UNIVERSIDADE FEDERAL FLUMINENSE FACULDADE DE ODONTOLOGIA
HISTÓRICO DE PERIODONTITE CRÔNICA E AUMENTO DA RELAÇÃO RANKL/OPG ESTÃO ASSOCIADOS COM A DOENÇA PERI-IMPLANTAR
Niterói 2014
UNIVERSIDADE FEDERAL FLUMINENSE FACULDADE DE ODONTOLOGIA
HISTÓRICO DE PERIODONTITE CRÔNICA E AUMENTO DA RELAÇÃO RANKL/OPG ESTÃO ASSOCIADOS COM A DOENÇA PERI-IMPLANTAR
LUCAS CARNEIRO COSTA
Dissertação apresentada à Faculdade de Odontologia da Universidade Federal Fluminense, como parte dos requisitos para obtenção do título de Mestre, pelo Programa de Pós-Graduação em Odontologia.
Área de Concentração: Clínica Odontológica
Orientador: Profa Dra. Priscila Ladeira Casado.
Co-orientador: Prof. Dr. José Mauro Granjeiro
Niterói 2014
C837 Costa, Lucas Carneiro
Histórico de periodontite crônica e aumento da relação RANKL/OPG estão associados com doença peri-implantar / Lucas Carneiro Costa; orientadores: Priscila Ladeira Casado,
José Mauro Granjeiro. – Niterói : [s.n], 2014.
53 f.:il.
Possui gráficos e tabelas.
Dissertação (Mestrado em Clínica Odontológica) - Universidade Federal Fluminense, 2014.
Bibliografia: f. 32-36.
1. Osteoprotegerina. 2. Rank ligante. 3. Periodontite crônica. 4. Peri-implantite. I. Casado, Priscila Ladeira [orient.].
II. Granjeiro, José Mauro [co-orient.]. III. Título.
Profa. Dra. Mônica Diuana Calasans Maia
Instituição: Faculdade de Odontologia da Universidade Federal Fluminense
Decisão: _________________________Assinatura: ________________________
Profa. Dra. Priscila Ladeira Casado
Instituição: Faculdade de Odontologia da Universidade Federal Fluminense
Decisão: _________________________Assinatura: ________________________
Prof. Dr. Fernando Luiz Duarte de Almeida
Instituição: Especialização em Implantodontia da Universidade Veiga de Almeida Decisão: _________________________Assinatura: ________________________
Dedico este trabalho à Deus pois sem Ele não teria conseguido. Dedico aos meus pais Wilton da Silva Costa e Leila Carneiro Costa por todo apoio, compreensão, dedicação e amor sem limites. Esta conquista também é de vocês.
À Deus por me guiar, sustentar, abrir os caminhos, e por tornar realidade todos estes sonhos mais profundos do coração.
Aos meus pais, irmão e cunhada por todo amor e apoio incondicional, mesmo nos momentos em que os privei de atenção para me dedicar a este trabalho.
À minha tão amada noiva, eterna companheira, por estar sempre ao meu lado me motivando e me sustentando em oração.
À minha tão dedicada Professora e Orientadora Priscila Ladeira Casado, por todo empenho e motivação, por acreditar em mim e me fazer seguir adiante. Exemplo de
profissionalismo e de competência.
Ao meu Co-Orientador Professor Doutor José Mauro Granjeiro, por acreditar no nosso trabalho, por toda contribuição e incentivo. Pessoa admirável e exemplo a ser
seguido.
Ao Marcos Alexandre da Fonseca, pela amizade, conselhos e companheirismo por todo período deste trabalho.
Ao Doutor Diego Pinheiro Aguiar por toda amizade, contribuição e dedicação a este trabalho, que o enriqueceu de forma brilhante.
À Thays dos Santos Vieira, pela dedicação e empenho.
Ao Doutor Fernando Luiz Duarte de Almeida, por todo investimento na minha carreira profissional e apoio à este trabalho.
que levarei por toda vida. Exemplo de integridade e competência.
À Professora Doutora Mônica Diuana Calasans Maia por todo o apoio e suporte na coordenação deste Programa de Pós Graduação da Universidade Federal
Fluminense, sempre tão dedicada e solicita.
À toda equipe do Instituto Nacional de Traumatologia e Ortopedia que sempre me receberam com muita cordialidade.
Costa LC. HISTÓRICO DE PERIODONTITE CRÔNICA E AUMENTO DA RELAÇÃO RANKL/OPG ESTÃO ASSOCIADOS COM A DOENÇA PERI-IMPLANTAR
Tese/Dissertação Niterói: Universidade Federal Fluminense, Faculdade de Odontologia; 2014.
Histórico da periodontite crônica (PC) é um fator de risco para a falha na osseointegração. O sistema de osteoclastogênese, que inclui o receptor do fator ativador nuclear kappa B (RANK), ligante RANK (RANKL) e osteoprotegerina (OPG), é crítico para o controle da homeostase da atividade dos osteoclastos, o que sugere um papel vital do sistema no curso da perda óssea. Neste estudo, foram investigados os níveis de RANKL e OPG na cicatrização dos tecidos peri-implantares em participantes de pesquisa com e sem histórico de PC, e sua associação com a osseointegração sem intercorrências. O diagnóstico de histórico de PC e avaliação peri-implantar foram realizados através de exame em 49 participantes de pesquisa. Com base na condição periodontal, os participantes foram divididos em um grupo controle (sem histórico de PC, n = 26) e um grupo PC (com histórico de PC, n = 23). Biópsias gengivais foram coletadas de todos os participantes durante a reabertura do implante. O Método Livak determinou a quantificação relativa da expressão de RANKL / OPG em um sistema de reação em cadeia da polimerase quantitativa. As proteínas RANKL e OPG foram analisadas utilizando western blot e imunohistoquímica. O teste não paramétrico de Mann-Whitney correlacionou os níveis de RANKL e OPG em cada grupo (p <0,05). Vinte e quatro (92,3%) participantes do grupo controle apresentaram cicatrização peri-implantar sem intercorrências durante a osseointegração, em contraste com 7 (30,4%) no grupo PC. Os participantes de pesquisa com histórico de PC tiveram 27 vezes mais chance de desenvolver cicatrização peri-implantar com intercorrências, incluindo a inflamação da mucosa e/ou perda do implante, em comparação com o grupo controle (p=0,0001; 27,43 [4,28-228,63] ). OPG mostrou níveis de RNAm semelhantes em ambos os grupos (p=0,22). No entanto, foram observados altos níveis de RANKL (p=0,04) no grupo PC. Além disso, altas expressões de RNAm de
(p=0,001). As análises de western blot e imunohistoquímica mostraram aumento dos níveis de RANKL em oposição à diminuição da expressão OPG em participantes com PC. Em conclusão, mesmo sem periodontite ativa, os participantes de pesquisa com histórico de PC tiveram níveis elevados de RANKL/OPG nos tecidos peri-implantares, e maior correlação com inflamação da mucosa peri-implantar e perda do implante.
Palavras-chave: Osteoprotegerina; RANK ligante; periodontite crônica; peri-implantite
Costa LC. History of chronic periodontitis and increased rankl/opg ratio are associated with harmful peri-implant healing.
Tese/Dissertação Niterói: Universidade Federal Fluminense, Faculdade de Odontologia; 2014.
History of chronic periodontitis (CP) is a risk factor for osseointegration failure. The osteoclastogenesis system, which includes the receptor activator of nuclear factor-kappa B (RANK), RANK ligand (RANKL) and osteoprotegerin (OPG), is critical for homeostatic control of osteoclast activity, suggesting the system‟s vital role in the progress of bone loss. In this study, we investigated the levels of OPG and RANKL in healing peri-implant tissues from subjects volunteer with and without a history of CP and their association with uneventful osseointegration. Diagnosis of a history of CP and peri-implant examination was performed on 49 subjects volunteer. Based on periodontal status, subjects were divided into a control group (without history of CP, n= 26) and a CP group (with history of CP, n= 23). Gingival biopsies were harvested from all subjects during implant exposure. Livak Method determined the relative quantification of OPG/RANKL expressions in a quantitative polymerase chain reaction system. OPG and RANKL proteins were analyzed using western blot and immunohistochemistry assay. Non-parametric Mann-Whitney test correlated the levels of OPG and RANKL in each group (p<0.05). Twenty-four (92.3%) subjects in the control group showed uneventful peri-implant healing during osseointegration, in contrast with 7 (30,4%) in the CP group. Subjects with CP history had 27 times higher chance of developing harmful peri-implant healing, including mucosae inflammation and/or implant loss compared to subjects without CP history (p=0.0001; 27.43 [4.28-228.63]). OPG showed similar mRNA levels in both groups (p=0.22). However, high levels of RANKL were observed (p=0.04) in the CP group. In addition,
RANKL/OPG mRNA expressions showed higher association with history of chronic
periodontitis (p=0.001). The western blot and immunohistochemistry analyses showed the increase of RANKL levels in opposition to decrease OPG expression in CP patients. In conclusion, even without active periodontitis, subjects with a history of
implant mucosae inflammation and implant loss.
