALT activity was identified in the ER as well as the Golgi, indicating AGPs likely initiate Hyp galactosylation in the ER and continue to be Hyp galactosylated and further glycosylated in the Golgi [17], [29], [61 62]. A recent study has also localized GALT31A, GALT29A, and GlcAT14A to unique subcellular compartments, which are not part of the trans-Golgi network, cis-Golgi network or endosomes [63].

AGP glycosylation required for normal growth and development: GALT

and AGP glycosyltransferase mutant phenotypes

While singlegalt2orgalt5mutants are largely indistinguishable from wild type with respect to their non-biochemical phenotypes,galt2 galt5double mutants are clearly compromised with respect to normal growth and development (Table 2, Figs7–9,S8andS9Fig). Given that the single mutants have biochemical phenotypes corresponding to a reduction in AGP glycosyla-tion that is exacerbated in the double mutant, it is reasonable to conclude that critical threshold levels of glycosylated AGPs are required for normal growth and development. In other words, single mutants have sufficient levels of glycosylated AGPs to appear normal, while double mu-tants do not and display pleiotropic phenotypes affecting the growth and development of roots, leaves, inflorescences, flowers, pollen, and seeds. Specifically,galt2 galt5double mutants display shorter roots (Fig 9), shorter and less dense root hairs (Fig 7), more rosette leaves (Table 2), shorter inflorescences (Table 2), delayed flowering (Table 2), shorter pollen tubes (Fig 8), disruption of pollen tips (S9 Fig), and reduced seed coat mucilage (Fig 13). These obser-vations also lend further support to the notion that GALT5 and GALT2 are functionally redun-dant. More severe growth and development consequences, including lethality, are likely as additional Hyp-GALT genes are identified and cumulatively knocked-out.

(28)

possibility is that specific glycomodules within the AG polysaccharide are responsible for specific functions.

Roots and root hairs are particularly sensitive to the loss of glycosylated AGPs since some of the singlegaltmutants display more subtle versions of the phenotypes observed ingalt2 galt5

double mutants. Such root hair sensitivity was previously observed in mutants for proline hy-droxylation, extensins, and extensin arabinosylation, which display impaired growth [64], [65].

AGP glycosylation required for root and tip growth

Several conditional phenotypes also characterize thegaltsingle and double mutants; the most interesting of which involve alterations in root growth, pollen tubes, and root hairs in response toβ-Yariv or NaCl treatments. In roots,β-Yariv binds AGPs, specifically to theirβ-1,3-galactan chains [11], and inhibit root elongation (Fig 9) [53–55]. This inhibition is alleviated in the sin-gle and double mutants, which have reduced AGP glycosylation. This conditional phenotype indicates a role for AG polysaccharides in root elongation; this role is largely, but not complete-ly masked in the mutants under normal growth conditions due to gene redundancy. In particu-lar, normal root growth is inhibited in the double mutant, which corroborates a function for AGP glycosylation in root elongation. Pollen tube growth is affected in a similar manner. In pollen,β-Yariv binds to AGPs and inhibits pollen tube growth (Fig 8) [49–51]. This inhibition is alleviated in single and double mutants, which likely have reduced AGP glycosylation. This conditional phenotype indicates a role for AG polysaccharides in pollen tube growth; as in the roots, this role is largely, but not completely masked in the mutants under normal growth con-ditions due to gene redundancy. Notably, under normal growth concon-ditions, the double mutants show reduced pollen tube growth, as well as reduced root hair growth. These results are consis-tent with observations that knock-out mutants of pollen-specific AGP genes (AGP6,AGP11

andAGP40) lead to impaired pollen tube elongation [66] and that knock-out mutants of prolyl 4-hydroxylase genes (P4H2,P4H5,P4H13) display shorter root hairs [64]. Taken together, these studies indicate the important functional contribution of the carbohydrate moiety of AGPs to root and pollen tube growth and development, particularly with respect to polarized tip growth.

Salt treatment was also used to reveal conditional phenotypes in the single and double mu-tants. In roots, NaCl treatment results in reduced root growth [67–69], and the root bending assay can be used to screen for salt sensitivity [37]. Here, the single and particularly the double mutants are salt hypersensitive, demonstrating significantly reduced root growth and delayed root bending, further corroborating the functional contribution of the carbohydrate moiety of AGPs to root growth (Figs10and11). Moreover, root elongation in the single and doublegalt

mutants was hypersensitive to NaCl, LiCl, and KCl, but not to CsCl, as was previously observed for thesos5mutant (S13 Fig) [24]. Single and double mutants forFUT4andFUT6also demon-strate reduced root growth in response to salt treatment, illustrating more specifically the im-portance of fucose in the AG side chains in root growth [70], [71]. In addition, NaCl treatment can result in root tip swelling in salt hypersensitive mutants. The single and doublegalt mu-tants also display this phenotype. Interestingly, mumu-tants for SOS5, a fasciclin-like AGP, as well as two cell wall receptor like kinases (FEI1 and FEI2) which are in the same genetic pathway as SOS5, phenocopy thegalt2,galt5, andgalt2 galt5mutants with respect to NaCl—induced root tip swelling and salt hypersensitivity in the root bending assay.

GALTs and cellular signaling

Referências

Documentos relacionados

After the toxicity assessment, spotted wolf fish sperm was freeze using the three cryoprotectants at the highest concentration that did not show any toxic effects in the first trial

This paper aimed to determine how efficiently nations from Latin America and Asia measure a country’s performance in converting Economic Complexity into Human Development,

We propose the term rent-seeking to summarize society interaction with government agencies in which public policies are supposed to provide specific privileges

Growth of the root and primary leaf was significantly reduced and there was no development of secondary leafs on sporophytes cultivated in cadmium concentrations of 12.5 mg L –1

Fourteen wheat genotypes (mutant lines and cultivars) were evaluated for primary root growth during 7 and 15 days of development in complete and aerated nutrient solutions, in

These different meteorological conditions affected leaf emission speed and development, which are important in studies of development and plant growth (Rosa et al., 2009), and

The prosodic profile of EP varieties, on the basis of our main findings on the intonation of information-seeking yes-no questions and the rhythmic properties obtained with the