Molecular characterization of Chaetomium species using URP-PCR

(1)

Molecular characterization of

Chaetomium

species using URP-PCR

Rashmi Aggarwal

1

, Vandana Sharma

2

, Lalit L. Kharbikar

1

and Renu

1

_{Fungal Molecular Plant Pathology Laboratory, Division of Plant Pathology,}

Indian Agricultural Research Institute, New Delhi, India.

2

_{Centre for Advanced Research in Medical Mycology, Department of Medical Microbiology,}

PGIMER, Chandigarh, India.

Abstract

Chaetomium spp. are common colonizers of soil and cellulose-containing substrates. Seventeen isolates of Chaetomium spp., which included 15 isolates of C. globosum and one each of C. reflexum and C. perlucidum, were genetically characterized with universal rice primers (URP - primers derived from DNA repeat sequences in the rice genome) using polymerase chain reaction (URP-PCR). Out of the 12 URP’s used in the study, nine primers were ef-fective in producing polymorphic fingerprint patterns from DNA ofChaetomium spp. Analysis of the entire fingerprint profile using the unweighted pair-group method with arithmetic averages (UPGMA) clearly differentiated C. globosum isolates from C. perlucidum and C. reflexum. One of the primers, URP-2R, produced a uniform DNA band of 1.9 kb in all the isolates ofC. globosum but not in C. perlucidum and C. reflexum, which can be used as molecular marker to differentiateC. globosum from other species. Our results indicate that URP’s are sensitive and give repro-ducible results for assaying the genetic variability inChaetomium spp.

Key words: Chaetomium globosum, Chaetomium reflexum, Chaetomium perlucidum, genetic variability, URP-PCR.

Received: April 10, 2008; Accepted: June 30, 2008.

Chaetomium is a genus belonging to the class

Pyrenomycetes (Ascomycotina), order Sordariales and family Chaetomiaceae. It is found extensively on various agricultural commodities. The genus can produce an

Acremonium-like state (imperfect stage) on culture media

and is characterized by superficial flask-shaped perithecia, which are surrounded by dark, stiff hairs. C. globosum is one of the commonest species growing saprophytically in the rhizosphere and phyllosphere. It is a common colonizer of soil and cellulose-containing substrates and has been re-ported to be a potential biocontrol agent. C. globosum has been reported effective in minimizing damage caused by seed rot and damping off, due to several seed-borne and soil-borne plant pathogens like Pythium ultimum, Alternaria raphani, A. brassicol and Fusarium spp.

(Har-man et al., 1978; Vannacci and Har(Har-man, 1987).

The seedling blight caused by Rhizoctonia solani has been successfully controlled by seed treatment with

Chaetomium spp. (Baker, 1968). C. globosum has also

shown an antagonistic effect against rice blast (Pyricularia

oryzae) (Soyton and Quimio, 1989). Our recent studies

have indicated its bioefficacy in controlling spot blotch of wheat caused by Cochliobolus sativus (Aggarwal et al.,

2004). Biochemical characterization of the fungus has shown the production of β 1,3-glucanase and xylanase (Ahammed SK, Ph.D. Thesis, Indian Agricultural Research Institute, New Delhi, India, 2003; Ahammed et al., 2008).

C. globosum has a great potential as a biocontrol agent and

has been classified based on morphological descriptions of colony growth and perithecia (Millner et al., 1997; Ahammed et al., 2004; 2005a), but this is not sufficient and a significant variation needs to be defined for each strain at the molecular level. C. reflexum and C. perlucidum are two other species, morphologically very similar to C.

globosum. Therefore, there is a need for molecular markers

to characterize differences at the inter and intraspecific level.

Repeat sequences from Korean weedy rice, originally referred to as universal rice primer (URP), have been used for the fingerprinting of diverse genomes of plants, animals and microbes (Kang et al., 2002), but only very few fungi (Kang et al., 2001; Kang et al., 2002; Jana et al., 2005).

Chaetomium globosum isolates had been characterized

ear-lier by the PCR-RAPD technique (Ahammed et al., 2005b). However, the use of repetitive sequences derived from plant genomes as molecular markers has not received atten-tion in the fingerprinting of this fungus. The objective of our study was to use URP’s for generating DNA fingerprint profiles of different C. globosum isolates and compare

Genetics and Molecular Biology, 31, 4, 943-946 (2008)

Send correspondence to Rashmi Aggarwal. Fungal Molecular Plant Pathology Laboratory, Division of Plant Pathology, Indian Agricul-tural Research Institute, 110 012 New Delhi, India. E-mail: rashmiiari@yahoo.com.

(2)

them with C. reflexum and C. perlucidum, in order to genet-ically differentiate the species.