1 - INTRODUÇÃO
O processo osteogênico requer uma coordenação cronológica e espacial cuidadosa dos sinais moleculares para conduzir a proliferação, migração e diferenciação das células mesenquimais precursoras de osteoblastos.45 Durante a instalação do implante, a formação de osso em torno do implante de titânio é ativada quando a matriz é exposta à um fluido extracelular, liberando proteínas não colagenosas e fatores de crescimento.42 Esta fase inicial da cicatrização óssea desencadeia, posteriormente, deposição de uma matriz orgânica e mineralizada.45
A osseointegração bem sucedida é determinada pela incorporação do osso trabecular e adaptação da massa óssea à carga, com aposição óssea contínua e remodelação em direção ao implante.36 O processo é extremamente complexo e muitos fatores influenciam na formação e manutenção do osso localizados na superfície do implante.36
Recentemente, a periodontite crônica (PC) foi considerada um fator de risco importante ao processo de osseointegração adequada.15 Similar à periodontite, na peri-implantite (reabsorção do tecido ósseo peri-implantar),45 o aumento da atividade microbiana pode promover desequilíbrio na resposta do hospedeiro favorecendo a inflamação.29 Isto aumenta a atividade osteoclástica com consequente reabsorção óssea e perda do implante.25,28. Avanços em biologia óssea demonstraram que a reabsorção óssea é regulada pela interação de um sistema de citocinas pertencentes à superfamília do receptor fator de necrose tumoral e ligante, que compõem o sistema de osteoclastogênese – o fator ativador do receptor nuclear kappa-B (RANK) / ligante RANK (RANKL ) / osteoprotegerina (OPG). 18
RANKL, também conhecido como TNFSF11, é o décimo primeiro membro da família de OPG ligantes, expresso por osteoblastos, células do estroma, fibroblastos, células B e células T, quando estimulados por citocinas e lipopolissacarídeos bacterianos.23 A sua ação é conduzida através da ligação de receptores especiais, conhecidos como RANK, que estão presentes na superfície dos pré-osteoclastos/osteoblastos,30 e resulta no aumento da atividade dos osteoclastos maduros.19
Por outro lado, a OPG, também conhecida como fator inibidor da osteoclastogênese ou TNFRSF11B, é um receptor circulante solúvel, semelhante ao
RANKL, que antagoniza a interação RANK-RANKL e, portanto, promove a formação de osso, inibindo a osteoclastogênese.7,41 Células do estroma da medula óssea, osteoblastos, células dendríticas, e células do músculo liso expressam OPG .38
RANKL e OPG regulam a reabsorção óssea por estimulação positiva ou negativa de RANK em células precursoras de osteoclastos.29 A associação positiva de marcadores genéticos para RANK e OPG tem sido observada em doenças ósseas destrutivas, tais como a doença de Paget,44 osteólise expansível familiar, osteoporose humana27 e lesões apicais.33 Além disso, os estudos mostraram que a proporção relativa de RANKL/OPG é mais elevada em sítios com periodontite quando comparado com sítios saudáveis.29 Níveis elevados de RANKL e uma redução dos níveis de OPG são característicos de perda óssea alveolar em pacientes com PC.20
Poucos estudos sobre a função do sistema RANKL/OPG no insucesso da implantodontia tem sido relatados. Estes estudos revelaram a associação de níveis elevados de OPG com tecido peri-implantar saudável e aumento da expressão de RANKL com doença peri-implantar.4,22,38
Até onde sabemos, nenhum estudo anterior detectou alterações teciduais peri-implantares iniciais associadas ao sistema de osteoclastogênese. Tendo em conta que o processo de remodelação óssea é fundamental para a osseointegração, e o sistema de osteoclastogênese é a principal via de ativação osteoclástica, o nosso estudo teve como hipótese que indivíduos com histórico de PC tem um desequilíbrio do sistema RANKL/OPG durante a osseointegração, interferindo na cicatrização do tecido peri-implantar. Portanto, o objetivo deste estudo foi investigar os níveis de RANKL e OPG na cicatrização dos tecidos peri-implantares de pacientes com e sem histórico de PC e sua associação com a osseointegração sem intercorrências.
2 – MATERIAL E MÉTODOS
2.1 Participantes de Pesquisa
Quarenta e nove participantes de pesquisa, apresentando 59 implantes endósseos ósseointegráveis, foram recrutados para o estudo nas Clínicas Odontológicas da Faculdade de Odontologia da Universidade Federal Fluminense, Niterói, e da Universidade Veiga de Almeida, Rio de Janeiro, Brasil, durante um ano. Os procedimentos clínicos foram conduzidos de acordo com as recomendações dos Conselhos de Ética das duas universidades (número de registro 80627 e 00706212.9.0000.5243 12/09, respectivamente) (Anexos A e B). O termo de consentimento livre e esclarecido informado foi obtido de todos os participantes (Anexo C). Os parâmetros clínicos iniciais da população estudada são apresentados na tabela 1, incluindo anamnese e história médica e odontológica. Os critérios de exclusão foram: uso bifosfonato, ingestão de antibióticos e agentes anti-inflamatórios nos últimos três meses, gravidez e/ou lactantes, em participantes do sexo feminino, ausência de radiografia pré-operatória, participantes com doença periodontal ativa, e com exposição do parafuso de cobertura. Todos os participantes incluídos foram reabilitados com implantes de dimensões mínimas de 3,4mm de espessura e 7mm de altura, em procedimento de dois estágios cirúrgicos, mostrando qualidade e quantidade de osso favorável para a instalação, fazendo uso apenas de agentes analgésicos durante o período pós-operatório imediato .1
2.2 Diagnóstico de periodontite crônica
O diagnóstico de PC foi estabelecido com base em parâmetros radiográficos, incluindo a análise radiográfica mostrando reabsorção óssea horizontal antes da colocação do implante, e avaliação de exame clínico e história dental pregressa, a fim de diferenciar a periodontite crônica da forma agressiva.
O diagnóstico e a classificação da periodontite crônica foram baseados em Armitage (2004).6 Todos os indivíduos diagnosticados com periodontite crônica foram tratados e estavam sob manutenção periodontal regular.
Com base na condição periodontal, os participantes foram divididos em grupo controle (sem histórico de periodontite crônica, n = 26) e o grupo PC (com histórico de periodontite crônica, n = 23).
2.3 Avaliação da osseointegração
A Osseointegração foi avaliada durante a cirurgia de reabertura, após o aguardo de 3 meses em mandíbula e 6 meses em maxila de instalado o implante. Os critérios para considerar a osseointegração adequada foram: imobilidade do implante durante o teste clínico; ausência de radiotransparência peri-implantar; e ausência de sinais e/ou sintomas persistentes, como dor, infecção, neuropatia, parestesia, ou comprometimento do canal mandibular.2
Todas as regiões peri-implantares foram avaliadas clínica e radiograficamente, um mês após a reabertura do implante. O exame clínico dos tecidos peri-implantares foi realizado através de inspeção visual e palpação, análise de inflamação da mucosa, edema, sangramento espontâneo, pus, tipo plataforma do implante e mobilidade. Com base nas características clínicas dos sítios, os participantes foram caracterizados como (i) tendo a cicatrização sem complicações (com a osseointegração adequada, sem mobilidade do implante, e sem qualquer sinal de inflamação da mucosa) ou (ii) cicatrização peri-implantar inadequada (com osseointegração inadequada caracterizada por sinais de inflamação na mucosa e/ou mobilidade de implante).
A avaliação da osseointegração durante a cirurgia de reabertura, e a avaliação 1 mês após, foram realizadas por examinadores diferentes, sem que os mesmos soubessem em qual dos grupo os participantes avaliados se encontravam.
2.4 Expressão de RNA
Biópsias gengivais foram coletadas de 49 participantes de pesquisa após o período de osseointegração, durante o procedimento de reabertura do implante. Foram coletadas amostras de 26 participantes do grupo controle e 23 do grupo PC e, imediatamente submersas no reagente para estabilização do RNA (RNA later, Qiagen, Valencia, CA), e armazenadas a -800C até a extração de RNA.
O RNA total isolado a partir das amostras gengivais foi isolado utilizando o reagente Trizol® (InvitrogenTM por Life Technologies, Nova Iorque, EUA) de acordo
com o protocolo do fabricante. Tratamento com DNase, para digerir o DNA genômico que poderia levar a falsos resultados positivos, foi realizado usando DNA-free DNase® (Ambion por InvitrogenTM pela Life Technologies, NY, EUA). A integridade do RNA foi confirmada e corrida em eletroforese, gel de agarose a 1,2% corada com SYBR Stain® (InvitrogenTM pela Life Technologies, NY, EUA). A pureza do RNA foi confirmada com a razão das absorvâncias 260/280 em spectrophotômetro, e a quantidade de RNA foi estimada a 260 nm (Nanodrop® 1000, Thermo Scientific, Wilmington, EUA). A reação de transcrição reversa do PCR (RT-PCR) foi realizada para a síntese de DNA complementar (cDNA), a partir de 300 ng de RNA utilizando o sistema ImProm-II Transcrição Reversa System™ (Promega Corporation, Wisconsin, EUA), de acordo com o protocolo do fabricante. O controle do branco (RT-PCR, sem matriz de RNA) e as reações RT (reações de PCR sem a transcrição reversa) foi executada juntamente com todos os RT-PCRs. As reações de PCR quantitativo (qPCR) foram realizadas no software MxPro-Mx3005P (Stratagene/Agilent Technologies, Wilmington, DE, EUA), utilizando o sistema de detecção rápida SYBR Green Master Mix (Applied Biosystems, Foster City, CA, EUA) com 1,5 ul de cDNA em cada reação. qPCR foi realizada com um ativação a 95 ° C durante 10 minutos, seguido por 40 ciclos de desnaturação e prolongamento (95 ° C durante 15 segundos e 60 ° C durante 1 minuto). Iniciadores específicos para OPG (frente 5 'AGGAGCTGCAGTACGTCAAG 3' e inverso 5 'TCTGGGGTTCCAGCTTGC 3') e RANKL (5 'GCAGAGAAAGCGATGGTGGA 3' e 5'GGAACCAGATGGGATGTCGG 3 '), foram confeccionados com base nos dados BLAST (http: //blast.ddbj. nig.ac.jp/top-j.html). O Método Livak (2-ΔΔCT) foi utilizado para determinar a quantificação relativa da expressão de RANKL/OPG. Os valores foram normalizados em relação à expressão constitutiva de β-actina (para a frente 5 '- AAT TAC GAG CTG CGT GTG G - 3' / reverse 5 '- AGA GCG CAG GTA GGA TAG CA - 3').43 Duas séries de experimentos foram realizados para cada amostra de tecido para assegurar a reprodutibilidade. Os dados são apresentados com a variação relativa de dobragem de um calibrador (pool de RNA a partir de todas as amostras). Todas as reações foram realizadas em duplicata contendo informações essenciais de acordo com Bustin et al. (2009).14
2.5 Preparação da amostra e experimentos de Western Blot
Para a quantificação das proteínas RANKL/OPG, 8 amostras gengivais foram verificados por processo mecânico e sonicação, e quantificados por método Bradforf.13 Quinhentos nanogramas de proteína foram homogeneizados em tampão de amostra (0,02 mM dithioreitol [DTT], 1,38 mM de sulfato de dodecilo e sódio [SDS], e 125 mM de Tris-HCl [pH 6,8 e glicerol a 20%]) e 50 ug de proteína foram separadas por eletroforese em gel de SDS-poliacrilamida a 10%. As proteínas foram então eletro-transferidas para uma membrana de PVDF (Hy-bond-P TM, Amersham Biosciences, Brasil). As membranas foram bloqueadas em 5% de leite em pó desnatado em Tris-tamponada salina de 0,001% de Tween 20 (TBS-T), durante uma hora e, em seguida, incubadas com os anticorpos primários: policlonais de coelho-anti-OPG (Abecam, EUA), o policlonal anti-RANKL de coelho (Abcam, EUA) e rato monoclonal anti-tubulina (Sigma-Aldrich, Clone DM1A, EUA) durante a noite. A reação foi observada usando SuperSignalWest Pico Chemiluminescent Substrate (Pierce, EUA).
2.6 Imunohistoquímica
Duas amostras, uma de cada grupo, foram embebidas em parafina e seccionadas no plano coronal, com 4 μm de espessura, e montadas em lâminas. As secções foram mergulhadas em xileno para remover a parafina e desidratadas por meio de uma série de álcoois graduados. A fim de impedir a atividade da peroxidase endógena, as secções foram incubadas com 3% de peróxido de hidrogênio em metanol, durante 30 minutos, à temperatura ambiente, seguido de tratamento com antígeno citrato de sódio durante 20 minutos a 96 ° C. Cinco por cento do soro de cabra normal em PBS-Triton (0,3%) foi utilizado para bloquear a temperatura ambiente. Foram utilizados os seguintes anticorpos: anti-OPG (1:200, de coelho policlonal, Abcam, EUA) e anti-RANKL (1:200, anticorpo policlonal de coelho, Abcam, EUA) em 5% de soro bovino normal, durante a noite a 4 ° C. Depois disso, as lâminas foram tratadas com a coloração da peroxidase (Sigma-Aldrich, EUA) e
com tetracloridrato de diaminobezidina (DAB-Vector Laboratories, Brasil). As lâminas foram então contrastadas com hematoxilina de Harris ou verde de metilo e montados com Entellan (Merck Millipore, Brasil), a fim de visualizar os núcleos das células. Os controles negativos foram obtidos seguindo o protocolo exato descrito acima, mas omitindo o anticorpo primário de cada reação. As lâminas foram fotografadas com um microscópio Nikon Eclipse TE300 (Nikon Company, EUA).
2.7 Análises Estatísticas
O tamanho da amostra necessária para um estudo com 80% de poder foi calculado usando uma calculadora on-line em http://statpages.org/proppowr.html. As Nominais variáveis foram expressas em frequências e percentuais. Para acessar o significado das variáveis nominais entre os grupos, foi realizado o teste do qui-quadrado (χ2). As variáveis contínuas foram expressas em média e desvio padrão. O teste de Shapiro-Wilk foi utilizado para avaliar a distribuição entre as variáveis. A análise de variância foi realizada utilizando (ANOVA)/testa t-Test ou Mann-Whitney para comparação das médias entre os grupos, quando a variável estava em uma distribuição normal ou não-normal, incluindo a análise de expressão gênica após o cálculo pelo método 2-ΔΔCT. Valores de p<0,05 foram considerados estatisticamente significativos. As análises de regressão logística multinominal foram realizadas para permitir a exploração das co-variáveis simultaneamente em comparação com o grupo controle (idade, osseointegração adequada, e expressões RANKL/OPG). As análises estatísticas foram realizadas utilizando Stata 11.1 (StataCorp, Texas EUA).
3 - ARTIGO PRODUZIDO
History of chronic periodontitis and increased RANKL/OPG ratio are associated with harmful peri-implant healing
Abstract: History of chronic periodontitis (CP) is a risk factor for osseointegration
failure. The osteoclastogenesis system, which includes the receptor activator of nuclear factor-kappa B (RANK), RANK ligand (RANKL) and osteoprotegerin (OPG), is critical for homeostatic control of osteoclast activity, suggesting the system‟s vital role in the progress of bone loss. In this study, we investigated the levels of OPG and RANKL in healing peri-implant tissues from subjects volunteer with and without a history of CP and their association with uneventful osseointegration. Diagnosis of a history of CP and peri-implant examination was performed on 49 subjects volunteer. Based on periodontal status, subjects were divided into a control group (without history of CP, n= 26) and a CP group (with history of CP, n= 23). Gingival biopsies were harvested from all subjects during implant exposure. Livak Method determined the relative quantification of OPG/RANKL expressions in a quantitative polymerase chain reaction system. OPG and RANKL proteins were analyzed using western blot and immunohistochemistry assay. Non-parametric Mann-Whitney test correlated the levels of OPG and RANKL in each group (p<0.05). Twenty-four (92.3%) subjects in the control group showed uneventful peri-implant healing during osseointegration, in contrast with 7 (30,4%) in the CP group. Subjects with CP history had 27 times higher chance of developing harmful peri-implant healing, including mucosae inflammation and/or implant loss compared to subjects without CP history (p=0.0001; 27.43 [4.28-228.63]). OPG showed similar mRNA levels in both groups (p=0.22). However, high levels of RANKL were observed (p=0.04) in the CP group. In addition,
RANKL/OPG mRNA expressions showed higher association with history of chronic
periodontitis (p=0.001). The western blot and immunohistochemistry analyses showed the increase of RANKL levels in opposition to decrease OPG expression in CP patients. In conclusion, even without active periodontitis, subjects with a history of CP had elevated tissue levels of RANKL/OPG and higher correlation with peri-implant mucosae inflammation and peri-implant loss.