Pure cultures of 15 Chaetomium globosum isolates (Cg1-Cg15) and one isolate each of C. reflexum (Cr) and C.

perlucidum (Cp) collected from various locations of India

were established. For DNA isolation, the cultures were grown in potato dextrose broth (PDB; pH 5.5) for 7 days at 28 ± 1 °C in a shaker incubator. Mycelia were filtered through filter paper (Whatman n. 1) and DNA was ex-tracted using the cetyltrimethyl ammonium bromide (CTAB) method (Murray and Thompson, 1980). The my-celium was ground in liquid nitrogen, transferred to DNA extraction buffer (0.1 M Tris, 1.5 M NaCl, 0.01 M EDTA) and kept at 65 °C for one hour with occasional stirring. Equal volumes of chloroform:isoamyl alcohol (24:1) were added to all tubes, followed by centrifugation. The upper aqueous phase obtained by precipitation with 0.6thvolume of ice-cold isopropanol was again centrifuged. The pellet was washed with 70% ethanol and dried at room tempera-ture. Finally, the nucleic acid was dissolved in TE and stored at -20 °C.

URP’s are primers with 20 oligonucleotides each, originally obtained from repeat elements of weedy rice by Kang et al. (2002). There are 12 URP primers which were synthesized by Genuine Chemical Corporation (GCC), India. PCR was performed in a Temperature Gradient Ther-mal Cycler (BioRAD, USA). Concentrations of DNA tem-plate, primer and deoxynucleotide triphosphates (dNTPs) and the optimum annealing temperature were standardized for each primer in preliminary trials to obtain DNA finger-print profiles (Table 1). Each PCR reaction contained 50-100 ng of genomic DNA, 200μM of each dNTP (dATP, dGTP, dCTP and dTTP), 0.2μM primer, 1.5 mM MgCl2,

2.5 U Taq DNA polymerase, and 1X Taq buffer in a total reaction volume of 25 μL. Thermal cycling conditions were: initial denaturation at 94 °C for 4 min, followed by 35 denaturation cycles at 94 °C for 1 min, annealing at 55 °C

for 1 min, and extension at 72 °C for 2 min. A final exten-sion step at 72 °C for 7 min was also performed.

The URP - PCR products were electrophoresed on a 1.2% agarose gel in TBE buffer, visualized by staining with ethidium bromide and photographed using a Gene Genius Gel Documentation System (Syngene Inc, Cambridge, UK).

Relatedness among the 17 isolates of Chaetomium spp. was estimated by means of scorable DNA bands am-plified from different URP markers. Each band was consid-ered as character and was scored as either present (coded as 1) or absent (coded as 0). Cluster analysis with the un-weighted pair group method with an arithmetic average (UPGMA) algorithm was performed using NTSYS-PC (v. 2.01; Rohlf, 1998) to produce a dendrogram. The experi-ments were repeated three times, and each time identical re-sults were obtained.

Twelve oligonucleotide primers (URP’s) were used for the molecular analysis of 15 isolates of Chaetomium

globosum and one isolate each of C. reflexum and C. perlucidum. These isolates were used as templates to assess

the wide distribution of the URP nucleotide motif se-quences in the genome of Chaetomium spp. Nine URP’s out of 12 gave good amplification in all the C. globosum, C.

reflexum and C. perlucidum isolates used in this study.

Dif-ferent levels of polymorphism were obtained with these primers (Table 1). Amplification products for all primers were polymorphic, except for URP-30F, which produced a monomorphic band. The amplified DNA bands ranged from 250 bp to 3000 bp for each isolate.

Amplification with primer URP-2R produced a uni-form DNA band of 1.9 kb in all the isolates of C. globosum, but not in C. reflexum and C. perlucidum (Figure 1a). The data on banding pattern with this primer was analyzed, and the dendrogram obtained showed the formation of two ma-jor clusters with C. perlucidum separating out singly, show-ing only 33% similarity with the C. globosum and C.

reflexum isolates. In cluster I, there was 100% similarity

944 Aggarwal et al.

Table 1 - Sequences of Universal Rice Primers (URP’s) and polymorphism obtained in Chaetomium spp.