Keywords: osteoprotegerin; RANK ligand; chronic periodontitis; peri-implantitis
INTRODUCTION
The osteogenic process requires a careful chronological and spatial coordination of molecular signals to drive proliferation, migration, and differentiation of mesenchymal precursor cells in osteoblasts.45 During implant placement, bone formation around the titanium implant is activated when the matrix is exposed to extracellular fluid, releasing noncollagenous proteins and growth factors.42 This early stage of bone healing triggers subsequent deposition of an organic matrix and mineralization.45
Osseointegration success is determined by the incorporation of the woven bone, and the bone mass‟ adaptation to bearing a load, with continuous bone apposition and remodeling toward the implant.36 The process itself is quite complex and many factors influence the formation and maintenance of bone located at the implant surface.36
Recently, chronic periodontitis (CP) was considered a major risk factor for impaired osseointegration process.15 Similar to periodontitis, in peri-implantitis, (peri-implant bone tissue resorption) 46 increased microbial activity can disrupt the balance of the host response in favor of inflammation.29 This increases osteoclastic activity with consequent bone resorption and implant loss.25,28 Advances in bone cell biology demonstrated that bone resorption is regulated by the interplay of a cytokine system belonging to tumor necrosis factor ligand and receptor superfamilies, which comprise the osteoclastogenesis system - the receptor activator nuclear factor kappa-B (RANK)/ RANK ligand (RANKL)/ osteoprotegerin (OPG). 18
RANKL, also known as TNFSF11, is the eleventh member of the OPG ligand family, expressed by osteoblasts, stromal cells, fibroblasts, B cells, and T cells when stimulated by cytokines and bacterial lipopolysaccharides.23 Its action is conducted by connecting to special receptors, known as RANK, which are present on the surface of pre-osteoclast/osteoblast cells 29 and, results in the enhancement of matured osteoclasts activity.19
Conversely, OPG, also known as osteoclastogenesis inhibitory factor or TNFRSF11B, is a soluble circulating decoy receptor of RANKL that antagonizes the RANK-RANKL interaction and, therefore, promotes bone formation by inhibiting osteoclastogenesis.7,41 Bone marrow stroma cells, osteoblasts, dendrites, and smooth muscle cells express OPG.38
RANKL and OPG regulate bone resorption by positive or negative stimulation of RANK on osteoclast cells.29 The positive association of genetic markers for RANK and OPG has been observed in bone-destructive diseases, such as Paget‟s disease,44 familial expansile osteolysis, human osteoporosis,27 and apical lesions.33 In addition, studies have shown that the relative ratio of RANKL/OPG is higher in sites with periodontitis when compared to healthy sites.29 Higher levels of RANKL and a reduction of OPG levels are characteristics of alveolar bone loss in patients with CP.20
Few studies on the role of RANKL/OPG in peri-implant failure have been reported. These studies have found the association of higher OPG levels with healthy peri-implant status4, and increased RANKL expression with peri-implant disease.22,38
As far we know, no previous study detected early peri-implant tissue alterations associated with the osteoclastogenesis system. Taking into account that the bone remodeling process is crucial for osseointegration and the osteoclastogenesis system is the main pathway for osteoclastic activation, our study hypothesized that subjects with history of CP have a RANKL/OPG imbalance during osseointegration, disrupting the peri-implant tissue‟s healing. Therefore, the purpose of this study was to investigate the levels of OPG and RANKL in healing peri-implant tissues from patients with and without a history of CP and its association with uneventful osseointegration.
MATERIAL AND METHODS
Subjects volunteer
Forty-nine subjects volunteer, presenting 59 osseointegrated endosseous implants, were recruited for the study from the patients‟ pool at the Dental Clinics of the Faculty of Dentistry, Fluminense Federal University, Niterói, and Veiga de
Almeida University, Rio de Janeiro, Brazil, during one year. Clinical procedures were conducted according to recommendations from both Universities‟ Research Ethics Boards (Registration number 80627 and 00706212.9.0000.5243 12/09, respectively). Informed consent was obtained from all participants. The baseline clinical parameters for the subject population are shown in Table 1. Subjects answered a personal, medical, and dental history anamnesis. Exclusion criteria were: biphosphonate use, intake of antibiotics and anti-inflammatory agents in the preceding three months, pregnancy and/or lactation in female patients, no preoperative radiography, participants with active periodontal disease, and exposure of the cover screw. All included subjects underwent a two-stage implant placement procedure with minimum dimensions of 3.4mm thick and 7mm in height, showing favorable bone quality and quantity, using only analgesics during the immediate postoperative period 1
Diagnosis of Chronic Periodontitis
The diagnosis of CP was established on the basis of radiographic parameters, including radiographic analysis showing horizontal bone resorption before implant placement, and assessment of clinical examination and past dental history in order to differentiate chronic from aggressive periodontitis.
The diagnosis and classification of chronic periodontitis was based on Armitage (2004).6 All subjects diagnosed with chronic periodontitis had been treated and were under regular maintenance.
Based on periodontal status, subjects were divided into control group (without history of chronic periodontitis, n= 26) and CP group (with history of chronic periodontitis, n= 23).
Osseointegration Evaluation
The Osseointegration was evaluated during surgery to reopen after waiting 3
months in the mandible and 6 months in the maxilla installed the implant. The criteria for uneventful ossointegration were: implant immobility during clinical test; absence of peri-implant radiotransparence; and absence of persistent signs and/or symptoms, such as pain, infection, neuropathy, paresthesia, or mandibular canal commitment. 2
All peri-implant regions were clinically and radiographically evaluated one month after the implant exposure. Clinical examination of the peri-implant sites consisted of visual inspection and palpation, analysis of mucosal inflammation, edema, spontaneous bleeding, pus, implant platform type, and mobility. Based on local characteristics, subjects were characterized as (i) having uneventful healing (with adequate osseointegration, without implant mobility, and without any signal of mucosae inflammation) or (ii) harmful peri-implant healing (with inadequate osseointegration characterized by signs of mucosae inflammation and/or implant mobility).
The evaluation of osseointegration during the reopenning surgery, and the evaluation one month later, were conducted by different examiners and they did not know wich group the participants were placed.
RNA expression
Gingival biopsies were harvested from 49 patients after the osseointegration period, during the implant exposure procedure. Samples were collected from 26 subjects from the control group and 23 from CP group and immediately submerged in RNA stabilization reagent (RNA later, Qiagen, Valencia, CA) and stored at -800C until RNA extraction.
Total RNA from gingival samples was isolated using the Trizol® Reagent (InvitrogenTM by Life Technologies, NY, USA) method according to the manufacturer's protocol. DNase treatment to digest genomic DNA that could lead to false positive gene expression results was done using DNA-free DNase® (Ambion by InvitrogenTM by Life Technologies, NY, USA). RNA integrity was confirmed on a 1.2% agarose denaturing gel electrophoresis stained with SYBR Nucleic Acid Gel Stain® (InvitrogenTM by Life Technologies, NY, USA). RNA purity was confirmed with the spectrophotometic absorbance ratio at 260/280, and RNA quantity was estimated by the absorbance at 260nm (Nanodrop® 1000, Thermo Scientific, Wilmington, USA). Reverse transcription-polymerase chain reaction (RT-PCR) was performed for the synthesis of complementary DNA (cDNA), from 300ng of RNA using the system ImProm-II Reverse Transcription System™ (Promega Corporation, Wisconsin, USA), according to the manufacturer's protocol. The blank control (RT-PCR without RNA template) and RT (-) reactions (PCR without reverse transcription) were executed
along with all RT-PCRs. The quantitative PCR (qPCR) reactions were run in the MxPro-Mx3005p software (Stratagene/Agilent Technologies, Wilmington, DE, USA) using the detection system Fast Sybr Green Master Mix (Applied Biosystems, Foster City, CA, USA) with 1.5 µl of cDNA in each reaction. qPCR was performed with an activation step at 95°C for 10 minutes, followed by 40 cycles of denaturation and annealing/extension (95°C for 15 seconds and 60°C for 1 minute). It was designed specific primers for OPG (forward 5‟ AGGAGCTGCAGTACGTCAAG 3‟ and reverse 5‟ TCTGGGGTTCCAGCTTGC 3‟) and RANKL (5‟ GCAGAGAAAGCGATGGTGGA 3‟ and 5„GGAACCAGATGGGATGTCGG 3‟) based on BLAST database (http://blast.ddbj.nig.ac.jp/top-j.html). A melt curve was performed for specific amplification analysis. The Livak Method (2-ΔΔCT) was used to determine the relative quantification of OPG/RANKL expression. Values were normalized with respect to constitutive expression of β-actin (forward 5‟ - TAC AAT GAG CTG CGT GTG G – 3‟/ reverse 5‟ - AGA GGC GTA CAG GGA TAG CA – 3‟) 42
. Two series of experiments were carried out for each tissue sample to ensure reproductibility. Data are presented as fold change relative to a calibrator (RNA pool from all samples). All reactions were performed in duplicate and checklist with essential information is in accordance with Bustin et al. (2009).14
Sample preparation and western blot experiments
For OPG and RANKL proteins quantification, eight gingival samples were verified by mechanical and sonication process, and were quantified by Bradforf methods. 13 Five hundred µg of protein were homogenate in sample buffer (0.02 mM dithioreitol [DTT]; 1.38 mM sodium dodecyl sulfate [SDS]; 125 mM Tris–HCl, [pH 6.8 and 20% glycerol]) and 50 µg of protein were separated by 10% SDS– polyacrylamide gel electrophoresis. Proteins were then electro-blotted to a PVDF membrane (Hy-bond TM-P, Amersham Biosciences, Brazil). Membranes were blocked in 5% non-fat dry milk in Tris-buffered saline 0.001% Tween 20 (TBS-T) for one hour and then incubated with the primary antibodies: rabbit-polyclonal anti-OPG (Abecam, USA), rabbit-polyclonal anti-RANKL (Abcam, USA) and mouse-monoclonal anti-tubulin (Sigma–Aldrich, Clone DM1A, USA) overnight. The reaction was observed using SuperSignalWest Pico Chemiluminescent Substrate (Pierce, USA).
Immunohistochemistry
Paraffin-embedded heads from 2 samples in CP and control groups were sectioned in the coronal plane at 4 μm thickness and mounted onto slides. Sections were dipped in xylene to remove the paraffin and dehydrated through a graded alcohol series. In order to prevent endogenous peroxidase activity, sections were incubated with 3% hydrogen peroxide in methanol for 30 minutes at room temperature following sodium citrate antigen unmasking treatment for 20 minutes at 96°C. Five percent normal goat serum in PBS-Triton (0.3%) was used for blocking at room temperature. The following antibodies were used: anti-OPG (1:200, rabbit-polyclonal antibody, Abcam, USA) and anti-RANKL (1:200, rabbit rabbit-polyclonal antibody, Abcam, USA) in 5% normal Bovine Serum at 5%, overnight at 4°C. After that, the slides were treated with peroxidase staining (Sigma-Aldrich, USA) and developed with diaminobezidine tetrahydrochloride (DAB-Vector Laboratories, Brazil). The slides were then counterstained with Harris hematoxylin or methyl green and mounted with Entellan (Merck Millipore, Brazil) in order to visualize nuclei of the cells. Negative controls were obtained following the exact protocol described above, but omitting the primary antibody of each reaction. The slides were photographed under a Nikon Eclipse TE300 microscope (Nikon Company, USA).
Statistical Analyses
The sample size needed for a study with 80% power was calculated using an online calculator at http://statpages.org/proppowr.html.Nominal variables were expressed as frequencies and percentages. To access the significance of nominal variables between groups, the chi-square (χ2) test was performed. Continuous variables were expressed as mean and standard deviation. The Shapiro-Wilk test was used to evaluate distribution among variables. Analysis of variance was performed using (ANOVA)/ t-Test or Mann-Whitney tests to compare means between groups when the variable was in a normal or non-normal distribution, including gene expression analysis after 2-ΔΔCT method calculation. Values of p<0.05 were considered statistically significant. Multinomial logistic regression analyses were performed to permit the exploration of many covariates simultaneously compared to the healthy group (age, osseointegration success, and OPG/RANKL expressions). Statistical analyses were performed using STATA 11.1 (StataCorp, Texas USA).
Results
Clinical results
From the total of 49 subjects evaluated during six months, there were 36 (73.4%) women and 13 (26.5%) men, with mean age 56.5 ± 9.9 years. No difference was found between control and CP groups regarding ethnicity, sex, age, smoking habits, alcohol consumption, general medical conditions, and current medication. In contrast, CP subjects showed higher incidence of total edentulism (p=0.04) and unsatisfactory hygiene (p=0.01) compared to the controls (Tables 1 and 2).
Taking into account peri-implant status (Table 3) one month after implant exposure, the CP group showed higher prevalence of red mucosae (p=0.02). Twenty-four (92.3%) subjects in the control group showed uneventful peri-implant healing during osseointegration, in contrast with 7 (30,4%) in the CP group. Subjects with CP history had 27 times higher chance of developing harmful peri-implant healing, including mucosae inflammation and/or implant loss (2 cases, 4%), compared to subjects without CP history (p=0.0001; 27.43 [4.28-228.63]) (Table 4). Implant platform type had no association with impairing osseointegration (Table 5).
Correlation of clinical and osteoclastogenic parameters
To support the potential association of RANKL/OPG genes with the history of chronic periodontitis and peri-implant healing during osseointegration process, we investigated the genes‟ expression in 49 tissues harvested from subjects with or without CP. All DNA samples presented A260 nm/A280 nm ratios greater than 1.9. From the total samples, OPG and RANKL mRNA were detected in 40 tissues (81.6%).
OPG showed similar mRNA levels in both groups (p=0.22). However, high levels of RANKL was observed (p=0.04) in the CP group. In addition, RANKL/OPG mRNA
expressions showed higher association with history of chronic periodontitis (p=0.001) (Graphic 1).
In order to assess factors concurrently, a multivariate logistic regression was performed. The initial univariate analysis demonstrated chronic periodontitis (p=0.0001) and higher RANKL/OPG expression (p=0.04) as potential predictive factors for osseointegration complications. Table 6 summarizes the multivariate
logistic regression analysis and shows chronic periodontitis as potential predictors associated with harmful peri-implant healing during osseointegration.
All mRNA and protein analyses were performed in the same gingival sample from the same collected site. Therefore, samples obtained during implant exposure surgeries were divided in three fragments, when possible: one for RNA expression analysis, one for western blot analysis and one for immunohistochemistry. Considering the sample diameter to be about 4 mm, just in 8 samples was possible performing western blot analysis and in 1 sample immunohistochemistry. RANKL and OPG protein levels were specifically detected in eight subjects from the total of 49 included subjects. The western blot analysis showed that RANKL levels were increased in CP patients and OPG appeared downexpressed in the same diseased patients (Figure 1, columns 1-3). Therefore, we employed an affinity purified polyclonal antibody in histological sections from peri-implant tissues harvested from control and CP subjects (Figure 2). Lower RANKL staining in healthy subject was detected (Figure 2 A) in contrast with CP subject, who showed clearly higher detection of RANKL (brown staining – Figure 2B). Consistent OPG staining in gingiva from subjects with history of CP (Figure 2 D) was no observed. However, marked OPG staining (brown staining) was characteristic of gingiva from healthy subjects (Figure 2 C).
Discussion
The purpose of this study was to investigate the levels of OPG and RANKL in healing peri-implant tissues and their association with uneventful osseointegration by comparing subjects with and without history of CP. The results indicated that there is significantly higher RANKL/OPG expression in CP subjects and it has a correlation with harmful peri-implant healing. Therefore, our study supports the hypothesis that subjects with CP have RANKL/OPG imbalance during osseointegration, disrupting implant tissue wound healing and consolidating CP as a risk factor for peri-implant disease development.