Primer Sequence (5’ - 3’) GC content (%) Temp. (°C) Total n. of bands Polymorphic bands Monomorphic bands % polymorphism 1. URP-6R GGCAAGCTGGTGGGAGGTAC 50 65 13 13 - 100 2. URP-4R AGGACTCGATAACAGGCTCC 50 66 8 8 - 100 3. URP-30F GGACAAGAAGAGGATGTGGA 50 65 8 7 1 87.5 4. URP-25F GATGTGTTCTTGGAGCCTGT 50 65 8 8 - 100 5. URP-1F ATCCAAGGTCCGAGACAACC 50 65 8 8 - 100 6. URP-2F GTGTGCGATCAGTTGCTGGG 50 67 7 7 - 100 7. URP-9F ATGTGTGCGATCAGTTGCTG 50 67 7 7 - 100 8. URP-2R CCCAGCAACTGATCGCACAC 50 65 10 10 - 100 9. URP-17R AATGTGGGCAAGCTGGTGGT 55 74 10 10 - 100 Total 79 78 1 98.61

(3)

between isolates Cg2 and Cg 8, Cg12 and Cg 13, and Cg 10 and Cg 11, while in cluster II, Cg4, Cg5, Cg6 and Cg7 ex-hibited 100% similarity. The C. reflexum isolate separated out in this cluster, showing 82% similarity with the above isolates and with the C. globosum isolate Cg3 (Figure 1b). A DNA band of 1300 bp was specifically amplified by primer URP-6R only in C. reflexum and not in any of the C.

globosum and C. perlucidum isolates (Results not shown).

On the other hand, URP-4R amplified a band of 1200 bp specific to C. perlucidum and not present in any isolate of

C. globosum and C. reflexum (Results not shown). The

analysis based on individual URP primers (URP-2R, URP-4R and URP-6R) indicated a high level of genetic similarity between isolates Cg4, Cg6, Cg7 and Cg9 in one cluster and Cg10, Cg11, Cg12, Cg13, Cg14 and Cg15 in a separate cluster, in spite of the fact that they were obtained from different geographical regions of India.

Phylogenetic analysis of a combined data set obtained from nine URP’s showed formation of two main clusters with only 65.3% similarity between them (Figure 2). The dendrogram showed high genetic similarity among differ-ent isolates of C. globosum obtained from differdiffer-ent sources. Cluster I consisted of isolates Cg1, Cg9, Cg4, Cg5, Cg6, Cg7 and C. perlucidum and C. reflexum. Bootstrap analysis indicated that, within this cluster, isolates Cg4 and Cg6 showed 53.9% similarity, and these two isolates showed 92.4% similarity with Cg5. Isolate Cg9 and C. reflexum formed a separate group within cluster I, separating out at a

bootstrap value of 21 from the other isolates and C.

perlucidum. Within this cluster, isolates Cg4 and Cg5

showed 93% similarity. The other C. globosum isolates were grouped into cluster II, in which Cg2 and Cg3 showed a high bootstrap value (98.2%), forming a separate sub-group within this cluster. This sub-group showed > 63% genetic similarity among the isolates. Isolate Cg8 separated out from this other subgroup within this cluster at the bootstrap value of 54.6%, having the rest of the isolates viz., Cg10, Cg11, Cg12, Cg13, Cg14 and Cg15. In our earlier studies on molecular characterization of C. globosum using RAPD primers, nine isolates were grouped into two distinct clus-ters, with isolates Cg2, Cg3 and Cg4 in one cluster and the remaining isolates in another (Ahammed et al., 2005b). Ge-netic diversity using AFLP markers in this fungus was also explored earlier (Aggarwal et al., 2003), showing that five

C. globosum isolates formed two distinct clusters, one

com-prising isolates Cg6, Cg7 and Cg8, and the other encom-passing isolates Cg1 and Cg5. The use of URP markers in the present study enabled us to distinguish 15 different C.

globosum isolates collected from different sources, and

also from C. reflexum and C. perlucidum. Previous studies have indicated that these rice repeat sequences based on which the URP primers were designed are conserved in fungi too, enabling us to detect the variations at the inter-specific and intrainter-specific levels. There is one previous re-port on the use of URP’s for the genetic differentiation of a fungus, Macrophomina phaseolina (Jana et al., 2005). Our analysis revealed that 75% of the URP’s could amplify the scorable and reproducible bands with genomic DNA of

Chaetomium globosum, C. perlucidum and C. reflexum

iso-lates. Primers URP-6R, URP-4R and URP-2R produced distinct amplification profiles among the Chaetomium spp. isolates used in the present study and were therefore con-sidered the best markers. All URP primers, except URP-30F, revealed more polymorphism in our study, although

URP-PCR of Chaetomium spp. 945

Figure 1 - (a) DNA fingerprint profile of different Chaetomium spp.

iso-lates obtained with primer URP-2R. M is the 1 kb DNA ladder (MBI, Fermenats), Lanes 1-15, isolates of C. globosum, Cr - C reflexum, Cp - C.

perlucidum. (b) Dendrogram obtained from 17 isolates of Chaetomium

spp. with UPGMA-based similarity coefficient, using primer URP-2R.