Considerable effort has been made to understand the biological relationship between history of CP and peri-implant disease.16,17 A great number of studies have
focused on the osteoclastogenic system profile of chronic periodontitis.3,8,9,10,11,20,21,25,29,30,38,43 However, until now, no previous study correlated OPG/RANKL levels in mucosae of patients with history of CP who underwent to implant placement and the genes‟ influence on the osseointegration process.
Taking into account that the molecules responsible for the osteoclastogenic system and bone homeostasis work in a network-like organization,22 this study clearly demonstrated the relationship between CP and harmful peri-implant healing. The main findings of our analyses can be explored as follows: (i) the destructive tissue pattern related to exacerbated inflammatory response in subjects with CP6 remains even after tooth loss, and this exacerbated response is possibly an individual pattern related to CP‟s genetic basis, not just a local factor associated with the presence of infection around tooth; (ii) the relationship between high incidence of peri-implant disease in patients with CP has the osteoclastogenesis system as biological basis, with increased levels of osteoclast activators (RANKL) in peri-implant tissues from CP patients; (iii) the harmful peri-peri-implant healing observed in patients with CP can be the start-point for peri-implant disease development after osseointegration period.
It‟s a general consensus that peri-implantitis is characterized by progressive bone destruction and it is the main cause of implant failures.35,37 However, mucosae inflammation occurs prior to irreversible peri-implant bone loss.39 Therefore, signs of inflammation were evaluated in all subjects during clinical examination in order to indicate the possibility of complications with the osseointegration process. In our study, subjects with CP showed significant incidence of mucosae inflammation compared to subjects without CP history, and 2 subjects lost the implant. These data showed that patients with CP have 27 times higher chance of developing complications in mucosae and bone around implant, consolidating CP as a risk factor for peri-implantitis development.
Different mediators have been identified in the process of periodontal bone destruction, including arachidonic acid metabolites, cytokines, and nitric oxide.26 The pro-inflammatory cytokines, prostaglandin E2 (PGE2), IL-1b, IL-6, and TNF-,12 together with a number of other mediators of bone metabolism (TGF-b, PTH, 1,25-dihydroxyvitamin D3, glucocorticoids and estrogen), exert their effects on osteoclastogenesis by regulating osteoblastic/stromal cell production of OPG and
RANKL.40
Previous studies related that the change in the levels of RANKL play a major role in the bone loss observed in periodontitis.20,24 An increased concentration of RANKL and a decrease of OPG has been detected in gingival crevicular fluid11,31,34 and gingival tissues9,11,20,43 from patients with periodontitis. Similarly, high RANKL/OPG levels were associated with peri-implant tissue destruction.5,22,38 Rakic et al.38 emphasized the role of RANKL and OPG as prognostic biomarkers in peri-implantitis, suggesting that expressions of osteoclastogenesis related factors may play an important role in the onset and severity of the peri-implantitis.22
Our study tried crossing two diseases with similar etiology and immunologic pattern, chronic periodontitis and peri-implantitis, based on the biology of the osteoclastogenesis system and the possible early etiology of peri-implant disease. RANKL expression was significantly higher in the CP group, as well as RANKL/OPG ratio expressions, compared to tissues from subjects without CP. In addition, multivariate analysis affirmed CP to be associated with higher RANKL/OPG expression and a predictive factor for peri-implant healing complications.
In order to ensure the OPG and RANKL effect on harmful peri-implant healing and implant loss, we performed Western Blot and immunohistochemical analyses. In our study, the exploration of the molecular mechanism of early peri-implant failure was consistent with RANKL/OPG gene expression levels. RANKL was overexpressed in tissues from subjects with CP history even without disease activity. These results corroborate with previous findings,22,30,31,38 indicating that peri-implant complications and implant loss could be a genetic factor, and that the molecular mechanism of bone resorption can be active in patients with CP history.
The design of the present study considered that osseointegration is a dynamic process that culminates in the formation of an intimate contact between implant surface and surrounding bone. However, it‟s unclear how and why patients with history of chronic periodontitis have increased risk for peri-implant disease development. Based on the fact that initial mucosae inflammation can easily conduct peri-implant bone loss38 and that RANKL/OPG system is detected in gingival tissues32 exerting a direct effect on bone resorption, we explored the intrinsic mechanism in subjects with a history of chronic periodontitis and its association with healing complications, which consequent implant loss.
between the occurrence of peri-implant disease and history of chronic periodontitis, considering the biologic interaction in the osteoclastogenesis system. Even without active periodontitis, subjects with a history of CP had elevated tissue levels of RANKL/OPG and higher correlation with peri-implant mucosae inflammation and implant loss, showing that the destructive pattern remains in the mucosa and bone of these risk subjects. Therefore, RANKL/OPG correlation may have a potential value as a biomarker for early complications in the peri-implant tissue. Overall, we encourage future studies to identify subjects at an increased risk for peri-implantitis. A detailed analysis of osteoclastogenesis and inflammatory biomarker mechanisms and their consequences should also be studied, and, in the long term, their effects on the osseointegration process.
References
1. Adell R, Lekholm U, Rockler B, Brånemark PI. A 15-year study of osseointegrated implants in the treatment of edentulous jaw. Int J Oral Surg. 1981, v 10, p 387-416
2. Albrektsson TO, Johansson CB, Sennerby L. Biological aspects of implant dentistry: osseointegration. Periodontol 2000. 1994, v 4, p 58–73.
3. Araújo AA, Lopes de Souza G, Souza TO, de Castro Brito GA, Sabóia Aragão K, Xavier de Medeiros CA, Lourenço Y, do Socorro Costa Feitosa Alves M, Fernandes de Araújo R Jr. Olmesartan decreases IL-1β and TNF-α levels; downregulates MMP-2, MMP-9, COX-2, and RANKL; and upregulates OPG in experimental periodontitis. Naunyn Schmiedebergs Arch Pharmacol. 2013, v 386(10), p 875-84.
4. Arikan F, Buduneli N, Kütükçüler N. Osteoprotegerin levels in peri-implant crevicular fluid. Clin Oral Implants Res. 2008, v 19(3), p 283-8.
5. Arikan F, Bubuneli N, Lappin DF. C-telopeptide pyridinoline crosslinks of type I collagen, soluble RANKL, and osteoprotegerin levels in crevicular fluid of dental implants with peri-implantitis: a case-control study. Int J Oral Maxillofac Implants. 2011, v 26(2), p 282-9.
6. Armitage GC. Periodontal diagnoses and classification of periodontal diseases. Periodontol 2000,2004, v.34, p.9-21.
7. Bartold PM, Cantley MD & Haynes DR. Mechanisms and control of pathologic bone loss in periodontitis. Periodontology. 2000, v 53, p 55–69.
8. Belibasakis GN, Bostanci N. The RANKL-OPG system in clinical periodontology. J Clin Periodontol. 2012, v 39(3), p 239-48.
9. Belibasakis GN, Meier A, Guggenheim B, Bostanci N. The RANKL-OPG system is differentially regulated by supragingival and subgingival biofilm supernatants. Cytokine. 2011, v 55, p 98–103.
10. Bostanci N, Ilgenli T, Emingil G, Afacan B, Han B, Töz H, Atilla G, Hughes FJ, Belibasakis GN. Gingival crevicular fluid levels of RANKL and OPG in
periodontal diseases: implications of their relative ratio. J Clin Periodontol. 2007, v 34(5), p 370-6.
11. Bostanci N, Ilgenli T, Emingil G, Afacan B, Han B, Töz H, Berdeli A, Atilla G, McKay IJ, Hughes FJ, Belibasakis GN. Differential expression of receptor activator of nuclear factor-kappaB ligand and osteoprotegerin mRNA in periodontal diseases. J Periodontal Res. 2007, v 42(4), p 287-293.
12. Boyle WJ, Simonet WS, Lacey DL. Osteoclast differentiation and activation. Nature. 2003, v 423, p 337-342.
13. Bradford MM. Rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 1976, v 72, p 248–254.
14. Bustin SA, Benes V, Garson JA, Hellemans J, Huggett J, Kubista M, Mueller R, Nolan T, Pfaffl MW, Shipley GL, Vandesompele J, Wittwer CT. The MIQE guidelines: minimum information for publication of quantitative real-time PCR experiments. Clin Chem. 2009, v 55(4), p 611-622.
15. Casado PL, Pereira MC, Duarte MEL, Granjeiro JM. History of chronic periodontitis is a high risk factor for peri-implant disease. Braz Dent J. 2013, v 24(2), p 134-141.
16. Casado PL, Villas-Boas R, Mello W, Duarte MEL, Granjeiro JM. Peri-implant disease and Chronic Periodontitis: Is Interleukin-6 Gene Promoter Polymorphism the common risk factor in a Brazilian population? Int J Oral Maxillofac Implants. 2013, v 28(1), p 35-43.
17. Casado PL, Canullo L, Filardy AA, Granjeiro JM, Barboza EP, Duarte MEL. Intreleukins 1B and 10 expressions in the periimplant crevicular fluid from patients with untreated periimplant disease. Implant Dent. 2013, v 22, p 1–8. 18. Chen B, Wu W, Sun W, Zhang Q, Yan F, Xiao Y. RANKL E xpression in
Periodontal Disease: Where Does RANKL Come from? BioMed Res Int. 2014, Article ID 731039, 7 pages.
19. Cochran, D.L. Inflammation and bone loss in periodontal disease. Journal of Periodontology. 2008, v 79 (8), p 1569–1576.
20. Crotti T, Smith MD, Hirsch R, Soukoulis S, Weedon H, Capone M, Ahern MJ, Haynes D. Receptor activator NF kappaB ligand (RANKL) and osteoprotegerin (OPG) protein expression in periodontitis. J Periodontal Res. 2003, v 38, p 380–387.
21. Dereka XE, Markopoulou CE, Fanourakis G, Tseleni-Balafouta S, Vrotsos IA. RANKL and OPG mRNA level after non-surgical periodontal treatment. Inflammation. 2010, v 33, p 200–206.
22. Duarte PM, de Mendonça AC, Máximo MB, Santos VR, Bastos MF, Nociti Júnior FH. Differential cytokine expressions affect the severity of peri-implant disease. Clin Oral Implants Res. 2009, v 20(5), p 514-20.
23. Dutzan N, Gamonal J, Silva A, Sanz M, Vernal R. Over-expression of forkhead box P3 and its association with receptor activator of nuclear factor-kappa B ligand, interleukin (IL) -17, IL-10 and transforming growth factor-beta during the progression of chronic periodontitis. Journal of Clinical Periodontology. 2009, v 36, p 396–403.
24. Garlet GP, Martins WJr, Fonseca BA, Ferreira BR, Silva JS. Matrix metalloproteinases, their physiological inhibitors and osteoclast factors are differentially regulated by the cytokine profile in human periodontal. J Clin Periodontol. 2004, v 31(8), p 671-679.
25. Giannopoulou C, Martinelli-Klay CP, Lombardi T . Immunohistochemical expression of RANKL, RANK and OPG in gingival tissue of patients with periodontitis. Acta Odontol Scand. 2012, v 70(6), p 629-34.
26. Graves D. Cytokines that promote periodontal tissue destruction. J Periodontol. 2008, v 79, p 1585–1591.
27. Hughes AE, Ralston SH, Marken J, Bell C, MacPherson H, Wallace RG, van Hul W, Whyte MP, Nakatsuka K, Hovy L, Anderson DM. Mutations in
TNFRSF11A, affecting the signal peptide of RANK, cause familial expansile osteolysis. Nat Genet. 2000, v 24(1), p 45-48.
28. Hultin M, Gustafsson A, Hallstrom H, Johansson LA, Ekfeldt A, Klinge B. Microbiological findings and host response in patients with peri-implantitis. Clin Oral Implants Res. 2002, 13, p 349-358.
29. Kadkhodazadeh M, Ebadian AR, Gholami GA, Khosravi A, Tabari ZA. Analysis of RANKL gene polymorphism (rs9533156 and rs2277438) in Iranian patients with chronic periodontitis and periimplantitis. Arch Oral Biol. 2013, v 58(5), p 530-6.
30. Kadkhodazadeh M, Tabari ZA, Ardakani MR, Ebadian AR, Brook A. Analysis of osteoprotegerin (OPG) gene polymorphism in Iranian patients with chronic periodontitis and peri-implantitis. A cross-sectional study. Eur J Oral Implantol. 2012, v 5(4), p 381-8.
31. Kinane, D. F., Preshaw, P. M. & Loos, B. G. Host-response: understanding the cellular and molecular mechanisms of host-microbial interactions–consensus of the Seventh European Workshop on Periodontology. J Clin Periodontol. 2011, v 38(11), p 44 –48.
32. Lu HK, Chen YL, Chang HC, Li CL, Kuo MY. Identification of the osteoprotegerin/ receptor activator of nuclear factor- kappa B ligand system in gingival crevicular fluid and tissue of patients with chronic periodontitis. J Periodont Res. 2006, v 41, p 354–360.
33. Menezes R, Garlet TP, Letra A, Bramante CM, Campanelli AP, Figueira Rde C, Sogayar MC, Granjeiro JM, Garlet GP. Differential patterns of receptor activator of nuclear factor kappa B ligand/osteoprotegerin expression in human periapical granulomas: possible association with progressive or stable nature of the lesions. J Endod. 2008, v 34(8), p 932-8.
34. Mogi M, Otogoto J, Ota N, Togari A. Differential expression of RANKL and osteoprotegerin in gingival crevicular fluid of patients with periodontitis. J Dent Res. 2004, v 83, p 166–169.
35. Mombelli A, Lang NP. The diagnosis and treatment of periimplantitis. Periodontol. 2000, v 17, p 63–76.
36. Parithimarkalaignan S, Padmanabhan TV. Osseointegration: Na upadate. J Indian Protsthodont Soc. 2013, v 13(1), p 2-6.
37. Pjetursson BE, Tan K, Lang NP, Bragger U, Egger M, Zwahlen M. A systematic review of the survival and complication rates of fixed partial dentures (FPDs) after an observation period of at least 5 years. Clin Oral Implants Res. 2004, v 15, p 625–642.
38. Rakic M, Struillou X, Petkovic-Curcin A, Matic S, Canullo L, Sanz M, Vojvodic D. Estimation of Bone Loss Biomarkers as a Diagnostic Tool for Peri-Implantitis. J Periodontol. 2014, v 30, p 1-12.
39. Roos-Jansaker AM, Renvert S, Egelberg J. Treatment of periimplant infections: a literature review. J Clin Periodontol. 2003, v 30, p 467–485.
40. Saika M, Inoue D, Kido S, Matsumoto T. 17beta-estradiol stimulates expression of osteoprotegerin by a mouse stromal cell line, ST-2, via estrogen receptor-alpha. Endocrinology. 2001, v 142(6), p 2205–12.
41. Sakellari D, Menti S, Konstantinidis A. Free soluble receptor activator of nuclear factorkb ligand in gingival crevicular fluid correlates with distinct pathogens in periodontitis patients. J Clin Periodontol. 2008, v 35, p 938–943. 42. Schenk RK, Buser D. Osseointegration: a reality. Periodontol 2000, 1998, v
17, p 22-35.
43. Wara-aswapati N, Surarit R, Chayasadom A, Boch JA, Pitiphat W. RANKL upregulation associated with periodontitis and Porphyromonas gingivalis. J Periodontol. 2007, v 78, p 1062–1069.
44. Wuyts W, Van Wesenbeeck L, Morales-Piga A, Ralston S, Hocking L, Vanhoenacker F, Westhovens R, Verbruggen L, Anderson D, Hughes A, Van Hul W. Evaluation of the role of RANK and OPG genes in Paget`s disease of bone. Bone. 2001, v 28(1), p 104-7.
45. Zaidi M. Skeletal remodeling in health and disease. Nat. Med. 2007 v 13, p 791–801.
46. Zitzmann NU, Berglundh T. Definition and prevalence of peri- implant diseases. J Clin Periodontol. 2008, v 35, p 286-91.