Figure 2 - Dendrogram obtained after combined bootstrap analysis. The

numbers at the forks show the percentage of times the group consisting of the species which are to the right of that fork occurred. Cg = Chaetomium

(4)

the results of Kang et al. (2001, 2002) and Jana et al. (2005) showed more polymorphism with primers having a GC content > 50%. Primers 13 R, 32F and URP-38F (Kang et al., 2002) did not amplify the genomic DNA of Chaetomium spp. in this study. The genetic differentia-tion of C. globosum isolates has a great significance, con-sidering that our earlier findings have indicated the potentiality of this fungus as a biocontrol agent (Aggarwal

et al., 2004).

The present investigation shows that URP-PCR fin-gerprinting is a valuable tool for rapid identification and differentiation of fungal strains. PCR fingerprints have shown high DNA polymorphism between strains of the same species and even between different Chaetomium spp. Moreover, our purpose of using URP markers was to differ-entiate the strains of C. globosum and also to develop spe-cies-specific markers. Amplification with URP-2R produced a uniform band of 1.9 kb in all the C. globosum isolates, but not in C. perlucidum and C reflexum. Further work on cloning and sequencing of this amplicon to de-velop a SCAR marker is in progress.

Acknowledgments

The authors are thankful to the Head of the Division of Plant Pathology, IARI, New Delhi - 110012, India, for providing facilities, and to the Indian Council of Agricul-tural Research, New Delhi, India, for financial support by providing a National Fellow Project Grant (Code n. 16-46).

References

Aggarwal R, Srinivas P, Malathi VG and Renu (2003) Evaluation of genetic diversity of Chaetomium globosum, a potential biocontrol agent by amplified fragment length polymor-phism (AFLP). Indian Phytopath 56:313 (Abstr.).

Aggarwal R, Tiwari AK, Srivastava KD and Singh DV (2004) Role of antibiosis in the biological control of spot blotch (Cochliobolus sativus) of wheat by Chaetomium globosum. Mycopathologia 157:369-377.

Ahammed SK, Aggarwal R and Srivastava KD (2004) Colony characteristics and bioefficacy of different isolates of

Chaetomium globosum Krunze ex Fr. against Bipolaris sorokiniana (Sacc.) Shoem. J Biol Control 18:167-171.

Ahammed SK, Aggarwal R and Singh DV (2005a) Morphological variability in different isolates of Chaetomium globosum. Indian Phytopath 58:71-74.

Ahammed SK, Aggarwal R and Renu (2005b) Use of PCR based RAPD technique for characterization of Chaetomium

globosum isolates. Acta Phytopath Entomol Hungarica

40:303-314.

Ahammed SK, Aggarwal R and Kapoor HC (2008) Production, partial purification and characterization of extracellular xylanase from Chaetomium globosum. J Plant Biochem Biotechnol 17:95-98.

Baker R (1968) Mechanism of biological control of soil borne pathogens. Annu Rev Phytopath 6:263-294.

Harman GE, Eckenrode CJ and Webb DR (1978) Alteration of spermosphere ecosystems affecting oviposition by the bean seed fly and attack by soil borne fungi on germinating seeds. Ann Appl Biol 90:1-6.

Jana TK, Singh NK, Koundal KR and Sharma TR (2005) Genetic differentiation of charcoal rot pathogen, Macrophomina

phaseolina, into specific groups using URP-PCR. Can J

Microbiol 51:159-164.

Kang HW, Park DS, Go SJ and Eun MY (2001) Genomic differ-entiation among oyster mushrooms (Pleurotus spp.) cult-ivars released in Korea by URP-PCR. Mycobiology 29:85-89.

Kang HW, Park DS, Park YJ, You CH, Lee BM, Eun MY and Go SJ (2002) Fingerprinting of diverse genomes using PCR with universal rice primers generated from repetitive se-quence of Korean weedy rice. Mol Cells 13:281-7. Millner PD, Motta JJ and Lentz PL (1997) Ascospores, germpore,

ultrastructure and thermophilism of Chaetomium. Myco-logia 69:722-733.

Murray MG and Thompson WF (1980) Rapid isolation of high molecular weight plant DNA. Nucleic Acids Res 8:4321-4326.

Rohlf FJ (1998) NTSYS-PC. Numerical Taxonomy and Multiva-riate Analysis System, v. 2.02. Exeter Software, Setauket. Soytong K and Quimio TH (1989) Antagonism of Chaetomium

globosum to rice blast pathogen Pyricularia oryzae.

Kaset-sart J Nat Sci 23:198-203.

Vannacci G and Harman GF (1987) Biocontrol of seed borne

Alternaria raphani and A. brassicicola. Can J Microbiol

33:850-856.

Associate Editor: Luis Carlos de Souza Ferreira

License information: This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.