Table 1. Baseline characteristics of all subjects Total (n= 49 ) Control (n= 26 ) Chronic Periodontitis (n= 23 )
P-value Odds ratio (CI)
n (%) n (%) n (%) Ethinic group Caucasians 26 (53) 14 (53) 12 (52) 0.90 0.94 (0.26-3.34) Non-Caucasians 23 (47) 12 (47) 11 (48) Age (years) 56.5±9.9 54.9±10.22 58.4±9.3 0.88 --- Gender Female 36 (73.4) 19 (73.1) 17 (73.9) 0.94 1.04 (0.25-4.46) Male 13 (26.5) 7 (26.9) 6 (26.1) Smoking Non-smoking 46 (93.9) 26 (100) 20 (87.0) 0.05 0.00 (0.00-1.95) Smoking 3 (6.1) 0 3 (13.0) Alcohol Consumption No 48 (98.0) 26 (100) 22 (95.7) 0.28 0.00 (0.00-15.78) Yes 1 (2.0) 0 1 (4.3)
Table 2. Patients clinical findings and anamnesis data. Parameters Total (n= 49 ) Control (n= 26 ) Chronic Periodontitis (n= 23)
P-value Odds ratio (CI)
n (%) n (%) n (%)
General Medical Condition
Other systemic diseases 8 (16.3) 5 (19.2) 3 (13.4) 0.56 0.63 (0.10-3.64) Diabetes 1(2.4) 1(3.8) 0 0.34 0.00 (0.00-20.28) Rheumatoid diseases 0 0 0 --- ---
Osteoporosis 1(2.4) 1(3.8) 0 0.34 0.00 (0.00-20.28) High blood pressure 4(8.1) 3(11.5) 1(4.3)
Cardiovascular diseases 0 0 0 Hypothyroidism 1(2.4) 1(3.8) 0 0.34 0.00 (0.00-20.28) Asthma 0 0 0 --- --- Hepatitis B 1(2.4) 0 1 (43) 0.28 RR 2.18 (1.60-2.97) Current medication Anti-hypertension 5(10.2) 3(11.5) 2(8.6) 0.74 0.73 (0.08-6.20) Antimicrobials 0 0 0 --- --- NSAIDs† 0 0 0 --- --- SAIDs‡ 0 0 0 --- --- Hormone reposition 3(6.1) 3(11.5) 0 0.09 0.00 (0.00-2.54) Antidepressant 1(2.4) 1(3.8) 0 0.34 0.00 (0.00-20.28) Anti-epileptic 1(2.4) 1(3.8) 0 0.34 0.00 (0.00-20.28) Clinical measurements Total Edentulism 9(18.3) 2(7.6) 7(30.4) 0.04 5.25 (0.82-42.38) Partial Edentulism 40(81.6) 24(92.3) 16(69.5) 0.08 0.29 (0.05-1.51) Oral Hygiene Satisfactory Unsatisfactory Region of tooth loss Maxilla Mandible 44(89.8) 5(10.2) 32(65,3) 17(34,7) 26(100) 0 17(65,4) 9(34,6) 18(78.3) 5(21.7) 15(65,2) 8(34,8) 0.01 0.99 2.44 (1.71-3.49) 0.99 (0.26-3.79)
Table 3. Peri-implant status of subjects.
CI: confidence interval; RR: Relative risk Peri-implant status Total
(n= 49 ) Control (n= 26) Chronic Periodontitis (n= 23)
P-value Odds Ratio (CI)
n (%) n (%) n (%) Spontaneous bleeding 0 0 0 --- Red mucosae 7 (14.3) 1 (3.9) 6 (26.1) 0.02 8.82 (0.89-212.83) Edema 2 (4.0) 0 2 (8.6) 0.12 RR 2.24 (1.63-3.08) Pus 1(2.0) 0 1 (4.3) 0.28 RR 2.18 (1.60-2.97) Mobility (presence) 2(4.0) 0 2 (8.6) 0.12 RR 2.24 (1.63-3.08) Implant region Superior 33 (67.3) 17(65.3) 16 (69.5) 0.75 1.21 (0.31-4.76) Inferior 16 (32.7) 9 (34.7) 7 (30.5) Screw Exposure 2 (4.1) 1 (3.8) 1(4.3) 0.92 1.14 (0.0-44.78) Peri-implant Plaque 1 (2.0) 0 1 (43) 0.28 RR 2.18 (1.60-2.97) Implant loss 2 (4.0) 0 2 (4.0) 0.12 RR 2.24 (1.63-3.08)
Table 4. Correlation between history of chronic periodontitis and harmful peri-implant healing.
Uneventful healing
Harmful healing
p-value Odds ratio (CI)
Control group (n=26) 24 2 <0.0001 27.43 (4.28-228.63)
CP group (n=23) 7 16
Table 5. Implant platform type and uneventful healing.
Legend: External Hexagon (HE) Internal Hexagon (IH) Morse Cone (MC).
Implant-platform Type Uneventful Healing Harmful Healing p-value EH 3 3 0.28 IH 1 3 MC 25 14
Table 6. Multinomial logistic regression results for CP group (reference= control group).
Parameter Z p-value Odds
Ratio 95% CI RANKL/OPG -0.13 0.89 0.98 0.74-1.28 Age -0.82 0.41 0.96 0.89-1.04 Uneventful healing -2.63 0.009 0.88 0.14-0.53 CI: confidence interval
C o n t r o l C h r o n ic P e r io d o n t it is 0 1 0 2 0 3 0 4 0 R A N K L /O P G e x p r e s s io n
Graphic 1. Messenger RNA expression levels of RANKL and OPG genes in mucosae samples. Values represent the relative expression as determined by 2-∆∆CT.
Figura 2. Immunohistochemical staining for RANKL and OPG (brown staining) showed marked
Figure 1. RANKL/OPG protein expression in Western Blot analysis from eight subjects. Note marked expression of RANKL and downexpression of OPG in CP subjects (Columns 1-3).
Chronic
Figura 2. Immunohistochemical staining for RANKL and OPG (brown staining) showed marked difference between peri-implant mucosae from control and CP subjects.
4 – Conclusões
1. Indivíduos com histórico de periodontite crônica tem níveis elevados de RANKL / OPG no tecido peri-implantar.
2. Os níveis elevados de RANKL / OPG tem correlação com inflamação da mucosa ao redor do implante e perda do implante.
ANEXO A – Aprovação do Comitê de Ética em Pesquisa
Plataforma Brasil - Ministério da Saúde
Faculdade de Medicina da Universidade Federal Fluminense/ FM/ UFF/ HU Antônio Pedro
PROJETO DE PESQUISA
Título: Análise da expressão do fator nuclear Kappa-B ligante e
osteoprotegerina na mucosa peri- implantar
Área Temática:
Pesquisador: Priscila Ladeira Casado
Instituição: Faculdade de Medicina da Universidade Federal
Fluminense/ HU Antônio Pedro
Versão: 3
CAAE: 00706212.9.0000.5243
Número do Parecer: 80627
PARECER CONSUBSTANCIADO DO CEP
Data da Relatoria: 06/09/2012
Apresentação do Projeto:
O Receptor ativador do fator nuclear Kappa-B ligante (RANKL) e a Osteoprotegerina (OPG) são fatores que podem ser instrumentos na mediação
da reabsorção óssea através da interação RANKL / RANK/OPG na interface do tecido ósseo-conjuntivo. Até o momento, não está claro a correlação
deste sistema de controle da osteoclastogênese na região peri-implantar. Objetivo: analisar a expressão de
RANKL e OPG na mucosa peri-implantar
em humanos submetidos à instalação de implantes dentários endósseos. Material e Métodos: Trinta pacientes submetidos a cirurgia de instalação
do implante endósseo por meio da técnica de dois estágios cirúrgicos serão incluídos no estudo e submetidos a reabertura para exposição do
implante. Os critérios de exclusão incluem doença sistêmica e uso de bifosfonato. As regiões peri-implantares incluídas na pesquisa serão
classificadas antes da reabertura de acordo com a presença ou não de exposição precoce do implante. Os descartes cirúrgicos obtidos da mucosa
peri-implantar durante a cirurgia para exposição do implante serão armazenados em solução contendo 1ml de
RNA later para estabilização do RNA
e imediatamente congelados a -200C. Posteriormente, o RNA total será extraído e mensurado. A quantidade de
1,0¿g de RNAm será transformada
em DNA complementar (cDNA). A expressão de RANKL/OPG será analisada a partir das amostras, utilizando iniciadores desenhados para
amplificar os genes selecionados. O tecido peri-implantar será clinicamente avaliado quanto à coloração gengival, presença de sangramento à
sondagem, sangramento espontâneo, profundidade clinica de sondagem. A avaliação clinica será feita 15 dias e 1 ano após a exposição do
implante. Os implantes serão radiografados utilizando radiografia periapical e posicionador radiográfico, objetivando padronizar as medidas do nível
ósseo peri-implantar durante 1 ano. A quantificação do nível ósseo peri-implantar será feita 15 dias e 1 ano após a exposição do implante. Esperase
com este trabalho elucidar se a expressão destes marcadores no tecido gengival ao redor do implante pode influenciar no aspecto clinicoradiográfico
